CN104250649B - The new Disease-causing gene of the white first syndrome of the few hair of Keratoderma and its encoding proteins matter and application - Google Patents
The new Disease-causing gene of the white first syndrome of the few hair of Keratoderma and its encoding proteins matter and application Download PDFInfo
- Publication number
- CN104250649B CN104250649B CN201410429164.6A CN201410429164A CN104250649B CN 104250649 B CN104250649 B CN 104250649B CN 201410429164 A CN201410429164 A CN 201410429164A CN 104250649 B CN104250649 B CN 104250649B
- Authority
- CN
- China
- Prior art keywords
- gja1
- keratoderma
- mutation
- syndrome
- white
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention identifies the new Disease-causing gene GJA1 gene related to the white first syndrome of the few hair of Keratoderma.Specifically, using the few white first syndrome illness family of hair of Keratoderma as research object, sequencing of extron group is carried out to the diseased individuals in family and non-diseased individual and compared, finds the Disease-causing gene that GJA1 genes are the disease, and following several pathogenic mutations are found in GJA1 genes：c.23G>T[p.Gly8Val]、c.412G>C [p.Gly138Arg], c.689 690delAT [p.Tyr230Cysfs*7], these mutation cause GJA1 protein translations mistake or interrupted in advance.On this basis, the invention provides the GJA1 genes of mutation and its encoding proteins matter, the carriers of the GJA1 genes comprising mutation, host cell and system, kit and method for screening the biological sample for being susceptible to suffer from the disease.Using the GJA1 genes of the mutation, molecule diagnosis can be carried out to the few white first syndrome of hair of Keratoderma and risk is evaluated.The mutator and its encoding proteins matter are alternatively arranged as treating the drug target of the white first syndrome of the few hair of Keratoderma.
Description
Technical field
The present invention relates to a kind of gene of human variation, more particularly to a kind of Keratoderma-few Mao-white first syndrome is new
Disease-causing gene-GJA1 genes.The invention further relates to the GJA1 genes of mutation and its encoding proteins matter, the GJA1 genes comprising mutation
Carrier, host cell and for screen be susceptible to suffer from the disease biological sample system, kit and method.
Background technology
Keratoderma-few Mao-white first syndrome (Keratoderma-Hypotrichosis-Leukonychia
Totalis Syndrome, KHLS) it is a kind of extremely rare autosomal dominant skin disease, include the work of inventor
Make, at present only 3 Case reports (including 2 familial cases).Keratoderma-few Mao-white first syndrome is mainly shown as
There is oligotrichosis, leukonychia totalis in the near future in birth, and gradually pityriasis rubra keratotic papule occurs in trunk, four limbs, crissum, can companion
There is the clear erythema of boundary.Pityriasis rubra keratotic papule can merge in friction part, form the keratosa patch of large stretch of black.
The positions such as angling, popliteal nests are particularly evident, and ichthyosis hystrix sample outward appearance is presented.Patient brothers can occur slapping plantar angling, involve
Brothers back.Skin histopathology can see obvious hyperkeratinization, hair follicle keratotic plug, and a small amount of inflammatory cell in skin corium
Infiltration.Hair ESEM can see dry multiple pitting, and hair cuticle significant degradation.This disease has a strong impact on patient
Outward appearance and quality of life.Previously this disease is classified as autosomal dominant palm plantar angling-few hair syndrome (OMIM
104100), Disease-causing gene is still not clear.
Recently, sequencing of extron group (exome sequencing) is successfully applied to find rare single-gene disorder
Disease-causing gene, such as the MYH3 genes of Freeman-Sheldon syndromes, the SETBP1 bases of Schinzel-Giedion syndromes
Cause, and seriously WDR62 mutation of big deformity of brain etc..Full extron sequencing technologies, which are proven, reduces rare single-gene disease
Sick candidate gene even finds strong, the effective means of its Disease-causing gene, only by several seldom individuals (including patient and
Normal control) full extron be sequenced to screen the variation related to disease, its success rate significantly increases.Therefore, originally grind
Study carefully the new pathogenic mutation that Keratoderma-few Mao-white first syndrome is looked for using sequencing of extron group technology, be somebody's turn to do to abundant
The clinical gene detection range of disease.
The content of the invention
It is a primary object of the present invention to differentiate the new Disease-causing gene of Keratoderma-few Mao-white first syndrome, orient
The gene mutation site of the disease.On this basis, there is provided the Disease-causing gene and its volume of Keratoderma-few Mao-white first syndrome
Code protein, carrier, host cell comprising Keratoderma-few Mao-white first syndrome Disease-causing gene and is susceptible to suffer from for screening
System, kit and the method for the biological sample of the disease, to carry out molecule diagnosis to Keratoderma-few Mao-white first syndrome
Evaluate with risk, further to treat the target spot that the disease provides design medicine, while carried to illustrate the sick mechanism of causing a disease
For theoretical foundation.
Therefore, on the one hand, the invention provides the GJA1 genes of mutation, GJA1 gene orders and the SEQ ID of the mutation
NO:1 compared to having a non-silent mutation of at least one, and the GJA1 genes of the mutation cause Keratoderma-few Mao-white first to integrate
The generation of sign；One or more of the non-silent mutation in insertion, missing and displacement.
In a preferred embodiment, the non-silent mutation is at least one of following mutation:SEQ ID
NO:1 G of the 23rd sports T；SEQ ID NO:1 G of the 412nd sports C；With SEQ ID NO:The 689th of 1
A and T is lacked respectively with the 690th.
In a highly preferred embodiment, non-silent mutation is SEQ ID NO:1 G of the 23rd sports T,
The mutation belongs to missense mutation so that the glycine of the amino acid sequence the 8th of GJA1 gene codes becomes valine.
In a highly preferred embodiment, non-silent mutation is SEQ ID NO:1 G of the 412nd is sported
C, the mutation belong to missense mutation so that the glycine of the amino acid sequence the 138th of GJA1 gene codes becomes figured silk fabrics ammonia
Acid.
In a highly preferred embodiment, non-silent mutation is SEQ ID NO:The 689th of 1 and the 690th
A and T is lacked respectively, and the mutation belongs to frameshift deletion mutation so that the junket ammonia of the amino acid sequence the 230th of GJA1 gene codes
Acid becomes cysteine, and the 230th later amino acid sequence also changes, until the codon mutation of the 236th is
Terminator codon so that polypeptide chain synthesis is interrupted.
Second aspect, present invention also offers the protein of above-mentioned three kinds of mutational formats coding, SEQ is sported when described
ID NO:When 1 G of the 23rd sports T, the amino acid sequence such as SEQ ID NO of the protein:2 show；When the mutation
For SEQ ID NO:When 1 G of the 412nd sports C, the amino acid sequence such as SEQ ID NO of the protein:3 show；Work as institute
State and sport SEQ ID NO:The 689th of 1 and the 690th respectively lack A and T when, the amino acid sequence of the protein is such as
SEQ ID NO:Shown in 4.
In the third aspect of the present invention, there is provided the carrier containing above-mentioned mutation GJA1 genes.
In the fourth aspect of the present invention, there is provided the host cell that is converted or transduceed by above-mentioned carrier or by above-mentioned mutation
The GJA1 genes host cell that directly converts or transduce.
In the fifth aspect of the present invention, there is provided the GJA1 genes of above-mentioned mutation as treatment Keratoderma-few hair-
The drug target of white first syndrome prepares application in Keratoderma-few Mao-white first Syndrome disease diagnostic kit.
In the sixth aspect of the present invention, there is provided a kind of reagent for being used to diagnose Keratoderma-few Mao-white first syndrome
Box, the kit includes the primer for being capable of specific amplification GJA1 genes, or is capable of specific detection GJA1 gene mutations
Probe.
In a preferred embodiment, the primer is at least one of following primer pair：(1) sense primer:
GATCTTTTCTTCGTTGGC, anti-sense primer：CTCTTTCCCTTAACCCG；(2) sense primer:TTCCTCTCTCGCCCCAC,
Anti-sense primer：GGCCTAGAAAG CTTACCTT；(3) sense primer:GGGTGACTGGAGCGCCTTAGGCAAACTC CTT, under
Swim primer：AAGGAGTTTGCCTAAGGCGCTCCAGTCACCC；(4) sense primer:
GAAGTTCAAGTACCGTATTGAAGAGCATGG, anti-sense primer：CCATGCTCTTCAATCCTGTACTTGAACTTC；(5) on
Swim primer:ATCATTGA ACTCTTCTGTTTTCTTCAAGGGCGTTAAGGATCGGG, anti-sense primer：CCCG
ATCCTTAACGCCCTTGAAGAAAACAGAAGAGTTCAATGAT。
In the seventh aspect of the present invention, there is provided a kind of to be used to screen the life for being susceptible to suffer from Keratoderma-few Mao-white first syndrome
The system of thing sample, the system include nucleic acid-extracting apparatus, nucleotide sequence determining device and judgment means；The nucleic acid carries
Device is taken to be used to extract sample of nucleic acid from biological specimen；The nucleotide sequence determining device and the nucleic acid-extracting apparatus phase
Even, for analyzing the sample of nucleic acid, to determine the nucleotide sequence of the sample of nucleic acid；The judgment means with it is described
Nucleotide sequence determining device is connected, for comparing the nucleotide sequence of the sample of nucleic acid, the nucleic acid sequence based on the sample of nucleic acid
Row and SEQ ID NO：1 difference and judge whether the biological sample is susceptible to suffer from Keratoderma-few Mao-white first syndrome.For example,
If the nucleotide sequence of the sample of nucleic acid and SEQ ID NO：1 compares with following at least one mutation：SEQ ID NO:1
The G of the 23rd sports T；SEQ ID NO:1 G of the 412nd sports C；SEQ ID NO:The 689th of 1 and the 690th
A and T is lacked respectively, it indicates that the biological sample is susceptible to suffer from Keratoderma-few Mao-white first syndrome.
In a preferred embodiment, the nucleotide sequence determining device further comprises library construction unit and survey
Sequence unit, the library construction unit are connected with the sequencing unit；The library construction unit is used to build the nucleic acid sample
This nucleic acid sequencing library；The sequencing unit is used to the nucleic acid sequencing library be sequenced, to obtain by multiple sequencings
The sequencing result that data are formed.
In a preferred embodiment, the library construction unit further comprises that PCR expands module, the PCR
GJA1 extron specific primers are provided with amplification module, performing PCR amplification is entered to the sample of nucleic acid.
In a preferred embodiment, the specific primer is at least one of following primer pair：(1) upstream
Primer:GATCTTTTCTTCGTTGGC, anti-sense primer：CTCTTTCCC TTAACCCG；(2) sense primer:
TTCCTCTCTCGCCCCAC, anti-sense primer：GGCCTA GAAAGCTTACCTT；(3) sense primer:
GGGTGACTGGAGCGCCTTAGGCAA ACTCCTT, anti-sense primer：AAGGAGTTTGCCTAAGGCGCTCCAGTCACCC；(4)
Sense primer:GAAGTTCAAGTACCGTATTGAAGAGCATGG, anti-sense primer：CCATGCTCTTCAATCCTGTACTTGAACT
TC；(5) sense primer:ATCATTGA ACTCTTCTGTTTTCTTCAAGGGCGTTAAGGATCGGG, anti-sense primer：CCCG
ATCCTTAACGCCCTTGAAGAAAACAGAAGAGTTCAATGAT。
In the eighth aspect of the present invention, there is provided a kind of to be used to screen the life for being susceptible to suffer from Keratoderma-few Mao-white first syndrome
The method of thing sample, the described method comprises the following steps：(1) from the extraction from biological material sample of nucleic acid；(2) obtained by determining
Sample of nucleic acid nucleotide sequence；(3) by the nucleotide sequence of resulting sample of nucleic acid and SEQ ID NO：1 sequence is compared
It is right, if having following at least one mutation in resulting nucleotide sequence：SEQ ID NO:1 G of the 23rd is sported
T；SEQ ID NO:1 G of the 412nd sports C；SEQ ID NO:The 689th of 1 and the 690th lacks A and T respectively, then
Indicate that the biological sample is susceptible to suffer from Keratoderma-few Mao-white first syndrome.
In the ninth aspect of the present invention, there is provided a kind of antibody, the antibody and protein specific of the present invention
With reference to, and the protein of normal GJA1 coded by said gene is not acted on.
In the tenth aspect of the present invention, there is provided a kind of Keratoderma-few Mao-white first syndrome agent, the treatment
Agent includes antibody described above.
The present invention is found that GJA1 gene mutations can cause Keratoderma-few first by sequencing of extron group technology
The morbidity of Mao-white first syndrome.On the one hand, can early stage by detecting whether subject carries GJA1 gene pathogenic mutations
Examination Keratoderma-few Mao-white first syndrome mutator carrier, there is provided prenatal and postnatal care is instructed；Or Keratoderma-few
Mao-white first syndrome patient provides molecule diagnosis basis.Especially, method provided by the present invention, diagnostic kit and system
Available for quickly and efficiently prediction or diagnose Keratoderma-few Mao-white first syndrome.On the other hand, GJA1 genes are being controlled first
Treat and be realized in Keratoderma-few Mao-white first syndrome, carried for complicated Keratoderma-few Mao-white first syndrome physiology course
For brand-new path.The third aspect, the present invention can provide possible medicine target for treatment Keratoderma-few Mao-white first syndrome
Point.
Brief description of the drawings
Fig. 1 be used to screening the biological sample that is susceptible to suffer from Keratoderma-few Mao-white first syndrome in the embodiment of the present invention is
The schematic diagram of system.
Embodiment
The present invention is described in more detail with reference to embodiments, but following description is only used for entering the present invention
Row indicative explaination, any limitation is not carried out to protection scope of the present invention, protection scope of the present invention is with claim
The scope that book limits is defined.
In the present invention, unless otherwise stated, Science and Technology noun used herein has art technology
The implication that personnel are generally understood that.Also, molecular genetics used herein, nucleic acid chemistry and molecular biology relational language
It is widely used term and conventional steps in corresponding field with laboratory operation step.Meanwhile in order to more fully understand this
Invention, is provided below the definition and explanation of relational language.
In the present invention, " GJA1 genes " is gap junction protein gene (gap junction protein), and its is wild
There are 1149 nucleotides type gene coding region, encodes 382 amino acid, wild type GJA1 gene orders such as SEQ ID NO:1 institute
Show.
In the present invention, the type of nucleic acid is not particularly limited, and can be any coding base comprising with GJA1 mutant
Because of the polymer of corresponding deoxyribonucleotide and/or ribonucleotide, including but not limited to DNA, RNA or cDNA.Root
According to the specific example of the present invention, the nucleic acid of foregoing coding GJA1 mutant is DNA.For description of the invention and
In claims, nucleic acid is referred to, it will be appreciated by those skilled in the art that actual include complementary double-strand any one, or
Two.For convenience, in the present specification and claims, although only giving a chain in most cases, actually
Also disclose that another complementary therewith chain.For example, refer to SEQ ID NO:1, it is actual to include its complementary series.Art technology
Personnel are further appreciated that can detect another chain using a chain, and vice versa.
In the present invention, term " extron " refers to the part being retained in ripe mRNA, i.e., ripe mRNA is corresponding
Part in gene.Introne is the part being cut away in mRNA process, is not present in ripe mRNA.It is outer aobvious
Son and introne are all for gene, and the part of coding is extron, and what is do not encoded does not lose for introne, introne
Pass effect.
In the present invention, term " exon trapping " is used interchangeably with " chip hybridization ", refers to probe in library
The DNA fragmentation of exon region carries out specific selection and the process of combination.DNA molecular is double-strand under normal circumstances, therefore is caught
Before obtaining, DNA molecular must be changed into single-stranded, be denatured it generally by heating and reach purpose of unwinding, the DNA molecular to unwind
It is rapidly cooled, that is, keeps single-chain state.After the denaturation of library capture hybridization is carried out in hybridization platform with chip.Contain exon 1
The DNA fragmentation in domain and it is fixed between the probe on chip and carries out molecule hybridization under strict conditions.It is preferred that visited on chip
The concentration of pin molecule will be significantly larger than concentration of target molecules.The methods of waiting after hybridizing, passing through denaturation collects the sequence of capture simultaneously
Purifying, obtains the sequential mixture after capture.
In the present invention, " high-flux sequence " refers to carry out high-flux sequence using three kinds of second generation microarray datasets：
454FLX (Roche companies), Solexa Genome Analyzer (Illumina companies) and Applied Biosystems are public
SOLID of department etc..The characteristics of these platforms are common is high sequencing throughput, is surveyed relative to 96 capillaries of tradition sequencing
Sequence, high-flux sequence, which is once tested, can read 40 ten thousand to 400 ten thousand sequences, according to the difference of platform, read length from 25bp
To 450bp, therefore different microarray datasets can read the base number that 1G to 14G is not waited in once testing.
In the present invention, term " DNA library " refers to enter the purpose fragment of genome Break Row, and obtaining one group has one
Determine the DNA fragmentation mixture of size.The preparation method of DNA library is well known to those skilled in the art.In a preference,
Stopping pregnancy thing, end reparation product, joint product and the enriched product of can also fighting each other are purified.The condition of reaction is carried out necessarily
Change or optimization also within those skilled in the art's limit of power.
In the present invention, term " mutation " refers to that the GJA1 polynucleotide sequences of wild type change, and turns into variant,
Variant can be naturally occur or non-natural occur.Variant includes substitution variants, Deletion variants and insertion and become
Allosome.In the present invention, a certain variant can be accomplished in several ways, for example, to obtain wild type gene coding not
Complete variant, some codon can be made to be changed into terminator codon by inserting base in wildtype gene sequence,
Or the mode of directly lack part sequence is realized.In the present invention, term " non-silent mutation " refer to except silent mutation with
Outer gene mutation, including but not limited to missense mutation, nonsense mutation and frameshift mutation etc..
The invention further relates to having at least 80% between described GJA1 nucleotide hybridizations and two sequences, preferably extremely
Few 90%, more preferably at least 95%, at least polynucleotides of 99% homology.The present invention is more particularly directed under strict conditions with this
Invent the interfertile polynucleotides of the polynucleotides.
Wild type or saltant type GJA1 nucleotides full length sequence of the present invention or its fragment can generally use PCR TRAPs, again
Group method or artificial synthesized method obtain., can be according to relevant nucleotide sequence disclosed in this invention, especially for PCR TRAPs
It is open reading frame sequence to design primer, and with commercially available cDNA storehouses or by conventional method well known by persons skilled in the art
Prepared cDNA storehouses expand as template and obtain relevant sequence.Once obtain relevant sequence, it is possible to recombination method come
Relevant sequence is obtained in large quantity.This is typically to be cloned into carrier, then is transferred to cell, then by conventional method from propagation
Isolated relevant sequence in host cell afterwards.
In the present invention, " carrier " includes but is not limited to cloning vector and expression vector.In a preferred embodiment,
The carrier is such as plasmid, clay, bacteriophage, coemid etc..In a preferred embodiment, the carrier is
It is obtained commercially.In a preferred embodiment, the carrier includes operationally connects with the GJA1 genes of above-mentioned mutation
The expression control sequence connect, such as, but not limited to promoter, enhancer and terminator.In a preferred embodiment, institute
State carrier and optionally also include selected marker.
Comprising above-mentioned appropriate DNA sequence dna and the carrier of appropriate promoter or control sequence, it is suitable to can be used for conversion
When host cell, allow it to marking protein.Such host cell includes but is not limited to, prokaryotic such as large intestine bar
Bacterium cell, and eukaryotic such as yeast cells, insect cell, plant cell and zooblast (such as mammalian cell, example
Such as mouse cell, people's cell).The host cell of the present invention can also be cell line.
The invention further relates to GJA1 muteins, GJA1 muteins of the invention can be recombinant protein,
Native protein, synthetic protein, preferably recombinant protein, i.e., using recombinant technique from protokaryon or eucaryon host (for example, thin
Bacterium, yeast, higher plant, insect and mammalian cell) in produce.
In the present invention, GJA1 muteins further relate to have and GJA1 mutein identical functions, SEQ ID
NO：The variant form of 2~4 sequences.Variant form includes:Homologous sequence, conservative variant, induced mutants etc..Invention is also
It is related to GJA1 mutein analogs.These analog skins and GJA1 mutains qualitative difference can be on amino acid sequence
Difference or do not influence difference on the modified forms of sequence, or have both at the same time.
As well known to those skilled in the art, Disease-causing gene tool is of use in many ways.Therefore, mutation GJA1 provided by the invention
The purposes of gene includes but is not limited to：Drug target as treatment Keratoderma-few Mao-white first syndrome；For screening easily
Suffer from the kit of the biological sample of Keratoderma-few Mao-white first syndrome；It is comprehensive that Keratoderma-few Mao-white first is susceptible to suffer from for screening
The system of the biological sample of simulator sickness；For producing disease animal model；There is provided for treatment Keratoderma-few Mao-white first syndrome
New pathways of drug action etc..
" kit " of the present invention refers to those skilled in the art using GJA1 wild types or mutant nucleotide as base
Because of probe, according to the principle of gene recombination, it can detect and whether there is the nucleotides complementary with the probe sequence in biological specimen
Sequence, therefore using this kit can detect to whether there is in sample the gene mutation site of the present invention.Kit
Generally comprise：Primer, probe, nucleic acid chip, specification etc., it is also possible to including the buffer solution compatible with active component, carrier or
Medium etc..
In the present invention, " primer " refers to the polynucleotide passage for expanding target nucleic acids in being reacted in PCR, it typically is
Oligonucleotides, such as containing at least five base, for example, 5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,
21st, the polynucleotide passage of 22,23,24,25,30,35,40,45,50 or more bases.Primer need not with it is to be amplified
Target gene or its complementary strand complete complementary, as long as it being capable of specific amplification target gene.As used herein, art
Language " specific amplification " refers to that primer can react amplifying target genes by PCR, without expanding other genes.It is for example, special
Property amplification GJA1 genes refer to, PCR reaction in primer only expand GJA1 genes, without expanding other genes, such primer
Design be well known to a person skilled in the art.
In the present invention, term " probe of specific detection GJA1 gene mutations " refers to that probe can be distinguished containing prominent
The GJA1 genes of change and the GJA1 genes for not containing mutation.In general, can by controlling the stringencies of hybridization conditions,
Enable the probe to distinguish the gene containing mutation and do not contain the gene of mutation.For example, under high stringency conditions, with
The probe of GJA1 gene exact complementarities can hybridize with not containing the GJA1 genes of mutation, without with even only including one
The GJA1 gene recombinations of the mutation of point mutation, so as to which the two be distinguished.Same way, it is also possible to design the GJA1 gene bases with mutation
Because of the probe of exact complementarity, so as to its GJA1 gene recombination under high stringency conditions with mutation, without with not containing mutation
GJA1 gene recombinations.In biology field, the design and hybridization technique of probe are well known.
There is specific polyclonal antibody and monoclonal antibody the present invention relates to the GJA1 protein to mutation, especially
Monoclonal antibody.Here, " specificity " refers to that antibody can be incorporated into the GJA1 protein of mutation.Can be with dashing forward it is preferred that referring to those
The GJA1 proteins or fragment of change combine but nonrecognition and the GJA1 protein associated antigen molecules for being incorporated into wild type
Antibody.The present invention not only includes complete monoclonal or polyclonal antibody, but also including having immunocompetent antibody fragment,
Such as Fab, or (Fab) 2 fragment；Heavy chain of antibody；Antibody light chain；Genetically engineered Single Chain Fv Molecule A or chimeric antibody.This hair
Bright antibody can be prepared by various technologies known to a person skilled in the art.
The GJA1 protein antibodies of the mutation of the present invention can be used for identifying the GJA1 protein of mutation.For example, it can use
A kind of detectable molecule such as fluorescein isothiocyanate (FITC) marks the GJA1 protein specific antibodies of mutation, Ran Hourang
The GJA1 protein specific antibodies of mutation contact with sample, then are gone out and mutation with fluorescence microscope or flow cytomery
The sample that GJA1 protein specific antibodies combine, so as to comprehensive with the presence or absence of Keratoderma-few Mao-white first to predict or diagnosing patient
Simulator sickness provides foundation and guidance.
The GJA1 protein antibodies of the mutation of the present invention can also be used to the GJA1 protein of neutral mutation.If enough
The presence that GJA1 protein is mutated with the present invention of the individual Keratoderma of as shown by data-few Mao-white first syndrome it is related, can
To consider to neutralize these pathogenic mutations GJA1 protein molecules with the GJA1 protein-specific antibodies of mutation, suffer from so as to alleviate
The illness of person.
Embodiment 1：Sample acquisition
Inventor was collected into a KHLS family at home in recent years, and family shares three generations, existing normal individual, also had
KHLS patient.4 clinical samples are chosen in the family, totally 6 samples are as sample is studied for 2 normal family samples, each
Sample collection peripheral blood sample 2ml, add EDTA anti-freezings, -80 DEG C of preservations.
As secondary checking sample, every is adopted 100 normal individuals unrelated with the family 1 and family 2 of random collecting
Collect peripheral blood sample 2ml, add EDTA anti-freezings, -80 DEG C of preservations.
Embodiment 2：It is prepared by sample DNA
DNA is extracted from peripheral blood sample using OMEGA Blood DNA Midi Kit whole blood DNA extracts kits, carried
Take step as follows：
(1) 2ml whole blood samples are taken, add 150ul OB Protease, 2.1ml Buffer BL and 20ul RNase A,
Maximal rate whirlpool 1 minute, thoroughly mix.
(2) 65 C water bath's 15-20 minutes, and whirlpool 5 times during water-bath.
(3) 2.2ml absolute ethyl alcohols are added, maximal rate whirlpool 30 seconds, are thoroughly mixed.
(4) 3.5ml lysates are moved into the 15ml centrifuge tubes with Filter column, 4000 leave the heart 5 minutes, take out Filter column,
Filtered fluid is outwelled, puts back to Filter column.
(5) the 3rd step residue lysate is added into the 15ml centrifuge tubes with Filter column, 4000 leave the heart 5 minutes, take out filtering
Post, filtered fluid is outwelled, put back to Filter column.
(6) 3ml HB Buffer are added, washed filter column, 4000 leave the heart 5 minutes, take out Filter column, outwell filtered fluid
Body, put back to Filter column.
(7) 3ml DNA Wash Buffer are added, 4000 leave the heart 5 minutes, take out Filter column, outwell filtered fluid, put
Return Filter column.
(8) 3ml DNA Wash Buffer are added again, and 4000 leave the heart 5 minutes, take out Filter column, outwell filtered fluid
Body, put back to Filter column.
(9) 4000 leave the heart 15 minutes, dry Filter column.
(10) Filter column is moved to new 15ml centrifuge tubes, adds 70 degrees Celsius of 500ul Elution Buffer, room
Temperature stands 5 minutes, and 4000 leave the heart 5 minutes, collect the filtered fluid containing DNA.
(11) Filter column is moved to new 15ml centrifuge tubes again, adds 70 degrees Celsius of 500ul Elution
Buffer, it is stored at room temperature 5 minutes, 4000 leave the heart 5 minutes, collect the filtered fluid containing DNA.
(12) spectrophotometer measurement DNA concentration and purity, the OD260/ of each sample genomic DNA of gained are utilized
OD280 is respectively positioned between 1.7~2.0, and concentration is no less than 200ng/ul, and total amount is no less than 30 μ g.
Embodiment 3：Exon trapping and sequencing
Inventor is with full exon trapping kit (the Agilent SureSelect of Agilent SureSelect people
Human All Exon Kit) combine extron group sequence of the Solexa high throughput sequencing technologies to the sample of the embodiment 1 of selection
Row are sequenced, specific as follows：
1) genomic DNA is broken into 150-200bp or so fragment at random, then connects and connects respectively at fragment both ends
Head prepares Hybrid Library (referring to http:The Illumina/Solexa standards that //www.illumina.com/ is provided build storehouse explanation
Book).
2) by ligation-mediated PCR (ligation-mediated PCR (LM-PCR)) linear expansion after library is purified
Increase and carry out hybridization enrichment with SeqCap EZ Oligo pool, then upper machine sequencing is carried out after LM-PCR linear amplification.Survey
Sequence platform is Illumina Hiseq 2000, and reading length is 90bp, the average sequencing depth of each sample at least for 50 ×.
3) initial data obtained after being sequenced is handled by Illumina basecalling Software 1.7, is passed through
Filtering depollutes, compared using SOAPaligner 2.20# reference gene group Hg19 (refer to Li R, Li Y,
KristiansenK,et al,SOAP:short oligonucleotide alignment program.
Bioinformatics 2008,24(5):713-714；Li R,Yu C,Li Y,et al,SOAP2:an improved
Ultrafast tool for short read alignment.Bioinformatics 2009,25 (15):1966-1967,
By reference to mode be incorporated by herein), compared to obtain to unique aligned sequences on genome.Then utilize
SOAP snp (reference can be made to:Li R,Li Y,Fang X,Yang H,et al,SNP detection for massively
parallel whole-genome resequencing.Genome Res 2009,19(6):1124-1132, by reference to
Mode is incorporated by herein) determine the genotype of target region.Indel (insertion-deletion, insertion/deletion mark
Note) using BWA (by Burrows-Wheeler conversion ratios to) (version 0.5.9-r16) compare arrive reference gene group
Hg19 (snp132), then determined using GATK (Genome Analysis Toolkit) (version v1.0.4705)
Indel type.(reference can be made to Li H, Durbin R.Fast and accurate long-read alignment with
Burrows-Wheeler transform.Bioinformatics 2010；26(5):589-595；McKenna,A,Hanna
M,Banks E,et al.The genome analysis toolkit:a MapReduce framework for
analyzing next-generation DNA sequencing data.Genome Research 2010；20(9):
1297-1303)。
As a result show, SNP (SNP) and insertion/deletion are found in the case of patient's family
(Indel).Then pass through dbSNP databases (http://www.ncbi.nlm.nih.gov/projects/SNP/snp_
), summary.cgi thousand human genome databases (www.1000genomes.org/), HapMap databases (http://
The filtering of public database such as hapmap.ncbi.nlm.nih.gov/), remove all known and equipotential bases in database
Because frequency is more than 0.005 variation.By comparing normal sample, remove all known variation, same sense mutation and noncoding regions
Variation, influence the less site of protein function, including intron, intergenic, UTR, same sense mutation, and soft using SIFT
Part carries out SNP function predictions, finally gives the SNP site and Indel may with meaning of causing a disease.
Embodiment 4：Pathogenic mutation gene is verified
Because sequencing of extron group has a certain degree of false positive, therefore we further utilize Sanger PCR sequencing PCRs,
There is the SNP site for meaning of causing a disease and Indel to verify that specific method step is as follows the possibility of above-mentioned patient's family：
1.DNA is extracted
The peripheral blood of the normal control of sample and 100 consanguinity-less relations to embodiment 1 according to embodiment 2 method
Extract genomic DNA.
2. design of primers and PCR reactions
Design of primers refers to human gene data unit sequence storehouse hg19/build37.1, GJA1 extron specific primer
(the 2nd exon for being directed to GJA1) is specific as follows：
Reaction system：
Reaction condition：
3.DNA is sequenced
The pcr amplification product of acquisition is purified with QIAquick PCR amplification kits (Qiagen companies), then
Carry out DNA sequencing.Mutation investigation is carried out to the mutational site of GJA1 genes in patients' family member, patient is to carry accordingly
Mutation, its normal family members do not carry the pathogenic mutation.Therefore it is considered that GJA1 mutational site is Keratoderma-few
The Disease-causing gene of Mao-white first syndrome.
Embodiment 5：The kit of the GJA1 genes of vitro detection Keratoderma-few Mao-white first syndrome patient
In order to detect the pathogenic mutation of other Keratodermas-few Mao-white first syndrome family gene, the base can be designed
Because of all extrons in code area and the primer sequence of extron and introne intersection.In this embodiment, kit primer and
Expand sequencing condition such as embodiment 4.
1st, kit forms：
Primer
Taq enzyme
Buffer solution
dNTP
Extraction and purified genes material (DNA sample) from organism sample to be detected
2nd, application method：
(1) extracting genome DNA：Carried using the Wizard Genomic DNA extraction kits of Promega companies of the U.S.
Take peripheral blood sample genomic dna.
(2) performing PCR amplification is first entered instead using above-mentioned PCR primer, Taq enzyme, sample genomic dna, buffer solution, dNTP etc.
Should；
(3) pcr amplification product is purified；
(4) BigDye reactions are carried out to the PCR primer of purifying；
(5) BiyDye reaction products are purified；
(6) BiyDye reaction products are sequenced, sequencing sequence is compared with normal sequence.
If sequencing sequence and SEQ ID NO：1 compares, and has selected from following at least one mutation：c.23G>T
[p.Gly8Val]、c.412G>C [p.Gly138Arg], c.689_690delAT [p.Tyr230CysfsX7], it indicates that biology
Sample is susceptible to suffer from Keratoderma-few Mao-white first syndrome.Using kit according to an embodiment of the invention, can effectively sieve
Choosing is susceptible to suffer from the biological sample of Keratoderma-few Mao-white first syndrome.
Embodiment 6：The method that screening is susceptible to suffer from the biological sample of Keratoderma-few Mao-white first syndrome
According to an embodiment of the invention, this method comprises the following steps：
(1) from extraction from biological material sample of nucleic acid.According to an embodiment of the invention, the type of biological sample is not by special
Limitation, as long as sample of nucleic acid of the reflection biological sample GJA1 with the presence or absence of mutation can be extracted from the biological sample.
According to an embodiment of the invention, biological sample can be selected from blood of human body, skin, hypodermis at least one, it is preferably outer
All blood.Thus, it is possible to be easily sampled and detect, Keratoderma-few Mao-white is susceptible to suffer from so as to further improve screening
The efficiency of the biological sample of first syndrome.According to an embodiment of the invention, term " sample of nucleic acid " used herein above should do extensively
Reason and good sense solution, its can be it is any can reflect the sample of GJA1 in biological sample with the presence or absence of mutation, such as can be from biology
The complete genome DNA directly extracted in sample or the part that GJA1 coded sequences are included in the full-length genome, can be with
It is the total serum IgE extracted from biological sample or the mRNA extracted from biological sample.According to one of present invention implementation
Example, the sample of nucleic acid is complete genome DNA.Thus, it is possible to expand the source range that comes of biological sample, and can be simultaneously to life
The much information of thing sample is determined, so as to improve the biological sample that screening is susceptible to suffer from Keratoderma-few Mao-white first syndrome
The efficiency of product.In addition, according to an embodiment of the invention, for using RNA as sample of nucleic acid, from extraction from biological material nucleic acid sample
Originally may further include：From extraction from biological material RNA samples, preferably RNA samples are mRNA；And based on resulting RNA
Sample, by reverse transcription reaction, cDNA samples are obtained, resulting cDNA samples form sample of nucleic acid.Thus, it is possible to further
Improve the efficiency for the biological sample that Keratoderma-few Mao-white first syndrome is susceptible to suffer from by the use of RNA as sample of nucleic acid screening.
(2) sample of nucleic acid is analyzed, so as to the nucleotide sequence of sample of nucleic acid obtained by determining.According to the present invention
Embodiment, it is determined that the method and apparatus of the nucleotide sequence of resulting sample of nucleic acid is not particularly restricted.According to the present invention's
Specific embodiment, the nucleotide sequence of sample of nucleic acid by sequence measurement, can be determined.According to an embodiment of the invention, Ke Yiyong
It is not particularly restricted in the method and apparatus being sequenced.According to an embodiment of the invention, second generation sequencing skill can be used
Art, the third generation and forth generation or more advanced sequencing technologies can also be used.According to the specific example of the present invention, Ke Yili
Nucleotide sequence is sequenced with selected from Hiseq2000, SOLiD, 454 and at least one of single-molecule sequencing device.Thus, tie
Newest sequencing technologies are closed, higher sequencing depth can be reached for Single locus, detection sensitivity and accuracy carry significantly
It is high, it is thus possible to the characteristics of using the high flux of these sequencing devices, deep sequencing, further to improve and sample of nucleic acid is examined
Survey the efficiency of analysis.Thus, it is possible to improve accuracy when subsequently analyzing sequencing data and the degree of accuracy.Thus, according to
Embodiments of the invention, determine that the nucleotide sequence of sample of nucleic acid may further include：First, for resulting nucleic acid sample
This, structure nucleic acid sequencing library；And resulting nucleic acid sequencing library is sequenced, to obtain by multiple sequencing numbers
According to the sequencing result of composition.According to some embodiments of the present invention, can use selected from Hiseq2000, SOLiD, 454 and single point
Resulting nucleic acid sequencing library is sequenced at least one of sub- sequencing device.In addition, according to an embodiment of the invention, can
To be screened to sample of nucleic acid, GJA1 extrons are enriched with, screening enrichment can build sequencing before sequencing library is built
During library, or carried out after structure sequencing library.According to one embodiment of present invention, for sample of nucleic acid, structure
Nucleic acid sequencing library further comprises：Using GJA1 extron specific primers, performing PCR amplification is entered to sample of nucleic acid；And pin
To resulting amplified production, structure nucleic acid sequencing library.Thus, it is possible to be expanded by PCR, enrichment GJA1 extrons are (especially
It is the 2nd exon), screen the biological sample for being susceptible to suffer from Keratoderma-few Mao-white first syndrome so as to further improve
Efficiency.According to an embodiment of the invention, the sequence of GJA1 extrons specific primer is not particularly limited, according to the excellent of the present invention
Embodiment is selected, these GJA1 extrons specific primers (the 2nd exon for being directed to GJA1) are the same as shown in embodiment 4.
On for sample of nucleic acid, building the method and flow of sequencing library, those skilled in the art can be according to difference
Sequencing technologies suitably selected, on the details of flow, may refer to be sequenced such as Illumina companies of manufacturer of instrument
The code provided, for example, see Illumina companies Multiplexing Sample Preparation Guide (Part#
1005361；Feb 2010) or Paired-End SamplePrep Guide (Part#1005063；Feb 2010), pass through ginseng
According to be incorporated into herein.According to an embodiment of the invention, from the method and apparatus of extraction from biological material sample of nucleic acid, also not by spy
Do not limit, the nucleic acid extraction kit of commercialization can be used to carry out.
It should be noted that term " nucleotide sequence " used herein should broadly understood, it can be to core
After the sequencing data that acid sample is sequenced to obtain is assembled, obtained complete nucleic acid sequence information or directly
It is used as nucleotide sequence using by carrying out resulting sequencing data (reads) is sequenced to sample of nucleic acid, as long as these nucleic acid sequences
Coded sequence containing corresponding GJA1 in row.
Finally, it is determined that after the nucleotide sequence of sample of nucleic acid, by the nucleotide sequence and SEQ of resulting sample of nucleic acid
ID NO：1 sequence compared to pair.If have in resulting nucleotide sequence selected from following at least one mutation：c.23G
>T[p.Gly8Val]、c.412G>C [p.Gly138Arg], c.689_690delAT [p.Tyr230CysfsX7], it indicates that raw
Thing sample is susceptible to suffer from Keratoderma-few Mao-white first syndrome.Thus, skin angle is susceptible to suffer from by screening according to embodiments of the present invention
The method of the biological sample of change-few Mao-white first syndrome, it can effectively screen and be susceptible to suffer from Keratoderma-few Mao-white first syndrome
Biological sample.According to an embodiment of the invention, to nucleotide sequence and SEQ ID NO：1 method and apparatus being compared is not
It is particularly limited, the software of any conventional can be used to be operated, according to the instantiation of the present invention, SOAP can be used soft
Part is compared.
It should be noted that according to embodiments of the present invention, " screening is susceptible to suffer from the life of Keratoderma-few Mao-white first syndrome
The purposes of the method for thing sample " is not particularly limited, such as may be used as the screening technique of non-diagnostic purpose.
Embodiment 7：The system that screening is susceptible to suffer from the biological sample of Keratoderma-few Mao-white first syndrome
The present invention proposes a kind of life that can effectively implement above-mentioned screening and be susceptible to suffer from Keratoderma-few Mao-white first syndrome
The system of the method for thing sample.
As shown in figure 1, the system 1000 that the screening is susceptible to suffer from the biological sample of Keratoderma-few Mao-white first syndrome includes
Nucleic acid-extracting apparatus 100, nucleotide sequence determining device 200 and judgment means 300.
According to an embodiment of the invention, nucleic acid-extracting apparatus 100 is used for from extraction from biological material sample of nucleic acid.Such as preceding institute
State, the type of sample of nucleic acid is not particularly restricted, for using RNA, as sample of nucleic acid, then nucleic acid-extracting apparatus is further
Including RNA extraction units 101 and reverse transcription unit 102, wherein, extraction unit 101 is used for from extraction from biological material RNA samples,
Reverse transcription unit 102 is connected with RNA extraction units 101, for carrying out reverse transcription reaction to RNA samples, to obtain cDNA samples
This, resulting cDNA samples form sample of nucleic acid.
According to an embodiment of the invention, nucleotide sequence determining device 200 is connected with nucleic acid-extracting apparatus 100, for core
Acid sample is analyzed, to determine the nucleotide sequence of sample of nucleic acid.As previously shown, the method for sequencing can be used to determine nucleic acid
The nucleotide sequence of sample.Thus, according to one embodiment of present invention, the nucleotide sequence determining device 200 can be further
Including：Library construction unit 201 and sequencing unit 202.Library construction unit 201 is used to be directed to sample of nucleic acid, builds nucleic acid
Sequencing library；Sequencing unit 202 is connected with library construction unit 201, for nucleic acid sequencing library to be sequenced, to obtain
Obtain the sequencing result being made up of multiple sequencing datas.As it was previously stated, can be expanded by PCR, GJA1 extrons are enriched with, further
Improve the efficiency that screening is susceptible to suffer from the biological sample of Keratoderma-few Mao-white first syndrome.Thus, library construction unit 201 can be with
Further comprise that PCR expands module (not shown), being provided with GJA1 extron specificity in the PCR expands module draws
Thing, to utilize GJA1 extron specific primers, performing PCR amplification is entered to the sample of nucleic acid, according to the specific reality of the present invention
Example is applied, GJA1 extrons specific primer (2 exons for being directed to GJA1) is as described in Example 4.According to the implementation of the present invention
Example, sequencing unit 202 can include selected from HISEQ2000, SOLiD, 454 and single-molecule sequencing device at least one.Thus,
With reference to newest sequencing technologies, higher sequencing depth can be reached for Single locus, detection sensitivity and accuracy are significantly
Improve, it is thus possible to the characteristics of using the high flux of these sequencing devices, deep sequencing, further improve and sample of nucleic acid is carried out
The efficiency of detection and analysis.So as to improve accuracy when subsequently analyzing sequencing data and the degree of accuracy.
According to an embodiment of the invention, judgment means 300 are connected with nucleotide sequence determining device 200, suitable for by nucleic acid sample
This nucleotide sequence is compared, so as to the nucleotide sequence based on sample of nucleic acid and SEQ ID NO：1 difference judges biological sample
Whether product are susceptible to suffer from Keratoderma-few Mao-white first syndrome.Specifically, the nucleotide sequence based on sample of nucleic acid and SEQ ID NO：1
Compare, if having selected from following at least one mutation：c.23G>T[p.Gly8Val]、c.412G>C[p.Gly138Arg]、
C.689_690delAT [p.Tyr230CysfsX7], so as to judge it is comprehensive whether biological sample is susceptible to suffer from Keratoderma-few Mao-white first
Simulator sickness.According to one embodiment of present invention, the nucleotide sequence of sample of nucleic acid and SEQ ID NO：1 compares, and has selected from following
At least one mutation：c.23G>T[p.Gly8Val]、c.412G>C[p.Gly138Arg]、c.689_690delAT
[p.Tyr230CysfsX7], it is the instruction that biological sample is susceptible to suffer from Keratoderma-few Mao-white first syndrome.As it was previously stated, according to
Embodiments of the invention, to nucleotide sequence and SEQ ID NO：1 equipment being compared is not particularly restricted, and can be used and be appointed
The conventional software of meaning is operated, and according to the instantiation of the present invention, can be compared using SOAP softwares.
Thus, using the system, it can effectively implement foregoing screening and be susceptible to suffer from Keratoderma-few Mao-white first syndrome
The method of biological sample, so as to effectively screen the biological sample for being susceptible to suffer from Keratoderma-few Mao-white first syndrome.
Claims (6)
- A kind of 1. GJA1 genes of mutation, it is characterised in that：The GJA1 gene orders of the mutation and SEQ ID NO:1 compared to same When there is following mutation:SEQ ID NO:1 G of the 23rd sports T；SEQ ID NO:1 G of the 412nd sports C； SEQ ID NO:The 689th of 1 and the 690th lacks A and T respectively.
- A kind of 2. protein for the GJA1 gene codes being mutated as claimed in claim 1.
- A kind of 3. carrier, it is characterised in that：The carrier contains the GJA1 genes being mutated as claimed in claim 1.
- A kind of 4. genetically engineered host cell, it is characterised in that：The host cell is that the carrier described in claim 3 turns The host cell changed or transduceed.
- 5. prepared by the GJA1 genes being mutated as claimed in claim 1 be susceptible to suffer from Keratoderma-few Mao-white first syndrome for screening Biological sample kit for diagnosing diseases in application.
- A kind of 6. kit for being used to diagnose Keratoderma-few Mao-white first syndrome, it is characterised in that：The kit includes Being capable of the probe of GJA1 genes that is mutated as claimed in claim 1 of specific detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410429164.6A CN104250649B (en) | 2014-08-27 | 2014-08-27 | The new Disease-causing gene of the white first syndrome of the few hair of Keratoderma and its encoding proteins matter and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410429164.6A CN104250649B (en) | 2014-08-27 | 2014-08-27 | The new Disease-causing gene of the white first syndrome of the few hair of Keratoderma and its encoding proteins matter and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104250649A CN104250649A (en) | 2014-12-31 |
| CN104250649B true CN104250649B (en) | 2018-01-16 |
Family
ID=52185901
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410429164.6A Active CN104250649B (en) | 2014-08-27 | 2014-08-27 | The new Disease-causing gene of the white first syndrome of the few hair of Keratoderma and its encoding proteins matter and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104250649B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475351B (en) * | 2016-06-08 | 2021-02-05 | 戴勇 | Screening method of high-contribution pathogenic gene of rheumatoid arthritis |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509801B (en) * | 2012-06-20 | 2017-06-06 | 深圳华大基因股份有限公司 | Skeletal muscle chloride ion channel gene mutant and its application |
-
2014
- 2014-08-27 CN CN201410429164.6A patent/CN104250649B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Connexin 43 (GJA1) Mutations Cause the Pleiotropic Phenotype of Oculodentodigital Dysplasia;William A. Paznekas, et al.;《Am. J. Hum. Genet.》;20031231;第72卷;408-418 * |
| Oculo-dento-digital dysplasia: Lack of genotype–phenotype correlation for GJA1 mutations and usefulness of neuro-imaging;M.J. Alao, et al.;《European Journal of Medical Genetics》;20091004;第53卷;19-22 * |
| Oculodentodigital Dysplasia-causing Connexin43 Mutants Are Non-functional and Exhibit Dominant Effects on Wild-type Connexin43;Wendi Roscoe, et al.;《THE JOURNAL OF BIOLOGICAL CHEMISTRY》;20050325;第280卷(第12期);11458–11466 * |
| Skin Changes in Oculo-Dento-Digital Dysplasia Are Correlated With C-terminal Truncations of Connexin 43;M. Vreeburg, et al.;《American Journal of Medical Genetics Part A》;20071231;360–363 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104250649A (en) | 2014-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104212806B (en) | New mutant disease-causing gene of Alport syndrome, encoded protein and application thereof | |
| CN110029158A (en) | A kind of marfan's syndrome detection panel and its application | |
| CN111411150B (en) | Intestinal flora for diagnosing sarcopenia and application thereof | |
| CN106350589A (en) | DNA library for detecting pathogenic genes of genetic vascular diseases and application thereof | |
| CN109852689A (en) | The relevant biomarker of one group of vascular malformation and coherent detection kit | |
| CN106282195A (en) | Gene mutant and application thereof | |
| CN104450727A (en) | Pathogenic gene for X-linked hypophosphatemic rickets as well as protein encoded by pathogenic gene and application of pathogenic gene | |
| CN105940115A (en) | A molecular marker of plasmodium falciparum artemisinin resistance | |
| CN104232650B (en) | The new Disease-causing gene of idiopathic calcification of basal ganglion and its encoding proteins matter and application | |
| CN104178487B (en) | ATM gene mutant and application thereof | |
| CN105442053B (en) | DNA library for detecting and diagnosing pathogenic genes of ion channel disease and application thereof | |
| CN104073499B (en) | TMC1 gene mutation body and its application | |
| CN104250649B (en) | The new Disease-causing gene of the white first syndrome of the few hair of Keratoderma and its encoding proteins matter and application | |
| CN110042153A (en) | A kind of detection method and its primer sets of SMN1 gene mutation | |
| CN105838720B (en) | PTPRQ gene mutation body and its application | |
| CN109439741A (en) | Detect idiopathy ospc gene probe compositions, kit and application | |
| CN104561015B (en) | MYL4 gene mutation bodies and its application | |
| CN103509801B (en) | Skeletal muscle chloride ion channel gene mutant and its application | |
| CN104774841B (en) | Genetic epilepsy is with febrile seizure plus SCN1A gene new mutations | |
| CN108977449A (en) | The pathogenic mutation of primary immunodeficiency disease and its application | |
| CN113897368A (en) | TTN gene mutant and application thereof | |
| CN104178489B (en) | AAGAB gene mutation bodies and its application | |
| CN104372009B (en) | The new Disease-causing gene of Mel gram pine rosenthal's syndrome and its encoding proteins matter and application | |
| CN104293813B (en) | The new Disease-causing gene of Skin peeling syndrome and its encoding proteins matter and application | |
| CN107385076B (en) | A kind of hypothyroidism Disease-causing gene mutation and the diagnostic reagent based on this gene mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: SHENZHEN BGI CORPORATION Free format text: FORMER OWNER: BGI-SHENZHEN CO., LTD. Effective date: 20150729 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20150729 Address after: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer Applicant after: BGI SHENZHEN CO LTD Address before: North Road No. 146, building 11F-3 Industrial Zone in Yantian District of Shenzhen city of Guangdong Province in 518083 Applicant before: BGI-Shenzhen Co., Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |