CN108085321B

CN108085321B - Gibberellin receptor gene LsGID1 and application thereof

Info

Publication number: CN108085321B
Application number: CN201810111636.1A
Authority: CN
Inventors: 韩莹琰; 刘雪莹; 隋宪苏; 范双喜; 刘然; 黄倩; 刘超杰
Original assignee: Beijing University of Agriculture
Current assignee: Beijing University of Agriculture
Priority date: 2018-02-05
Filing date: 2018-02-05
Publication date: 2020-09-08
Anticipated expiration: 2038-02-05
Also published as: CN108085321A

Abstract

The invention discloses a gibberellin receptor gene LsGID1, and relates to the technical field of biology, wherein the gibberellin receptor gene GID1 is derived from lettuce, the specific variety is PS11, and the gene is as follows: a gene cloned from gene GID1 derived from lettuce of variety PS11 comprising: cloning a gibberellin receptor gene GID 1; the gibberellin receptor gene GID1 and the sequence of its encoded protein; and provides an application of the gibberellin receptor gene GID1 in-vivo synthesis of lettuce after high-temperature treatment. The gibberellin receptor gene GID1 has a good effect on bolting lettuce, and can provide a theoretical basis for further researching the relationship between the GID1 gene and high-temperature bolting.

Description

Gibberellin receptor gene LsGID1 and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a gibberellin receptor gene LsGID1 and application thereof.

Background

Gibberellin (GA) is a tetracyclic diterpene carboxylic acid substance in higher plants, belongs to a broad-spectrum plant growth regulator, plays an important role in all aspects of plant growth and development, and is one of the most important roles in the regulation of plant reproductive development. After GA is synthesized in plants, GA receptors can sense GA signals, then signal transduction channels are activated, and the expression of a series of downstream genes is regulated and controlled, so that the growth and development of the plants are influenced. In recent years, with the development of functional genomics, proteomics, and system biology, the GA receptor GID1 has been shown to play an important role in plant flowering and flower development. At present, the GID1 genes of cotton, poplar, goat bean, pepper and other species have been cloned.

The gibberellin signal transduction pathway is a hot spot in plant research and is well studied, wherein GID1-GA-DELLA complex is mediated by ubiquitin E3 enzyme complex (SCF)^SLY1/GID2) DELLA proteins are recognized, mediated to form polyubiquitin chains, and subsequently degraded by the 26S proteasome, thereby triggering GA responses. Previous researches find that gibberellin can promote bolting of lettuce and play an important role in regulating growth and development of the lettuce, but related researches on the bolting of the GID1 on the lettuce are rarely reported, so that changes of the gene GID1 in the lettuce under different conditions are explored, and a theoretical basis is provided for future researches on bolting of the lettuce.

Disclosure of Invention

Based on the problems in the prior art, the invention aims to provide a gibberellin receptor gene LsGID1 and application thereof, which can be beneficial to regulation and control of lettuce bolting.

The purpose of the invention is realized by the following technical scheme:

the embodiment of the invention provides a gibberellin receptor gene LsGID1, which is characterized in that the gene is as follows: the gene cloned from gene GID1 derived from lettuce of variety PS11, LsGID1, was characterized as follows:

the gene sequence table is as follows:

ATGCTCCGGCGACCGGACGGGACATTCAACCGGGAGCTCGCCGAGTTTCTTGACCGGAAAGTGGTTGCGAATACGGTTCCGGTGGATGGTGTTTACTCGTTTGATGTGATTGACCGTGCCACTGGTCTCTTCAACCGGATTTACAGATGCGCTCCACCGGAAAATGAGTCTAGTCGGCATCCCGGTGCCGGAATCATAGAGCTTGAGAAACCGCTTAGTACTACTGAAATCGTGCCGGTTATAATATTCTTTCATGGTGGAAGCTTCACTCATTCGTCTGCTAACAGTGCTATATATGATACATTTTGCCGGCGACTCACCGGGCTTATTCAAGGTGTTGTCGTTTCTGTAAACTACCGGCGGTCACCAGAGCATCGGTATCCTTGTGCTTACGAAGATGGGTGGGAAGCTCTTAAATGGGTCCATTCAAGATCATGGCTTTTGAGTGGTAAAGACTCTAAAGTCCACGTTTATTTAGCCGGTGACAGCTCCGGCGGGAATATAGCTCATCATGTGGCTCACCGGGCGGCGGTTTCCGGCGTGGAGGTTCTCGGAAACATACTCTTACACCCGTTGTTTGGTGGCGAAGAAAGGACGGAGTCGGAGAAGAAATTAGACGGAAAATATTTCGTCAAGTTACTCGACAGAGACTGGTATTGGAGAGCATTTTTGCCTGAAGGTGAAGACAGAGATCATCCTGCTTGTAATATTTTTGGTCCTCGAGGCTCTAATCTCGCCGGCGTTAACTTCCCAAAAAGTCTGGTCGTCGTCGCCGGACTGGATCTTGTTCAAGACTGGCAATTGGCGTATGTTGAAGGGCTGCAGAAAGCAGGGCAAGACGTGAAGCTCTTGTTCTTGGAAAAAGCCACAATCGGATTCTACTTCTTGCCAAACAACGAGCATTTTTACACATTAATGGAAGAAATGAAGAATTTCGTGAGTCCTTCACCGGTTTGTTCGTTGAGTCTCGCCGGCGAGAAAACCCAGAAAGAT；

the protein sequence is as follows:

MLRRPDGTFNRELAEFLDRKVVANTVPVDGVYSFDVIDRATGLFNRIYRCAPPENESSRHPGAGIIELEKPLSTTEIVPVIIFFHGGSFTHSSANSAIYDTFCRRLTGLIQGVVVSVNYRRSPEHRYPCAYEDGWEALKWVHSRSWLLSGKDSKVHVYLAGDSSGGNIAHHVAHRAAVSGVEVLGNILLHPLFGGEERTESEKKLDGKYFVKLLDRDWYWRAFLPEGEDRDHPACNIFGPRGSNLAGVNFPKSLVVVAGLDLVQDWQLAYVEGLQKAGQDVKLLFLEKATIGFYFLPNNEHFYTLMEEMKNFVSPSPVCSLSLAGEKTQKD。

the embodiment of the invention also provides application of the gibberellin receptor gene LsGID1 in controlling lettuce growth under the high-temperature condition.

According to the technical scheme provided by the invention, the gibberellin receptor gene GID1 and the application thereof provided by the embodiment of the invention have the following beneficial effects:

the gene cloned from the gene GID1 of lettuce can be used as a gibberellin receptor gene for regulating the growth of lettuce, so that the regulation of the growth of lettuce is facilitated.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

FIG. 1 is a PCR electrophoresis diagram of LsGID1 clone provided in an example of the present invention;

FIG. 2 is a schematic diagram of the relative expression level of LsGID1 in the lettuce high-temperature process provided by the embodiment of the invention.

Fig. 3 is a schematic diagram of relative expression amount of lettuce Vigs in the process of infection provided by the embodiment of the invention.

Detailed Description

The technical solutions in the embodiments of the present invention are clearly and completely described below with reference to the specific contents of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments of the present invention without making any creative effort, shall fall within the protection scope of the present invention. Details which are not described in detail in the embodiments of the invention belong to the prior art which is known to the person skilled in the art.

the gene sequence table is as follows:

the protein sequence is as follows:

the embodiment of the invention also provides application of the gibberellin receptor gene LsGID1 in regulation and control of lettuce growth.

The embodiments of the present invention are described in further detail below.

Designing a primer according to a gene sequence, cloning a gene to obtain the full length of the gene, and analyzing the expression quantity of the gene under different conditions:

the method comprises the following specific steps:

(1) designing a primer:

sequence cloning primer design using primer 5.0:

the cloning primer is as follows:

F:CTCCGGCGACCGGACGGGACAT

R:ATCTTTCTGGGTTTTCTCGCCGGCG

(2) cloning genes:

and (3) PCR reaction system:

the PCR reaction program is: pre-denaturation at 94 ℃ for 5 min; annealing at 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 1:30min (35 cycles); extending for 10min at 72 ℃; storing at 4 ℃. The recovered product was added to the pMD19-T vector, and after transformation of E.coli, screening was performed with blue-white spots, and positive clones were selected and verified for sequencing (see FIG. 1).

(3) Sample RNA extraction under different treatments:

then, healthy and plump seeds are selected for germination accelerating treatment, after radicles grow out, the seeds with the same size are sowed in 50-hole trays, and conventional culture is carried out in a PRX-450D-30 type illumination incubator (Haizixifu, China). The matrix proportion is grass peat: vermiculite: perlite is added at 2:1:1, and the culture conditions are 25 deg.C, 12000lx, 14h/20 deg.C, dark and 10 h. When the seedlings grow to the five-leaf one-heart stage, selecting plants with consistent growth vigor, planting the plants in a plastic pot, and after the seedlings are revived for one week, carrying out high-temperature treatment. The temperature of the high temperature group was 37 deg.C, the temperature of the control group was 25 deg.C, and the other culture conditions were unchanged. After the treatment, samples were taken at 0d, 1d, 3d, 5d, 7d, and 9 d.

Total RNA of leaf lettuce leaves is extracted according to the method of the RNApure Total RNA Kit RNApure high-purity Total RNA rapid extraction Kit (Beijing Ederly Bio Inc.).

(4) And (3) cDNA synthesis:

first strand cDNA Synthesis:

the following volumes of reagents were added to a 0.2ml RNase-Free PCR tube:

the above reagents were incubated at 70 ℃ for 10min, at 42 ℃ for 2min, and then rapidly chilled on ice for 2min (on a conventional PCR machine).

Adding the following reverse transcription reaction solution into the PCR tube:

and (3) fully and uniformly mixing the solution by instantaneous centrifugation for several seconds, preserving the temperature for 1h at 42 ℃, reacting for 15min at 70 ℃, cooling on ice (operating on a common PCR instrument), and storing the obtained solution, namely the cDNA, in a refrigerator at the temperature of-20 ℃ for later use.

(5) Real-time fluorescent quantitative PCR:

by using

Premix Ex Taq^TMThe fluorescent dye method is used for carrying out real-time fluorescent quantitative PCR (RT-qPCR) experiments. The 10 μ l reaction system was (fluorescent primers:

F:AATTGGCGTATGTTGAAG；

R:TGGCAAGAAGTAGAATCC)：

the cDNA solutions were diluted in 5-fold gradient, respectively: 1. 1/10, 1/100, 1/1000, 1/10000. And performing a real-time fluorescent quantitative PCR experiment by using the reference gene 18Sr to draw a standard curve.

Real-time fluorescent quantitative PCR experiment of target gene. The cDNA solution obtained by reverse transcription was diluted to 200 ng/. mu.l for RT-qPCR amplification. The reaction procedure is as follows: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 20s, annealing at 58 ℃ for 20s, extension at 72 ℃ for 20s (35 cycles), fluorescence collection at step 3 of each cycle, and finally denaturation at 95 ℃ for 1min (incubation at 0.5 ℃ for 30s per rise), annealing at 60 ℃. The reaction program of the reference gene and the target gene is the same, the annealing temperature depends on the Tm value of the primer, and the standard substance cDNA and the sample to be detected are both arranged for at least 3 times of repetition.

(6) Construction of pTRV2-LsGID1 vector:

(61) plasmid and vector cleavage reaction:

and (3) carrying out enzyme digestion reaction on the cloned plasmid and pTRV2 plasmid respectively, and adding the corresponding enzyme digestion Buffer, the plasmid, the endonuclease and ddH20 into a 20-mu-L enzyme digestion reaction system according to a certain proportion. After being washed in water at 37 ℃ for 30min, the gel was taken out and subjected to agarose gel electrophoresis to separate bands. And recovering the target band obtained by enzyme digestion and separation by using an agarose gel recovery kit.

Enzyme digestion reaction system

(62)T₄And (3) ligase connection:

adding the target fragment and the connecting vector into a PCR tube according to a certain volume, sucking, beating and uniformly mixing, and connecting at 4 ℃ overnight.

Ligation reaction System

(63) And (3) transforming escherichia coli:

the ligation product was transformed into E.coli in the same manner as above.

(64) Identification of recombinant plasmids:

and extracting the recombinant vector plasmid, carrying out enzyme digestion on the recombinant plasmid according to the double enzyme digestion steps, and sending the recombinant plasmid to a company for sequencing after verification.

(65) Plasmid transformation GV3101 agrobacterium:

(1) melting Agrobacterium rhizogenes strain at-80 deg.C on ice;

(2) adding 1mg plasmid DNA per 100mL competence, mixing, standing on ice for 10min, liquid nitrogen for 5min, treating at 37 deg.C for 5min, and ice-cooling for 5 min;

(3) adding 800mL LB culture medium without antibiotics, and shake culturing at 28 ℃ for 3 h;

(4) centrifuging at 5000rpm for 1min to collect bacteria, and gently blowing and beating about 100mL supernatant to obtain heavy suspension bacteria block. Coating the mixture on a flat plate containing Kana and Cef, and placing the flat plate in an incubator at 28 ℃ for two days in an inverted manner;

(5) and (4) picking a single colony in an LB liquid culture medium, shaking the bacteria for 8h, and extracting the plasmid. PCR verification was performed directly with primers for the desired fragment.

(7) Preparation of VIGS staining solution:

(71) picking the verified colony in 1.5mL liquid LB (containing antibiotics, MES and AS) at 28 ℃ and shaking-culturing at 200 rpm;

(72) when OD is reached₆₀₀When the concentration of the bacterial liquid is about 0.8, transferring the liquid into 100mL LB culture medium, and performing shake culture at 28 ℃ overnight;

(73) centrifuging at 5000rpm for 5min, discarding supernatant, and suspending the precipitate with buffer solution;

(74) modulation of OD₆₀₀Standing at room temperature for 3 h;

(75) after the liquid volumes of pTRV1 and pTRV2-LsHsp70-2711 are mixed uniformly according to the ratio of l to l, the leaf back of the leaf lettuce is infected by a 50ml sterile syringe with a needle removed. Negative control plants were infected with empty vector and treated plants were infected with pTRV1 and pTRV2-LsHsp 70-2711. The blank control plants were not infected and infected in three batches.

(76) Infested plants were placed in a greenhouse at 25 ℃.

(8) And (3) PCR verification:

taking tender leaves at the same position of each treated plant after infection for 3 weeks as a cDNA (complementary deoxyribonucleic acid) template, carrying out PCR (polymerase chain reaction) amplification by using a specific primer TRV, and detecting the TRV virus. To a 20. mu.L reaction system, 1mL each of the sense primer and antisense primer was added 0 XPCR Buffers 2. mu.L, rTaq polymerase 0.2. mu.L, dNTP mix (2.5mM) 0.8. mu.L, and deionized water was added to 20. mu.L. Detecting the PCR amplification product by agarose gel electrophoresis.

(9) Analysis of results (see fig. 2, 3):

a large number of experiments verify that the lettuce of the variety undergoes bolting on the 7 th day after being treated at the high temperature of 37 ℃, and fluorescence results show that the gene is remarkably increased on the 7 th day, so that the gene is further proved to have important significance for promoting bolting of the lettuce, and in addition, the lettuce is infected by constructing a pTRV2-LsGID1 vector, a PCR strip (figure 3) is successfully cloned, and the gene is further verified to possibly have important significance in bolting. The invention provides theoretical basis and research direction for researching GID1 gene by utilizing the technologies of cloning, real-time fluorescence quantification, vector construction, agrobacterium infection and the like, and simultaneously, the relationship between GID1 gene and bolting is further proved by increasing gene expression amount at 7 days, thereby providing theoretical basis for researching related genes in the future.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are included in the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

Sequence listing

<110> Beijing college of agriculture

<120> gibberellin receptor gene LsGID1 and uses thereof

<130>2020

<140>2018101116361

<141>2018-02-05

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>993

<212>DNA

<213> lettuce (Lactvca saiva L.lette)

<400>1

atgctccggc gaccggacgg gacattcaac cgggagctcg ccgagtttct tgaccggaaa 60

gtggttgcga atacggttcc ggtggatggt gtttactcgt ttgatgtgat tgaccgtgcc 120

actggtctct tcaaccggat ttacagatgc gctccaccgg aaaatgagtc tagtcggcat 180

cccggtgccg gaatcataga gcttgagaaa ccgcttagta ctactgaaat cgtgccggtt 240

ataatattct ttcatggtgg aagcttcact cattcgtctg ctaacagtgc tatatatgat 300

acattttgcc ggcgactcac cgggcttatt caaggtgttg tcgtttctgt aaactaccgg 360

cggtcaccag agcatcggta tccttgtgct tacgaagatg ggtgggaagc tcttaaatgg 420

gtccattcaa gatcatggct tttgagtggt aaagactcta aagtccacgt ttatttagcc 480

ggtgacagct ccggcgggaa tatagctcat catgtggctc accgggcggc ggtttccggc 540

gtggaggttc tcggaaacat actcttacac ccgttgtttg gtggcgaaga aaggacggag 600

tcggagaaga aattagacgg aaaatatttc gtcaagttac tcgacagaga ctggtattgg 660

agagcatttt tgcctgaagg tgaagacaga gatcatcctg cttgtaatat ttttggtcct 720

cgaggctcta atctcgccgg cgttaacttc ccaaaaagtc tggtcgtcgt cgccggactg 780

gatcttgttc aagactggca attggcgtat gttgaagggc tgcagaaagc agggcaagac 840

gtgaagctct tgttcttgga aaaagccaca atcggattct acttcttgcc aaacaacgag 900

catttttaca cattaatgga agaaatgaag aatttcgtga gtccttcacc ggtttgttcg 960

ttgagtctcg ccggcgagaa aacccagaaa gat 993

Claims

1. An application of gibberellin receptor gene LsGID1 in promoting bolting of lettuce at high temperature is disclosed, wherein the gene sequence is shown in SEQ ID NO. 1.