CN109971750B

CN109971750B - Application of black shank germ effector in inducing necrosis of leaf tobacco flakes of Benshi

Info

Publication number: CN109971750B
Application number: CN201910165403.4A
Authority: CN
Inventors: 王文静; 王凤龙; 陈德鑫; 任广伟; 焦芳婵; 王静
Original assignee: Tobacco Research Institute of CAAS
Current assignee: Tobacco Research Institute of CAAS
Priority date: 2019-03-05
Filing date: 2019-03-05
Publication date: 2023-06-20
Anticipated expiration: 2039-03-05
Also published as: CN109971750A

Abstract

The invention discloses an application of a black shank germ effector in inducing necrosis of leaf tobacco flakes of Benshi, which is implemented by designing a primer; extracting genome DNA of tobacco black shank germ; PCR amplification of tobacco black shank germ effector gene; recovering and purifying PCR products; preparing escherichia coli DH5 alpha competence; the amplified product is connected with pMDTM 19-T Vector and transformed into escherichia coli DH5 alpha; transforming escherichia coli; screening positive clones and carrying out PCR identification on bacterial liquid; and (5) sequencing and identifying the screened positive clones to finally obtain the phytophthora parasitica effector. The invention has the beneficial effects that the effector of the tobacco black shank bacteria is cloned and the functions thereof are analyzed.

Description

Application of black shank germ effector in inducing necrosis of leaf tobacco flakes of Benshi

Technical Field

The invention belongs to the technical field of biology, and relates to application of a black shank germ effector in inducing necrosis of leaf tobacco flakes of Benshi.

Background

Tobacco black shank belongs to the kingdom of the genus Protopiraia (Strmenopila) or algae (Chromista), oomycetes (0 mycta), oomycetes (Oomycetes), peronosporales (Peronosporales), pytheraceae (Pytheraceae), phytophthora (Phytophthora). Plant pathogens secrete effector proteins into the host, allowing them to suppress the immune system of plants, disrupt cellular activity, ultimately causing disease (Kazan & Lyons, 2014). Bioinformatics analysis shows that pathogenic oomycetes encode a large class of effector proteins, namely RxLR effector proteins (RxLR). The N-terminus of RxLR effector protein contains a conserved Arginine-any amino acid-Leucine-Arginine motif domain (R, arginine; x, any amino acid; L, leucine). RxLR motif is typically followed by a small conserved glutamate-Arginine (EER) domain, similar to the host cell anchoring signal RxLR (E/Q) of plasmodium. This RxLR-dEER conserved domain is closely related to effector protein transport functions and can regulate the transport of these effector proteins into the cell interior.

With the rapid development of molecular biology, the research of the molecular biology of phytophthora has progressed rapidly. Currently, the genome of some important species of phytophthora have been sequenced and published, including phytophthora infestans, phytophthora sojae, phytophthora acori, phytophthora capsici and phytophthora nicotianae. The genome sizes of the phytophthora are unequal, the maximum is the phytophthora infestans, 240Mb, 17797 genes and 563 effector; phytophthora sojae has a genome size of 95Mb, contains 16,988 genes, and has 335 RxLR effectors; the genome size of the phytophthora acori is 65Mb, which contains 14451 genes and 309 RxLR effector; phytophthora capsici genome size is 63.8Mb, contains 19805 genes, and has 400 RxLR effector. The newly sequenced tobacco black shank germ No. 0 physiological race has a genome size of 80Mb, contains 17797 genes, has 308 RxLR effector, and No. 1 physiological race has a genome size of 69Mb, contains 14542 genes, and has 199 RxLR effector.

The vast number of effector agents are powerful weapons of phytophthora infestations plants, acting on various immune components of the plant, such as: plant exosome proteases, plant MAPK pathways, plant RNA silencing signal pathways, plant hormone signal pathways, endoplasmic reticulum, etc., promote pathogen infection. Currently, about 30 more effectors of Phytophthora are cloned and identified, such as EPI1, EPI10, EPIC2B, EPIC1, avrb1b2, GIP1, pexRD2, psCRN63, avh331, PSR1 and PSR2, piPSR2, psavr3c, pi14054, pi03192, psavh262, psCRN108, pslsc1, pexRD24 (Pi 04314), PSE1, IPI-O, avh241, AVR2, AVR1, AVR3b, AVR3a, CRN8, pi04089, avh238, etc. Most of the effect factors are derived from phytophthora infestans and phytophthora sojae, and researches on RxLR effect factors of tobacco black shank bacteria are not reported yet.

Disclosure of Invention

The invention provides application of a phytophthora parasitica effector in inducing necrosis of leaf tobacco flakes, and has the beneficial effects that the phytophthora parasitica effector is cloned and the functions thereof are analyzed.

The technical scheme adopted by the invention is that the method comprises the following steps:

step 1: designing a primer;

step 2, extracting genome DNA of the tobacco black shank germ;

step 3, PCR amplification of tobacco black shank germ effector genes;

step 4, recovering and purifying a PCR product;

step 5: preparing escherichia coli DH5 alpha competence;

step 6: the amplified product is connected with pMDTM 19-T Vector and transformed into escherichia coli DH5 alpha;

step 7: transforming escherichia coli;

step 8: screening positive clones and carrying out PCR identification on bacterial liquid;

step 9: and (5) sequencing and identifying the screened positive clones to finally obtain the phytophthora parasitica effector.

Step 10: HJ01 effector was analyzed for function in tobacco leaf transient expression.

Drawings

FIG. 1 is a schematic representation of the difference in transient expression of empty vector and HJ01 effector on tobacco leaves.

Detailed Description

The present invention will be described in detail with reference to the following embodiments.

Cloning of the phytophthora parasitica effector HJ01

Reagents and apparatus for experiments

Beijing Soxhibao company fungus DNA extraction kit and 10 XPCR BBuffer, dNTP Mix, PCR polymerase, cut-gel recovery kit, loading buffer, DNA marker, pipettor (0.1. Mu.l-1000. Mu.l), eppendorf table centrifuge, milli-Q ultra-pure water machine, GRANT SUB Aqua Plus digital temperature control water bath, SANYO SIM-F140 AY65 ice maker and TOMY SS-325 automatic sterilization pot, veriti of Applied Biosystems ^TM Multiple temperature control PCR instrument, BIO-RAD electrophoresis tank, voltage meter, common refrigerator, etc.

Step 1: the primers were designed as follows:

5' primer:

5’atgcgcctcgtccttgtgtg 3’

3' primer:

5’ctataggctccgatggttgg 3’

step 2, extracting the genome DNA of the tobacco black shank germ

Scraping tobacco black shank hypha cultured on an oat culture medium for 14 days, and extracting tobacco black shank DNA by using a Beijing Soy Bao fungus DNA extraction kit. The method comprises the following specific steps:

1. sample treatment: taking 50-100mg of tobacco black shank hypha, pouring a proper amount of liquid nitrogen, immediately grinding and repeating for 3 times, grinding a sample into powder, adding 200ul of solution A, adding 20ul of RNase A, adding 100mg of glass beads, and oscillating on a high-speed oscillator for about 5min.

2. 20ul of 10mg/ml proteinase K was added, mixed well, digested in a 55℃water bath for 30min. The tube can be inverted and mixed several times during digestion, and centrifuged at 12000rpm for 2min. The supernatant was transferred to a new centrifuge tube. If precipitate is present, the mixture may be centrifuged again.

3. 200ul of solution B was added to the supernatant and thoroughly mixed. If white precipitate appears, the solution can be put in a water bath at 55 ℃ for 5min, and the precipitate can disappear without influencing the subsequent experiment. If the solution is not clear, it indicates that the sample is not thoroughly digested, which may result in less and less pure DNA to be extracted, and may result in blocking of the column after loading, which may increase digestion time.

4. Adding 200ul of absolute ethyl alcohol, fully and uniformly mixing, wherein flocculent precipitate possibly appears at the moment without influencing DNA extraction, adding the solution and the flocculent precipitate into an adsorption column, and standing for 2 minutes.

5. Centrifuging at 12000rpm for 1min, discarding the waste liquid, and placing the adsorption column into a collecting tube.

6. 700ul of rinse solution (please check if absolute ethanol has been added before use) was added to the column, centrifuged at 12000rpm for 1min, the waste solution was discarded, and the column was placed in a collection tube.

7. 500ul of the rinse solution was added to the column, centrifuged at 12000rpm for 1min, the waste solution was discarded, and the column was placed in a collection tube.

8. Centrifuging at 12000rpm for 2min, and standing the adsorption column at room temperature or 50deg.C for several minutes to remove residual rinse solution in the adsorption column, which ethanol in the rinse solution can affect subsequent experiments such as enzyme digestion, PCR, etc.

9. Placing the adsorption column into a clean centrifuge tube, suspending and dripping 50-200ul of eluent preheated by 65 ℃ water bath into the center of the adsorption film, standing for 5min at room temperature, and centrifuging for 1min at 12000 rpm.

10. And adding the eluent obtained by centrifugation into an adsorption column, standing for 2min at room temperature, and centrifuging for 2min at 12000rpm to obtain high-quality genome DNA.

Step 3, PCR amplification of tobacco black shank germ effector HJ01 gene

The extracted tobacco black shank genome DNA is used as a template, and the designed specific primer is used for amplifying the effector HJ06 gene by PCR.

PCR reaction system:

the total volume was 50. Mu.l, and the reaction conditions were as follows: denaturation at 94℃for 1min; denaturation at 94℃for 30s, annealing at 56℃for 30s, extension at 72℃for 50s,35 cycles; extending at 72 ℃ for 10min; preserving heat at 4 ℃. And (3) performing gel electrophoresis on the obtained DNA product, and detecting to obtain the target fragment.

Step 4, recovery and purification of PCR products

The target fragment amplified by PCR obtained in the previous step was subjected to electrophoresis using 1% agarose gel. After completion, the target strip is cut in a UV-TV analyzer by photographing and observing under an ultraviolet and visible analyzer, and the glue recovery operation is performed according to the instruction in the glue recovery kit. The method comprises the following steps:

(1) Under a long-wave ultraviolet lamp, cutting the DNA strip to be recovered from the gel by using a clean blade, and placing the DNA strip into a clean 1.5ml centrifuge tube which is weighed in advance;

(2) Weighing the total mass of the centrifuge tube and the gel, and subtracting the mass of the centrifuge tube to obtain the mass of the gel, wherein 300 mu l Extraction Buffer is added to each 100g of gel;

(3) The gel is subjected to water bath at 55 ℃ for about 10min, and is vibrated and mixed uniformly every 2-3min until the gel is completely melted;

(4) Transferring the mixed solution obtained in the last step into a centrifugal column (Spin column), centrifuging at 6000rpm/min for 60s, and pouring out the waste liquid in a collecting pipe;

(5) Adding 600 mu l Extraction Buffer to the centrifugal column, centrifuging at 12000rpm/min for 60s, and pouring out the waste liquid in the collecting pipe;

(6) Adding 750 μl Wash Buffer into the centrifugal column, centrifuging at 12000rpm/min for 60s, and pouring out the waste liquid in the collecting pipe;

(7) The column was emptied at 12000rpm for 60s and placed into a new 1.5ml centrifuge tube;

(8) The middle part of the centrifugal column is added with 30 μl of the solution Buffer;

(9) Placing the column into a water bath kettle at about 60 ℃ for 2min;

(10) Centrifuging at 12000rpm/min for 60s, wherein the DNA product is in a centrifuge tube;

(11) Preserving at-20 DEG C

(6) Adding 600 μl of rinsing solution PW into the adsorption column, standing for 2-5min, centrifuging for 1min, and pouring out the waste liquid in the collecting tube;

(7) Centrifuging the empty tube for 2min, removing the rinsing liquid as much as possible, discarding the collecting tube, replacing the collecting tube with a sterilized centrifuge tube, and centrifuging the empty tube for 2min. The tube was replaced and centrifuged for 2min. The centrifuge tube is replaced, and the mixture is left at room temperature for 5min and thoroughly dried;

(8) Suspending 30-40 μl of eluent EB in the adsorption column, standing at room temperature for 3min, centrifuging for 2min, adding the solution in the tube into the pad, centrifuging for 2min again, discarding the adsorption column, and collecting the solution in the centrifuge tube as recovered DNA solution. Preserving at-40 ℃ for standby;

(9) The DNA was detected by 1% agarose gel electrophoresis, and the band length was the same as that of the PCR product. Step 5: preparation of E.coli DH 5. Alpha. Competence

The preparation of the competent E.coli is carried out according to the calcium chloride secondary resuspension method described in the molecular cloning experiment guidelines, and part of the preparation is slightly changed, and the preparation method comprises the following specific steps:

(1) Sucking 20 μl from the escherichia coli strain preservation bacterial liquid, inoculating into 10ml of liquid LB culture medium, shaking at 37 ℃ and 250rpm for overnight, and carrying out OD600 = 0.5;

(2) Adding 1ml of bacterial liquid cultured overnight into 100ml of newly-taken liquid LB culture medium, shake culturing for 2.5-3h at 225-250 rpm to OD600 = 0.4, subpackaging into 2 precooled 50ml centrifuge tubes, and carrying out ice water bath for 10min;

(3) Centrifuging at 12000rpm/min for 10min at 4deg.C, and collecting thallus;

(4) Discarding the supernatant, slowly adding 8ml of cold 0.1mol/L CaCl2 at 4 ℃ to re-suspend the cells until uniform;

(5) Centrifuging in ice water bath at 12000rpm/min for 5min for recovering cells;

(6) The supernatant was discarded and 2ml of cold 0.1mol/L CaCl at 4℃was used ₂ Re-suspending the thalli until uniform;

(7) Ice water bath for 2h;

(8) The competent cell suspension was dispensed in 100. Mu.l each tube with 15% glycerol and stored in a-80℃freezer using sterilized pre-chilled centrifuge tubes.

Step 6: amplification product ligation of pMDTM 19-T Vector and transformation of E.coli DH 5. Alpha

Amplification of the target product to pMDTM ¹⁹ E.coli DH 5. Alpha. Was transformed on T Vector, identified and sequenced. The connection system is as follows:

the total amount was 10ul of system. The mixture is gently shaken and then centrifuged briefly, and then is placed in a dry thermostat at 14 ℃ or in water at 14 ℃ for being kept warm overnight (12-16 h). The ligated product can be used immediately to transform competent cells.

Step 7: transformation of E.coli

(1) Taking a tube of prepared escherichia coli competent DH5 alpha in a refrigerator at the temperature of minus 80 ℃, thawing on ice, adding 5 mu l of a connecting product, lightly mixing with a gun head, and carrying out ice bath for 30min;

(2) Heating in a water bath kettle at 42 ℃ for 60s, and then rapidly carrying out ice water bath for 2min;

(3) 900. Mu.l of LB liquid medium was added, and the mixture was resuscitated at 37℃for 90 minutes while preheating a Kan-containing LB plate in a 37℃incubator.

(4) After resuscitating, centrifuging at 5000rpm/min for 5min;

(5) Sucking 900 μl of the supernatant, leaving supernatant to resuspend the cells, and coating the resuspend cells on LB plates;

(6) Culturing in a constant temperature incubator at 37 ℃ for 16-20 h in an inverted way.

Step 8: positive clone screening and PCR identification of bacterial liquid

(1) 10 individual uniform, nearly circular white colonies were selected and inoculated into 5ml LB liquid medium with Kan added, respectively;

(2) 225-250 rpm, shaking culture at 37 ℃ for 8-10 h;

(3) Performing PCR detection on bacterial liquid by using an amplification primer, and then performing gel electrophoresis and ultraviolet detection on a PCR product, wherein the PCR reaction system is 30 μl, and the amplification procedure is as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 94℃for 1min, annealing at 56℃for 30s, extension at 72℃for 50s,30 cycles; finally, the extension is carried out for 10min at 72 ℃.

Step 9: sequencing and identifying the screened positive clones

Positive clone samples consistent with the target band for PCR detection were sent to sequencing by epinason biotechnology limited. Sequencing results show that the sequence is consistent with the predicted effector sequence, and the cloned gene is proved to be the target effector HJ01.

The HJ01 gene sequence is as follows:

atgcgcctcgtccttgtgtggttggccgcagcttctaccgctctcattgcttctggtagtacgct

gtccattgctgaagcgaggccactacgatcaagcaagacgatttccaactacgacgcagcagaagaaga

agaagatcgcggctctttcaagtatacatttaatttcgacccaagcgatctaagtgcactgaaaagatt

gaataacgatcaattccacagaatggcgactcaaccggaatatttgaaacacattttcaagtcgtggaa

atccggttttaaacctctagaagactatgccagcttcatggagagcgagggggtgagtgaatatgccat

caaacacttcatcgctgccttcaaggagtacaccaaccatcggagcctatag

functional analysis of effector HJ01

PVX vector: pCamb-GR106 (cleavage site ClaI+SalI; cleavage site sequence has been added to the synthetic sequence) and then transformed into Agrobacterium LBA4404.

Step 10: target gene connection pCamb-GR106 vector

Designing a specific primer with cleavage site ClaI+SalI, carrying out PCR amplification by taking a T carrier with a target fragment as a template, amplifying the target fragment with cleavage site ClaI+SalI, then connecting the target fragment with pCamb-GR106, and converting the connection product into Agrobacterium tumefaciens LBA4404.

The specific primer sequences were as follows:

the PCR reaction system is as follows:

the total volume was 50. Mu.l, and the reaction conditions were: denaturation at 94℃for 1min; denaturation at 94℃for 30s, annealing at 56℃for 30s, extension at 72℃for 50s,35 cycles; extending at 72 ℃ for 10min; preserving heat at 4 ℃. And (3) performing gel electrophoresis on the obtained DNA product, and detecting to obtain the target fragment.

And cutting the target fragment into gel, and recovering the gel, wherein the method is the same as that described above. The recovered target fragment is connected with a carrier pCamb-GR106, and the connection system is as follows:

total 10ul system

The mixture is gently shaken and then centrifuged briefly, and then is placed in a dry thermostat at 14 ℃ or in water at 14 ℃ for being kept warm overnight (12-16 h). The ligated product can be used immediately to transform Agrobacterium.

Step 11: vector transformed agrobacterium tumefaciens

The ligation product obtained in the previous step is transformed into agrobacterium tumefaciens LBA4404, and the method comprises the following specific steps:

(1) Thawing a tube of LBA4404 Agrobacterium competent cells in ice water bath, adding 5 μl positive plasmid, and gently beating with a gun head until mixing;

(2) Placing into ice water bath, standing for 5min, cooling in liquid nitrogen for 8min, rapidly taking out the centrifuge tube, placing into 37 deg.C water bath, and heat-shock for 5min;

(3) Adding 900 μl of YEB liquid culture medium mixed with Str and Rif, at 28 ℃ and 180rpm, and resuscitating for 3-5 h by a shaking table;

(4) Centrifuging at 5000rpm/min for 5min, discarding 900 μl of supernatant;

(5) Re-suspending the bacterial cells, coating the bacterial cells on a YEB plate containing Kan, str, rif antibiotics, and culturing the bacterial cells in an inverted mode in a constant temperature incubator at 28 ℃ for about 2 days until larger bacterial colonies grow;

(6) About 10 individual uniform, nearly circular pale yellow colonies were picked with a gun head and inoculated into 5ml of YEB liquid medium with Kan, str, rif added, respectively; culturing by shaking, detecting PCR bacterial liquid, and amplifying and culturing positive cloned seeds for agrobacterium transient expression test.

Step 12: agrobacterium transient expression test method

The Agrobacterium solution was inoculated into 20ml of induction medium and incubated overnight at 28 ℃. And (5) centrifuging for 15min at 5000g, and collecting agrobacterium. 20ml of suspension (400. Mu.l MES+200. Mu.l MgCl2+19.4ml H) was added ₂ O) 10 μl of 200mM acetosyringone stock solution was added, the agrobacterium culture was suspended and adjusted to od=0.8 and left at room temperature for 3h. 100. Mu.L of the bacterial suspension was injected into the space between veins of tobacco leaves by a microinjector, the leaves were sealed by a transparent bag, and the cells were cultured in a culture room at 22℃for 16 hours, and the symptoms were observed after several days. Empty vector was also used as a control. Step 13:functional analysis of effector HJ01

Transient expression technique mediated by agrobacterium is utilized to transient table HJ01 on tobacco variety TN90 leaf, and empty vector is used as control. Experimental results indicate that HJ01 is capable of causing strong necrosis of Nicotiana benthamiana, whereas empty vectors do not exhibit symptoms (FIG. 1). HJ01 itself is shown to be toxic and causes necrosis of Nicotiana benthamiana cells, and another possibility is that HJ01 is recognized by the R protein in plants, triggering hypersensitivity reactions in hosts (hypersensitive response, HR).

Claims

1. The application of the black shank germ effect factor in inducing the necrosis of the leaf tobacco of the present invention is characterized in that the nucleotide sequence of the black shank germ effect factor is: atgcgcctcgtccttgtgtggttggccgcagcttctaccgctctcattgcttctggtagtacgctgtccattgctgaagcgaggccactacgatcaagcaagacgatttccaactacgacgcagcagaagaagaagaagatcgcggctctttcaagtatacatttaatttcgacccaagcgatctaagtgcactgaaaagattgaataacgatcaattccacagaatggcgactcaaccggaatatttgaaacacattttcaagtcgtggaaatccggttttaaacctctagaagactatgccagcttcatggagagcgagggggtgagtgaatatgccatcaaacacttcatcgctgccttcaaggagtacaccaaccatcggagcctatag.