CN111718401A

CN111718401A - Phytophthora capsici infected plant-related protein and application thereof

Info

Publication number: CN111718401A
Application number: CN201910773418.9A
Authority: CN
Inventors: 张修国; 李京; 朱春原; 艾聪聪
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2019-08-21
Filing date: 2019-08-21
Publication date: 2020-09-29

Abstract

The invention relates to the technical field of biology, in particular to phytophthora capsici infected plant related protein and application thereof. The protein is the protein of A1), A2) or A3) as follows: A1) the protein of which the amino acid sequence is the sequence 1 in the sequence table or the protein of which the amino acid sequence is the 19 th to 384 th sites in the sequence table 1; A2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in the sequence 1 in the sequence table, has more than 90% of identity with the protein shown in A1), and is related to leaf cell necrosis and/or phytophthora capsici infection; A3) a fusion protein obtained by connecting protein tags at the N-terminal or/and the C-terminal of A1) or A2). The protein and the application thereof can provide theoretical basis for designing a new strategy for preventing and treating the pepper phytophthora blight by effectively utilizing the disease resistance mechanism of plants.

Description

Phytophthora capsici infected plant-related protein and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to phytophthora capsici infected plant related protein and application thereof.

Background

Phytophthora capsici belongs to the genus oomycete, and is a destructive filamentous plant pathogen with relatively strong pathogenicity in plants, particularly dicotyledonous plants (Margulis and Schwartz, 2000).

Phytophthora capsici belongs to the order of Oomycetes of Oomycota of the order of Peronosporales of the family Phytophthora,

phytophthora capsici usually overwinter with oospores in soil or disease residues, and diseases are transmitted by wind, water and other agricultural activities (zheng et al, 2007). After the disease occurs, new sporangia can be generated, and zoospores are formed for re-infection. The temperature range of germ growth is 10-37 deg.C, and the optimum temperature is 20-30 deg.C. Under the conditions of continuous cropping, low-lying areas, poor drainage and the like, the regions with overlarge density, weak plants and the like are all beneficial to the occurrence and spread of the disease.

The survival time of pathogenic oospores of the pepper phytophthora blight can reach about 3 years at most, and pathogenic bacteria mainly live through the winter in soil and on diseased residues in the form of the oospores so as to pass seasons with low temperature and unsuitable environment. After spring comes, the oospores will begin to germinate under appropriate temperature and humidity conditions, and zoospores can be rapidly produced to invade the roots, stem bases, leaves, etc. of the peppers (Lamour and Hausbeck, 2001). During the growth of pepper plants, pathogenic bacteria will successively produce sporangia and zoospores, which are spread by wind, rain, soil, etc., with multiple reinfestations (Ristaino et al, 1991; Ristain et al, 1992; Ristain0et al, 1993; Schlub et al, 1983; Springer et al, 1982).

The current prevention and treatment work of the pepper phytophthora blight is mainly based on the traditional chemical agent prevention and treatment. The control method has the advantages that the series of problems of heavy metal exceeding and pesticide residue caused by phytophthora capsici brings great threat to human health and environmental safety.

Disclosure of Invention

The invention aims to solve the technical problem of inhibiting phytophthora capsici from infecting plants and/or providing phytophthora capsici from infecting plant-related proteins.

The invention provides a protein, which is the following protein A1), A2) or A3):

A1) the amino acid sequence is protein of sequence 1 in a sequence table;

A2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in the sequence 1 in the sequence table, has more than 90% of identity with the protein shown in A1), and is related to leaf cell necrosis and/or phytophthora capsici infection;

A3) a fusion protein obtained by connecting protein tags at the N-terminal or/and the C-terminal of A1) or A2).

Wherein the A2 is A21, A22, A23, A24, A25 or A26 as follows, wherein:

a21, protein with amino acid sequence shown as sequence 3;

a22, protein with the amino acid sequence shown as 19 th to 384 th positions in the sequence 3;

a23, protein with amino acid sequence shown as sequence 3;

a24, protein with the amino acid sequence shown as 19 th to 384 th positions in the sequence 3;

a25, protein with amino acid sequence shown as sequence 3;

a26, the amino acid sequence of which is shown as 19 th to 384 th positions in the sequence 3.

A21 is obtained by replacing GAL of the amino acids at the 34 th to the 36 th positions in the sequence 1 with DTD, T of the amino acid at the 41 th position with A, T of the amino acid at the 46 th position with N, K of the amino acid at the 93 rd position with R, M of the amino acid at the 320 th position with P, and keeping the other amino acid sequences in the sequence 1 unchanged;

a23 is obtained by replacing 34 th to 36 th amino acids of the sequence 1 from GAL to DTD, replacing 41 th amino acid from T to A, replacing 46 th amino acid from T to N, and replacing 93 rd amino acid from K to R, and keeping other amino acid sequences of the sequence 1 unchanged;

a25 is the substitution of GAL to DTD for the amino acids at positions 34-36 in the sequence 1, the substitution of T to A for the amino acid at position 41, the substitution of T to N for the amino acid at position 46, and the substitution of K to R for the amino acid at position 93; the amino acid sequence of SEQ ID No. 1 was maintained by replacing the amino acid at position 221 with K and the amino acid at position 284 with Q and R.

Wherein the fusion protein in A3 is A31, A32, A33 or A34, wherein:

a31, protein with amino acid sequence shown as sequence 9;

a32, the amino acid sequence of which is shown as 19 th to 394 th amino acid sequence in the sequence 9;

a33, protein with amino acid sequence shown as sequence 11;

a34, the amino acid sequence of which is shown as 19 th to 398 th positions in the sequence 11.

The invention also provides a biological material related to the protein, which is any one of the following B1) to B9):

B1) a nucleic acid molecule encoding the protein of claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) the nucleic acid molecule, or a recombinant microorganism containing B2) the expression cassette, or a recombinant microorganism containing B3) the recombinant vector;

B5) a transgenic plant cell line comprising B1) the nucleic acid molecule or a transgenic plant cell line comprising B2) the expression cassette;

B6) transgenic plant tissue comprising the nucleic acid molecule of B1) or transgenic plant tissue comprising the expression cassette of B2);

B7) a transgenic plant organ containing B1) the nucleic acid molecule or a transgenic plant organ containing B2) the expression cassette.

Wherein, B1) is the nucleic acid molecule with the nucleotide of R as follows B101, B102, B103, B104, B105, B106, B107, B108, B109, B110, B111 and B112:

b101, cDNA molecules or DNA molecules of a sequence 2 in a sequence table;

b102, cDNA molecules or DNA molecules of 55 th to 1152 th sites in a sequence 2 in a sequence table;

b103, cDNA molecules or DNA molecules of a sequence 4 in a sequence table;

b104, is a cDNA molecule or a DNA molecule of 55 th to 1152 nd site in a sequence 4 in the sequence table;

b105, cDNA molecules or DNA molecules of a sequence 6 in a sequence table;

b106, cDNA molecules or DNA molecules of 55 th to 1152 th sites in a sequence 6 in a sequence table;

b107, cDNA molecules or DNA molecules of a sequence 8 in a sequence table;

b108, cDNA molecules or DNA molecules of 55 th to 1152 th sites in a sequence 8 in a sequence table;

b109, cDNA molecules or DNA molecules of a sequence 10 in a sequence table;

b110, a cDNA molecule or a DNA molecule of 55 th to 1182 th in a sequence 10 in a sequence table;

b111, cDNA molecules or DNA molecules of a sequence 12 in a sequence table;

b112, cDNA molecules or DNA molecules of 55 th to 1194 th in a sequence 10 in a sequence table.

Any of the following applications of the protein, the biomaterial, P1-P9 should also be within the scope of the present invention:

use of P1, the protein of claim 1, or the biomaterial of

claim

2 or 3 for modulating leaf cell necrosis in a plant;

use of P2, a protein according to claim 1, or a biomaterial according to

claim

2 or 3 in the manufacture of a product for reducing necrosis of plant leaves;

use of P3, the protein of claim 1, or the biomaterial of

claim

2 or 3 for growing plants that reduce leaf necrosis;

use of P4, the protein of claim 1, or the biomaterial of

claim

2 or 3 for the manufacture of a product for reducing leaf necrosis in plants;

use of P5, a protein according to claim 1, or a biomaterial according to

claim

2 or 3 for modulating phytophthora capsici infestation in plants;

use of P6, a protein according to claim 1, or a biomaterial according to

claim

2 or 3 for the manufacture of a product for increasing the resistance of plants to phytophthora capsici infestation;

use of P7, a protein according to claim 1, or a biomaterial according to

claim

2 or 3 for growing plants resistant to phytophthora capsici infestation;

use of P8, a protein according to claim 1, or a biomaterial according to

claim

2 or 3 for the preparation of a product for combating phytophthora capsici infestation in plants;

use of P9, the protein of claim 1, or the biological material of

claim

2 or 3 in plant breeding.

Wherein the plant is a monocotyledon or a dicotyledon.

The plant of claim 4, wherein said plant is Nicotiana benthamiana or Capsicum annuum.

The invention has the advantages that the RxLR23 can not only cause slight cell necrosis on the Shinikin, but also cause relatively obvious necrosis on the hot pepper, and the subsequent experimental results show that the RxLR23 starts to have the symptom of necrosis about 1-3 days after the Shinikin and the hot pepper are instantaneously expressed, and about 3-5 days can form grey-brown necrotic spots on the hot pepper leaves, and the necrotic spots are not enlarged and belong to relatively obvious cell death reaction. The homologous genes of RxLR23, RxLR3-1, RxLR6-2 and RxLR8-2 can also cause the necrosis of the leaves of Nicotiana benthamiana and capsicum, but the functions of the homologous genes are different from those of RxLR23 due to the change of individual amino acid sites; the RxLR23 homologous gene is changed in the front-segment amino acid sequence, so that the subcellular localization of the homologous gene is changed to a certain extent; the early expression level of the effector RxLR23 in plants is higher. The function of causing cell necrosis by RxLR23 is mainly concentrated in cell nucleus, the difference of RxLR23 nuclear localization has influence on the infection of phytophthora capsici, and the difference of the corresponding fusion protein RxLR23NLS and RxLR23NES has certain influence on the infection of the phytophthora capsici, for example, the fusion protein RxLR23NLS can inhibit the infection of the phytophthora capsici. Thereby providing a theoretical basis for designing a new strategy for preventing and treating the pepper phytophthora blight by effectively utilizing the disease resistance mechanism of the plant.

Drawings

FIG. 1 is a diagram showing the results of PCR electrophoresis, wherein M: marker 2000; lanes 1-2: RxLR 23; lanes 3-4: RxLR 3-1; lanes 5-6: RxLR 6-2; lanes 7-8: RxLR 8-2;

FIG. 2 is a diagram showing the result of PCR electrophoresis, wherein M: marker 2000; lanes 1-2: RxLR 23; lanes 3-4: RxLR 3-1; lanes 5-6: RxLR 6-2; lanes 7-8: RxLR 8-2; lanes 9-10: RxLR23: NES;

FIG. 3 is an analysis graph of expression pattern of RxLR 23;

FIG. 4 is a protein expression diagram of Western blot detection of effector genes;

FIG. 5 pathogenic function analysis of RxLR effector on Nicotiana benthamiana, wherein panel a: 1: RxLR3-1, 2: RxLR23, 3: INF1, 4: no-load GFP, 5: MgCl₂(ii) a And (b) figure: 1: RxLR6-2, 2: RxLR23, 3: INF1, 4: no-load GFP, 5: MgCl₂(ii) a And (c) figure: 1: RxLR8-2, 2: INF1, 3: no-load GFP, 4: MgCl₂；

FIG. 6 statistics of necrotic area of effector-inoculated B.benthamiana leaves;

FIG. 7 is a graph of the pathogenic function of RxLR effector on Capsicum annuum, wherein graph a: 1: RxLR23, 2: INF1, 3: pBIN-GFP, 4: MgCl₂(ii) a And (b) figure: 1: RxLR3-1, 2: RxLR23, 3: INF1, 4: no-load GFP, 5: MgCl₂(ii) a And (c) figure: 1: RxLR6-2, 2: RxLR23, 3: INF1, 4: GFP; 5: MgCl₂(ii) a FIG. d: 1: RxLR8-2, 2: RxLR23, 3: INF1, 4: pBIN-GFP, 5: MgCl₂；

FIG. 8 statistics of necrotic area of effector-inoculated pepper leaves;

FIG. 9. Effect of Effector on Phytophthora capsici infection status;

FIG. 10 statistics of the infected area of effector zoospores

FIG. 11 fluorescent quantitation of effector versus Phytophthora capsici infection q-pcr;

FIG. 12 study of the pathogenic function of RxLR effector on pepper, wherein panel e: 1: RxLR NLS, 2: RxLR23, 3: INF1, 4: pBIN-GFP, 5: MgCl₂. FIG. f：1：RxLR:NES，2：RxLR23，3： INF1，4：pBIN-GFP，5：MgCl₂；

FIG. 13 statistics of necrotic area of effector-inoculated pepper leaves;

FIG. 14 Western blot detection of protein expression of effector genes;

FIG. 15. Effect of Effector on Phytophthora capsici infection;

FIG. 16 area statistics of Phytophthora capsici infestation with effector factors;

FIG. 17 fluorescent quantitation of effector versus Phytophthora capsici infection q-pcr.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Vectors and strains

The cloning Vector used for the experiments, pEASY-T3 clone Vector, was purchased from Beijing Quanyujin Biotechnology Ltd, the plant expression Vector pBIN-GFP2 (disclosed in "A Virus Essential CRN efficiency of Phytophtora capsaici supress feedbacks Defence and indecs Cell Death in PlantNucluus", publicly available from the teaching laboratory of the sinus tract Dragon), pYF2-PsNLS-hSpCas9, pYF2.3G-Ribo-sgRNA (disclosed in "A Phytophta capsaici efficiency Targets ACD11 cloning of ligands which regulated ROS-Mediated Defense Response ArgRNA", available from the teaching laboratory of the sinus tract), the experimental Vector pEASY-T3 clone Vector, was purchased from Beijing university Ginkyun Biotech Ltd, the plant expression Vector pBIN-GFP2 (available from the teaching laboratory of the sinus tract Posth).

Escherichia coli (Escherichia coli) DH 5. alpha. competent cells were purchased from Kyoto Kogyo gold Biotechnology Ltd, and Agrobacterium (Agrobacterium tumefaciens) strain GV3101 was purchased from TransGen Biotechnocroration.

Phytophthora capsici strain SD33 (Phytophthora capsici SD33) (Yong Jian Jia, Bao Zhen Feng, Wen XiuuSun and Xiu Guo Zhuang, J.Phytopathol,157:585 591,2009) was publicly available from Shandong university of agriculture, and was used only for repeating the relevant experiments of the present invention and was not used for other purposes.

The biological material can be obtained from Shandong agricultural university by the public, wherein the biological material is only used for repeating relevant experiments of the invention and cannot be used for other purposes.

Primers involved in specific examples of the invention are shown in table 1:

table 1 introduction table:

example 1 cloning of RxLR23 Gene, RxLR3-1 Gene, RxLR6-2 Gene, and RxLR8-2 Gene

1. Bioinformatics analysis and basic physicochemical property analysis of phytophthora capsici RxLR effector molecules

Professor kurth in 2012 predicts about 357 effector factors in phytophthora capsici by bioinformatics analysis, most of which are highly polymorphic. RxLR effector molecules were screened against the Phytophthora capsici genome database (http:// genome. jgi-psf. org/PhycaF7/PhycaF11.download. html) and their conserved motif RxLR, RxLR84, RxLR 7, RxLR3-1, RxLR6-2, RxLR8-2 equivalent response factors were selected from published Phytophthora capsici genome (http:// genome. jgi-psf.org/PhycaF7/PhycaF11.download. html), and these 5 RxLR effector factors were aligned using DNAMAN respectively, and it was determined that these five RxLR effector factors are unique in the genome of Phytophthora capsici and RxLR3-1, RxLR 3-2-8292, RxLR effector factors have homology with RxLR8-2, and we performed three experiments to study this.

2. Cloning of RxLR23 Gene of RxLR23 Gene, RxLR3-1 Gene, RxLR6-2 Gene and RxLR8-2 Gene: the total DNA of the strain of Phytophthora capsici SD33 stored in the laboratory is used as a template to design specific primers (primer F and primer R), and the primer F (5' -ATGCGTCTTCATTATATCGTTG) is used_-3 ') and a primer R (5'-CTACGCCGCCGCCTTATA-3') to PCR-amplify the RxLR23 gene, and the PCR product of the reaction is electrophoresed on 1.2% agarose gel.

Cloning of the RxLR3-1 gene: the total DNA of Phytophthora capsici Jul0201 stored in the laboratory is used as a template, specific primers (a primer F and a primer R) are designed, the RxLR3-1 gene is amplified by PCR by using the primer F (5'-ATGCGTCTTCATTATATCGTTG-3') and the primer R (5'-CTACGCCGCCGCCTTATA-3'), and the PCR product of the reaction is subjected to electrophoresis by using 1.2% agarose gel.

Cloning of the RxLR6-2 gene: the total DNA of Phytophthora capsici Aug0202 stored in the laboratory is used as a template, specific primers (a primer F and a primer R) are designed, the RxLR6-2 gene is amplified by PCR by using the primer F (5'-ATGCGTCTTCATTATATCGTTG-3') and the primer R (5'-CTACGCCGCCGCCTTATA-3'), and the PCR product of the reaction is subjected to electrophoresis by using 1.2% agarose gel.

Cloning of the RxLR8-2 gene: the total DNA of phytophthora capsici Jul0306 stored in the laboratory is used as a template, specific primers (a primer F and a primer R) are designed, the RxLR8-2 gene is amplified by PCR by using the primer F (5'-ATGCGTCTTCATTATATCGTTG-3') and the primer R (5'-CTACGCCGCCGCCTTATA-3'), and the PCR product of the reaction is subjected to electrophoresis by using 1.2% agarose gel.

The electrophoresis results are shown in FIG. 1, wherein M in FIG. 1 represents a marker, 1-8 are electrophoresis bands of the amplification product, and the electrophoresis results show that a target band with a size of about 1500bp is obtained.

Cutting a target band, putting the cut target band into a 1.5mL centrifuge tube for gel recovery, connecting a recovered product to a pEASY-T3 vector to obtain a recombinant vector, respectively converting the recombinant vector into escherichia coli DH5 alpha, growing monoclonal bacterial plaque after 12-16h, selecting the single bacterial plaque for bacterial liquid PCR verification, and sending the bacterial liquid with the correct size of the target band to sequencing. And (5) after sequencing is carried out, absorbing bacterial liquid for amplification culture after the sequence result is correctly compared. Then, the bacterial liquid is preserved and the plasmid is extracted to obtain a cDNA plasmid connected with a pEASY-T3 recombinant vector, the pEASY-T3 recombinant plasmid containing RxLR23 is named as pEASY-T3-RxLR23, the pEASY-T3 recombinant plasmid containing RxLR3-1 is named as pEASY-T3-RxLR3-1, the pEASY-T3 recombinant plasmid containing RxLR6-2 is named as pEASY-T3-RxLR6-2, and the pEASY-T3 recombinant plasmid containing RxLR8-2 is named as pEASY-T3-RxLR 8-2.

The sequencing result shows that the nucleotide sequence of the RxLR23 gene is shown as a sequence 2, the amino acid sequence of the RxLR23 with the coding amino acid sequence shown as a sequence 1 is shown as a sequence 1, the DNA sequence of the corresponding coding gene is shown as a sequence 2, the full length of the nucleotide sequence of the phytophthora capsici effector RxLR23 is 1155bp, the maximum open reading frame ORF is 1155bp, the coding region is provided with a protein of 384 amino acids, the size of the protein is predicted to be about 42kDa by software, and a signal peptide website is used for prediction (http:// www.cbs.dtu.dk/services/SignalP /), and the signal peptide of the effector RxLR23 is 1-18 amino acids of the sequence 1. The amino acid sequence of the mature protein is shown in the 19 th to the 384 th positions of the sequence 1.

The full length of the nucleotide sequence of the phytophthora capsici effector RxLR3-1 is 1182bp, the maximum open reading frame ORF is 1182bp, a 393-amino acid protein is encoded, the size of the protein is predicted by software to be about 42kDa, and the prediction is carried out by using a signal peptide website (http:// www.cbs.dtu.dk/services/SignalP /), and the signal peptide of the effector RxLR3-1 is 1-22 amino acids at the front end. The amino acid sequence of the mature protein of the RxLR3-1 is

The full length of the nucleotide sequence of the phytophthora capsici effector gene RxLR6-2 is 1158bp, the maximum open reading frame ORF is 1158bp, 385 amino acid proteins are encoded, the size of the protein predicted by software is about 42kDa, and a signal peptide website is used for prediction. (http:// www.cbs.dtu.dk/services/SignalP /), the signal peptide of the effector gene RxLR6-2 is 1-14 amino acids at the front end. The amino acid sequence of the mature protein of the RxLR3-1 is

The full length of the nucleotide sequence of the effector gene RxLR8-2 is 1173bp, the maximum open reading frame ORF is 1173bp, 390 amino acid proteins are coded, the protein size predicted by software is about 42kDa, and the front 1-19 amino acids are found to be signal peptides by using a signal peptide website (http:// www.cbs.dtu.dk/services/SignalP /). The amino acid sequence of the mature protein of the RxLR3-1 is

4. Analysis of RxLR23 expression pattern: cDNA of a phytophthora capsici standard strain SD33 in each infection period in pepper is respectively extracted as a template, phytophthora capsici hypha (MY) is used as a reference, PcAnn is used as a reference, expression levels of RxLR23 in 1.5h, 3h, 6h, 12h, 24h, 48h and 72h are detected, and the result is shown in figure 3, wherein the result shows that RxLR23 has a higher expression level in the first 1.5h, then is obviously reduced, starts to be obviously increased after 3h, reaches the maximum expression level in 12h, then starts to be reduced, reaches the minimum value in the detection period in 72h, and provides an important basis for the next experiment by analyzing the expression pattern of an effector.

5. Construction of expression vectors

The method comprises the steps of amplifying mature genes by taking pEASY-T3-RxLR23 as a template and pBIN-RxLR23-F-Kpnl and pBIN-RxLR23-R-BamH I as primers, carrying out electrophoresis on amplified products and recycling to obtain gel recovered products, carrying out enzyme digestion on the gel recovered products and a pBIN-GFP2 vector by using Kpn I and BamH I endonucleases, and then connecting by using Solution I. The recombinant vector pBIN-GFP2 containing the mature gene of RxLR23 was obtained and named pBIN-GFP2-RxLR23 recombinant vector. pBIN-GFP2-RxLR23 is a recombinant expression vector obtained by replacing a fragment between Kpn I and BamH I recognition sites of pBIN-GFP2 with RxLR23 mature gene (a mature protein consisting of 19 th to 384 th amino acids in the sequence 1 of the sequence table) and keeping other sequences of pBIN-GFP2 unchanged.

pEASY-T3-RxLR3-1 is used as a template, pBIN-RxLR3-1-F-Kpnl and pBIN-RxLR3-1-R-BamH I are used as primers, a-RxLR 3-1 mature gene is amplified, the amplified product is subjected to electrophoresis and recovery to obtain a gel recovery product, the gel recovery product and a pBIN-GFP2 vector are subjected to enzyme digestion by using Kpn I and BamH I endonucleases and then are connected by using Solutioni I. The recombinant pBIN-GFP2 vector containing the mature gene of RxLR3-1 was obtained and named pBIN-GFP2-RxLR3-1 recombinant vector. pBIN-GFP2-RxLR3-1 is a recombinant expression vector obtained by replacing a fragment between Kpn I and BamH I recognition sites of pBIN-GFP2 with RxLR3-1 mature gene (mature protein consisting of 19 th to 384 th amino acids in sequence 3 in the coding sequence list) and keeping other sequences of pBIN-GFP2 unchanged.

The RxLR6-2 mature gene is amplified by taking pEASY-T3-RxLR6-2 as a template and pBIN-RxLR6-2-F-Kpnl and pBIN-RxLR6-2-R-BamH I as primers, the amplified product is electrophoresed and recovered to obtain a gel recovered product, the gel recovered product and a pBIN-GFP2 vector are subjected to enzyme digestion by using Kpn I and BamH I endonucleases and then are connected by using Solutioni I. The recombinant pBIN-GFP2 vector containing the mature gene of RxLR6-2 was obtained and named pBIN-GFP2-RxLR6-2 recombinant vector. pBIN-GFP2-RxLR6-2 is a recombinant expression vector obtained by replacing a fragment between Kpn I and BamH I recognition sites of pBIN-GFP2 with RxLR6-2 mature gene (mature protein consisting of 19 th to 384 th amino acids in sequence 5 in the coding sequence list) and keeping other sequences of pBIN-GFP2 unchanged.

The RxLR8-2 mature gene is amplified by taking pEASY-T3-RxLR8-2 as a template and pBIN-RxLR8-2-F-Kpnl and pBIN-RxLR8-2-R-BamH I as primers, the amplified product is electrophoresed and recovered to obtain a gel recovered product, the gel recovered product and a pBIN-GFP2 vector are subjected to enzyme digestion by using Kpn I and BamH I endonucleases and then are connected by using Solutioni I. The recombinant pBIN-GFP2 vector containing the mature gene of RxLR8-2 was obtained and named pBIN-GFP2-RxLR8-2 recombinant vector. pBIN-GFP2-RxLR8-2 is a recombinant expression vector obtained by replacing a fragment between Kpn I and BamH I recognition sites of pBIN-GFP2 with RxLR8-2 mature gene (mature protein consisting of 19 th to 384 th amino acids in the sequence 7 of the coding sequence list) and keeping other sequences of pBIN-GFP2 unchanged.

Using pEASY-T3-RxLR23 as a template, using pBIN-RxLR23NLS-F-Kpnl and pBIN-RxLR23NLS-R-Kpnl as primers, amplifying the RxLR23 mature gene, carrying out electrophoresis on the amplified product, recovering the product to obtain a gel recovered product, carrying out enzyme digestion on the gel recovered product and a pBIN-GFP2 vector by using Kpn I and BamH I endonucleases, and then carrying out connection by using Solutioni. The recombinant vector pBIN-GFP2 containing the RxLR23NLS fusion protein coding gene was obtained and named pBIN-GFP2-RxLR23NLS recombinant vector. The pBIN-GFP2-RxLR23NLS is a recombinant expression vector obtained by replacing a fragment between Kpn I and BamH I recognition sites of pBIN-GFP2 with a nucleotide sequence (a fusion protein consisting of 19 th to 394 th amino acids in a sequence 9 in a coding sequence list) having the 55 th to 1182 th positions of a sequence 10 and keeping other sequences of pBIN-GFP2 unchanged.

Using pEASY-T3-RxLR23 as a template, pBIN-RxLR23NES-F-Kpnl and pBIN-RxLR23NES-R-Kpnl as primers, amplifying the RxLR23 mature gene, carrying out electrophoresis on the amplified product, recovering the product to obtain a gel recovered product, carrying out enzyme digestion on the gel recovered product and a pBIN-GFP2 vector by using Kpn I and BamH I endonucleases, and then carrying out connection by using Solutioni I. The recombinant vector pBIN-GFP2 containing the RxLR23NES fusion protein-encoding gene was obtained and named pBIN-GFP2-RxLR23 NES. pBIN-GFP2-RxLR23NES is a recombinant expression vector obtained by replacing the fragment between Kpn I and BamH I recognition sites of pBIN-GFP2 with a fragment containing 55 th to 1194 th amino acids in sequence No. 12 (a fusion protein consisting of 19 th to 398 th amino acids in sequence No. 11 in the sequence Listing) and keeping the other sequences of pBIN-GFP2 unchanged.

6. Agrobacterium mediated phytophthora capsici RxLR effector molecule transient expression

Construction of transient expression vectors

The prepared recombinant vector pBIN-GFP2-RxLR2 is introduced into the competence of Agrobacterium GV3101 to obtain recombinant Agrobacterium, which is named as Agrobacterium-RxLR 23.

The prepared recombinant vector pBIN-GFP2-RxLR3-1 is introduced into the competence of Agrobacterium GV3101 to obtain recombinant Agrobacterium, which is named as Agrobacterium-RxLR 3-1.

The prepared recombinant vector pBIN-GFP2-RxLR6-2 is introduced into the competence of Agrobacterium GV3101 to obtain recombinant Agrobacterium, which is named as Agrobacterium-RxLR 6-2.

The prepared recombinant vector pBIN-GFP2-RxLR8-2 is introduced into the competence of Agrobacterium GV3101 to obtain recombinant Agrobacterium, which is named as Agrobacterium-RxLR 8-2.

The prepared recombinant vector pBIN-GFP2-RxLR23NLS is introduced into the competence of Agrobacterium GV3101 to obtain recombinant Agrobacterium, which is named as Agrobacterium-RxLR 23 NLS.

The prepared recombinant vector pBIN-GFP2-RxLR23NE is introduced into the competence of Agrobacterium GV3101 to obtain recombinant Agrobacterium, which is named as Agrobacterium-RxLR 23 NE.

7. Western Blot detection of effector genes: agrobacterium, Agrobacterium-RxLR 23, Agrobacterium-RxLR 3-1, Agrobacterium-RxLR 6-2 and Agrobacterium-RxLR 8-2 containing empty vector pBIN-GFP2 are injected into Ben tobacco and pepper leaves respectively, and fusion protein of effector gene and GFP is expressed instantaneously to obtain Ben tobacco and pepper leaves inoculated with Agrobacterium. Extracting protein of the leaf, carrying out Western Blot detection experiment, and using primary antibody: GFP, secondary antibody: goat anti-mouse-HRP is detected, and the internal reference adopts an Action gene. The Western blot results in FIG. 4 show that on PVDF membrane, the target bands with the sizes similar to those of RxLR23, RxLR3-1, RxLR6-2 and RxLR RxL8-2 predicted proteins can be detected, which indicates that the several effector factors can be correctly expressed in Nicotiana capsaici.

Example 2

1. Influence on the necrosis of Bunshi tobacco leaf cells

With no loading of GFP, INF1, MgCl₂For comparison, 4 effector factors of RxLR23, RxLR3-1, RxLR6-2 and RxLR8-2 were transiently expressed on Nicotiana benthamiana for observation and analysis. Agrobacterium containing the empty vector pBIN-GFP2 and Agrobacterium-RxLR 23, Agrobacterium-RxLR 3-1, Agrobacterium-RxLR 6-2 and Agrobacterium-RxLR 8-2 of example 1 were inoculated onto Bentonium tabacum leaves, which were then photographed and recorded, stained with trypan blue staining solution, and decolorized with chloral hydrate and alcohol. The results are shown in FIG. 5, and FIG. 5 shows the leaf symptoms after transient expression of each effector, wherein in FIG. 5a, 1-5 respectively represent RxLR3-1, RxLR23, INF1, unloaded GFP and MgCl₂: 1 in FIG. 5 b: RxLR6-2, 2: RxLR23, 3: INF1, 4: no-load GFP, 5: MgCl₂. In fig. 5 c: 1: RxLR8-2, 2: INF1, 3: no-load GFP, 4: MgCl₂. . The statistics of necrosis areas of the inoculated Ben tobacco leaves with the effect factors are shown in FIG. 6.As can be seen from FIGS. 5 and 6, RxLR23 caused slight chlorosis and necrosis of B.benthamiana leaf cells, RxLR6-2 and RxLR8-2 also caused slight necrosis of B.benthamiana leaf cells, and RxLR3-1 caused substantially no necrosis of B.benthamiana leaf cells.

Compared with a negative control GFP, the inoculated part transiently expressing RxLR23, RxLR6-2 and RxLR8-2 can see slight chlorotic necrosis of the tobacco leaf cells of the ben's eye, and a light blue color appears after trypan blue staining, which indicates that the necrosis degree of an effector factor is lighter; after the RxLR3-1 is expressed transiently, the inoculated part can not be seen with naked eyes to be faded and necrosed, and the inoculated part can not be seen with blue after being dyed, which indicates that the effector can not cause necrosis basically; the positive control INF1 inoculated portion appeared dark blue, indicating that INF1 normally caused tobacco lamina PTI.

2. Influence on cell necrosis of pepper leaf

With no loading of GFP, INF1, MgCl₂For comparison, 4 effector factors of RxLR23, RxLR3-1, RxLR6-2 and RxLR8-2 were transiently expressed on pepper leaves for observation and analysis.

Agrobacterium containing the empty vector pBIN-GFP2 and Agrobacterium-RxLR 23, Agrobacterium-RxLR 3-1, Agrobacterium-RxLR 6-2 and Agrobacterium-RxLR 8-2 of example 1 were inoculated onto Benghace tabacum leaves, which were then photographed and recorded, stained with trypan blue staining solution, and decolorized with chloral hydrate and alcohol. The results are shown in FIG. 7, which is a leaf symptom after transient expression of several of the above effectors, wherein FIG. a: 1: RxLR23, 2: INF1, 3: pBIN-GFP, 4: MgCl₂(ii) a And (b) figure: 1: RxLR3-1, 2: RxLR23, 3: INF1, 4: no-load GFP, 5: MgCl₂(ii) a And (c) figure: 1: RxLR6-2, 2: RxLR23, 3: INF1, 4: GFP; 5: MgCl₂(ii) a FIG. d: 1: RxLR8-2, 2: RxLR23, 3: INF1, 4: pBIN-GFP, 5: MgCl₂. FIG. 8 is statistics of necrotic area of effector-inoculated pepper leaves. After agrobacterium inoculation, RxLR23 can quickly cause necrosis of pepper leaf cells, RxLR6-2 and RxLR8-2 can also cause necrosis of pepper leaves, and RxLR3-1 has light necrosis degree and slow lethal effect compared with the 3 effector genes. Compared with a negative control GFP, the transient stateWhen the inoculated parts of the RxLR23, the RxLR6-2 and the RxLR8-2 are expressed, the slight chlorosis and necrosis of the tobacco leaf cells of the ben-shi can be seen by naked eyes, and the slight blue appears after trypan blue staining, which indicates that the necrosis degree of effector factors is lighter; the RxLR3-1 is expressed transiently, the inoculated part is not seen to be faded and necrotic by naked eyes, and the inoculated part does not appear blue after dyeing, which indicates that the effector does not cause necrosis basically; the positive control INF1 inoculated portion appeared dark blue, indicating that INF1 normally caused tobacco lamina PTI.

Example 3 Regulation of Phytophthora capsici infection ability of plants

Infection of tobacco leaves experiment:

tobacco leaves of Ben's tobacco inoculated with Agrobacterium (control), Agrobacterium-RxLR 23, Agrobacterium-RxLR 3-1 and Agrobacterium-RxLR 6-2 containing empty vector pBIN-GFP2 were prepared according to the method in

step

2, and 2 layers of filter paper were laid on the bottom of a large petri dish, a small amount of mountain spring water was poured in to wet, a few traces were lightly scratched on the inoculated tobacco leaves with a fine needle, then 15. mu.L was dropped into the large petri dish, and the dish was placed in a25 ℃ incubator and treated in the dark for about 3 days. After the infection condition is stable, photographing under an ultraviolet lamp, and then photographing and dyeing. The results are shown in FIG. 9. After statistics of infection conditions of various effector factors, the results are shown in fig. 10, and experimental results show that compared with unloaded GFP, RxLR23 and RxLR6-2 can promote infection of phytophthora capsici SD33 zoospores, and RxLR3-1 can inhibit infection of phytophthora capsici zoospores to a certain extent. Studies have shown that the difference in amino acid positions between RxLR3-1 and RxLR23 may play a functionally critical role.

Then DNA of phytophthora capsici zoospore infected leaves is respectively extracted, and by taking the DNA as a template, and by taking pBIN-RxLR23-F-KpnI, pBIN-RxLR 23-R-BamHI, pBIN-RxLR3-1-F-KpnI, pBIN-RxLR3-1-R-BamHI, pBIN-RxLR6-2-F-KpnI and pBIN-RxLR 6-2-R-BamHI as primers and taking Action of the cigarette of the national origin as reference, fluorescent quantitative analysis is carried out. The results are shown in FIG. 11.

Example 4

1. The fusion proteins RxLR23NLS and RxLR23NES modulate the ability of plant cells to necrose:

with no loading of GFP, INF1, MgCl₂For comparison, 2 effector factors of RxLR23NLS and RxLR23NES are transiently expressed on pepper leaves, and observed and analyzed after 5-7 days.

Agrobacterium containing the empty vector pBIN-GFP2 and Agrobacterium-RxLR 23, Agrobacterium-RxLRNLS, Agrobacterium-RxLRNES in example 1 were inoculated onto B.benthamiana leaves, and then the qualified B.benthamiana leaves were photographed and recorded, stained with trypan blue staining solution, and decolorized with chloral hydrate and alcohol. The results are shown in FIG. 12, FIG. 12 is the leaf symptoms after transient expression of the respective effector Agrobacterium, where panel e: 1: RxLR NLS, 2: RxLR23, 3: INF1, 4: pBIN-GFP, 5: MgCl₂(ii) a FIG. f: 1: NES, 2: RxLR23, 3: INF1, 4: pBIN-GFP, 5: MgCl₂. The statistical map of the necrotic area of the leaf is shown in fig. 13.

As a result, RxLR23NLS can cause necrosis of pepper leaves; the RxLR23NES does not substantially cause necrosis of the pepper leaves. Comparison with a negative control GFP shows that the necrosis of the pepper leaf cells can be seen by naked eyes in the inoculated part of the RxLR23NLS which is transiently expressed, and the dark blue appears after trypan blue staining, which indicates that the necrosis degree is relatively heavy; after transient expression of RxLR23NES, the inoculated fraction was visibly chlorosis or slightly necrosed, and after staining appeared blue or bluish, indicating slight necrosis or no necrosis. Namely, RxLR23: NLS can cause pepper leaf necrosis, RxLR23: NES can not cause pepper leaf necrosis basically, and nuclear localization does not influence effector function after comparing with the function of RxLR 23; after the effector carries the nuclear output signal, the function of the RxLR23 is changed. Therefore, the effector RxLR23 induces cell necrosis mainly concentrated in the cell nucleus.

2. Western blot detection of fusion proteins RxLR23NLS and RxLR23 NES:

agrobacterium, Agrobacterium-RxLR 23, Agrobacterium-RxLRNES and Agrobacterium-RxLRNLS containing empty vector pBIN-GFP2 are injected into Benzen's tobacco and pepper leaves respectively, and fusion protein of effector gene and GFP is expressed transiently to obtain Benzen's tobacco and pepper leaves inoculated with Agrobacterium. Extracting protein of the leaf, carrying out Western Blot detection experiment, and using primary antibody: GFP, secondary antibody: goat anti-mouse-HRP is detected, and the internal reference adopts an Action gene. The Western blot results in fig. 14 show that target bands similar to the sizes of the proteins predicted by RxLR23, RxLRNES, RxLRNLS can be detected on the PVDF membrane, and that both RxLR23NLS and RxLR23NES can be normally expressed.

Example 5

1. Regulation and control of fusion proteins RxLR23NLS and RxLR23NES on phytophthora capsici infection conditions

Agrobacterium containing empty vector pBIN-GFP2 and Agrobacterium-RxLR 23, Agrobacterium-RxLRNLS and Agrobacterium-RxLRNES in example 1 were inoculated onto the leaf of Nicotiana benthamiana, after 24h, the zoospore suspension of the phytophthora capsici SD33 strain prepared by induction was dropped in the center of the same inoculated leaf (the zoospore amount of each leaf was consistent), then the leaf was placed in an incubator at 25 ℃ for dark treatment, after 72h, the leaf of Nicotiana benthamiana was taken out, photographed under an ultraviolet lamp, finally stained with trypan blue stain, the staining results are shown in FIG. 15, and after statistics of infection of each effector gene, the statistical results are shown in FIG. 16. The experimental results show that compared with unloaded GFP and RxLR23, RxLR23NLS can inhibit the infection of phytophthora capsici, and RxLR23NES can promote the infection of phytophthora capsici. The RxLR23 shows that the function of promoting phytophthora capsici infection is mainly concentrated in cytoplasm.

Then, DNAs of phytophthora capsici zoospore infected leaves are respectively extracted, and by taking the DNAs as templates, primers of pBIN-RxLR23-F-KpnI, pBIN-RxLR23-R-BamH I, pBIN-RxLR23NES-F-KpnI, pBIN-RxLR23NES-R-BamH I, pBIN-RxLR23NLS-F-KpnI and pBIN-RxLR23NLS-R-BamH I and Action of the cigarette are taken as references to perform fluorescence quantitative analysis, and the statistical result is shown in figure 17.

The tests show that the effector protein RxLR23 can not only cause slight cell necrosis on the Nicotiana benthamiana but also cause relatively obvious necrosis on the capsicum, and the subsequent experimental results show that the RxLR23 starts to have the symptom of necrosis about 1-3 days after the Nicotiana benthamiana and the capsicum are instantaneously expressed, about 3-5 days can form grey-brown necrotic spots on capsicum leaves, and the necrotic spots are not enlarged and belong to relatively obvious HR reaction. However, the death mechanism caused by effector cannot be completely determined, so it is suspected that the existence of resistant R proteins in plants can recognize each other, but the interaction proteins need to be screened by yeast double-hybrid technology, and the target of RxLR23 effector gene and the interaction relationship possibly exist are found to further explore the mechanism of RxLR effector infecting host plants.

The effector protein RxLR23 has sequence polymorphism in different strains of phytophthora capsici, and the effector factors can also cause the necrosis of the leaves of the Nicotiana benthamiana and the pepper, but the functions of the effector protein RxLR23 have some differences with RxLR23 due to the change of individual amino acid sites; the RxLR23 homologous gene has a certain change in subcellular localization due to the change of the front-segment amino acid sequence; the early expression level of the effector RxLR23 in plants is higher, and HR reaction can be quickly caused; the function of RxLR23 for triggering cell necrosis is mainly concentrated in cell nucleus, the difference of RxLR23 nuclear localization has influence on the infection of phytophthora capsici, and the difference of homologous gene amino acid sequences also has certain influence on the infection of phytophthora capsici.

Sequence listing

<110> Shandong university of agriculture

<120> phytophthora capsici infected plant-related protein and application thereof

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>384

<212>PRT

<213>Phytophthora capsici

<400>1

Met Arg Leu His Tyr Ile Val Val Leu Ala Val Ile Ala Phe Ala Thr

1 5 10 15

Asn Gly Asn Glu Val Ser Ala Gly Lys Ser Arg Val Ala Ile Thr Thr

20 25 30

Thr Gly Ala Leu Asp Thr Pro Thr Thr Arg Leu Leu Arg Thr Gln Tyr

35 40 45

Thr Asp Glu Glu Arg Ala Phe Gly Leu Asn Leu Leu Pro Gly Ser Lys

50 55 60

Lys Ile Ser Ser Ile Ile Thr Asn Lys Lys Leu Ser Lys Tyr Leu Lys

65 70 75 80

Ser Asn Gln Glu Phe Asp Asp Val Phe Ile Lys Leu Lys Leu Asp Lys

85 90 95

Ala Gly Asp Lys Leu Phe Glu Asn Pro Lys Phe Leu Ala Trp Ala Gln

100 105 110

Tyr Val Asp Asp Phe Asn Gln Lys His Gln Thr Gln Asn Ser Met Leu

115 120 125

Pro Thr Leu Val Arg Gln Phe Gly Gly Asp Asp Leu Ser Ile Met Leu

130 135 140

Glu Lys Ala Lys Gln Ala Asp Lys Thr Tyr Gly Val Ala Leu Arg Leu

145 150 155 160

Gln Gly Glu Gln Met Lys Leu Trp Arg Arg Glu Gly Leu Thr Thr Asp

165 170 175

Met Leu Phe Lys Ile Tyr Lys Leu Asp Asp Gly Ala Thr Asn Leu Leu

180 185 190

Glu Asn Pro Gly Ile Lys Ile Trp Met Arg Tyr Ala Asp Glu Leu Phe

195 200 205

Pro Gly Asp Ser Thr Leu Leu Phe Lys Lys Leu Gln Lys Thr Tyr Ser

210 215 220

Asp Glu Ala Leu Ser Lys Ile Leu Ile Asn Gly Lys Thr Val Ala Ser

225 230 235 240

Thr Glu Lys Leu Ala Ser Asp Leu Gln Asn Gln Gln Leu Arg Tyr Trp

245 250 255

Leu Lys Asp Leu Val Pro Pro Glu Lys Ala Phe Gln Leu Leu Ser Leu

260 265 270

Asn Lys Gly Ala Asp Asp Val Phe Gly Ser Pro Gln Leu Gln Thr Trp

275 280 285

Ile Arg Tyr Asn Ala Ala Tyr Ala Lys Gln Asn Pro Tyr Ala His Lys

290 295 300

Ala Thr Leu Ile Asp Thr Leu Leu Glu Asn Phe Asp Thr Ala Ala Met

305 310 315 320

Val Lys Met Leu Lys Thr Arg Pro Asn Thr Ala Tyr Gly Lys His Leu

325 330 335

Ala Gly Gly Val Glu Arg Asp Leu Ile Lys Arg Trp Val Thr Asp Gly

340 345 350

Lys Pro Leu Lys Phe Val Val Glu Asn Leu Gly Ser Ser Ser Pro Ala

355 360 365

Lys Lys Glu Phe Val Thr Gly Leu Tyr Asn Lys Tyr Lys Ala Ala Ala

370 375 380

<210>2

<211>1155

<212>DNA

<213>Phytophthora capsici

<400>2

atgcgtcttc attatatcgt tgtgctcgcg gtcattgcct tcgccacgaa cgggaatgaa 60

gtctcagctg gcaagtcccg tgtcgccata actactactg gtgcacttga cacccccaca 120

accagactct tgaggaccca gtacacggac gaagagaggg cgttcggcct caatcttctc 180

cctggaagca agaaaatctc aagtatcata acaaacaaga aactgtccaa gtatctcaag 240

agcaaccaag aattcgacga cgtgttcatc aaactcaagc tcgacaaggc cggagacaag 300

ttgttcgaga acccgaaatt cctcgcttgg gctcaatacg tggacgattt caatcagaaa 360

caccagaccc agaactcgat gctccccacg cttgtgcgac agtttggagg cgatgatctg 420

tcgattatgt tggaaaaggc caagcaggca gacaaaacct acggggtggc gttgagactt 480

cagggcgaac agatgaaact ctggagacgt gaaggtctca ctactgacat gctcttcaaa 540

atctacaaat tagatgatgg ggctacgaat ctgctggaaa acccaggcat caaaatttgg 600

atgaggtacg cagacgaact tttccctgga gactccacac ttctcttcaa gaagctgcaa 660

aagacgtatt cggacgaggc gttatccaaa atcttgatca acgggaaaac agtcgcaagt 720

acggagaagt tggcgtcgga cttgcagaac cagcaacttc gttattggtt gaaggatctt 780

gtgcctccag agaaggcctt ccagctgctg tcactcaaca agggggcgga cgatgtgttt 840

ggtagtcccc aactgcagac gtggattcgg tacaatgcag cttacgccaa gcagaatccg 900

tacgctcaca aggcgacgct gatcgatacg ctcctggaga atttcgacac tgccgctatg 960

gtcaaaatgc tcaaaacgag gccgaataca gcctacggca agcatttggc tggtggggtg 1020

gaacgtgatc tcatcaaaag gtgggttacg gacggaaaac cgctcaaatt tgttgtcgag 1080

aacctggggt cgtcatcgcc tgccaagaag gagtttgtga cggggttata caataagtat 1140

aaggcggcgg cgtag 1155

<210>3

<211>384

<212>PRT

<213>Phytophthora capsici

<400>3

Met Arg Leu His Tyr Ile Val Val Leu Ala Val Ile Ala Phe Ala Thr

1 5 10 15

Asn Gly Asn Glu Val Ser Ala Gly Lys Ser Arg Val Ala Ile Thr Thr

20 25 30

Thr Asp Thr Ile Asp Thr Pro Thr Ala Arg Leu Leu Arg Asn Gln Tyr

35 40 45

Thr Asp Glu Glu Arg Ala Phe Gly Leu Asn Leu Leu Pro Gly Ser Lys

50 55 60

Lys Ile Ser Ser Ile Ile Thr Asn Lys Lys Leu Ser Lys Tyr Leu Lys

65 70 75 80

Ser Asn Gln Glu Phe Asp Asp Val Phe Ile Lys Leu Arg Leu Asp Lys

85 90 95

Ala Gly Asp Lys Leu Phe Glu Asn Pro Lys Phe Leu Ala Trp Ala Gln

100 105 110

Tyr Val Asp Asp Phe Asn Gln Lys His Gln Thr Gln Asn Ser Met Leu

115 120 125

Pro Thr Leu Val Arg Gln Phe Gly Gly Asp Asp Leu Ser Ile Met Leu

130 135 140

Glu Lys Ala Lys Gln Ala Asp Lys Thr Tyr Gly Val Ala Leu Arg Leu

145 150 155 160

Gln Gly Glu Gln Met Lys Leu Trp Arg Arg Glu Gly Leu Thr Thr Asp

165 170 175

Met Leu Phe Lys Ile Tyr Lys Leu Asp Asp Gly Ala Thr Asn Leu Leu

180 185 190

Glu Asn Pro Gly Ile Lys Ile Trp Met Arg Tyr Ala Asp Glu Leu Phe

195 200 205

Pro Gly Asp Ser Thr Leu Leu Phe Lys Lys Leu Gln Lys Thr Tyr Ser

210 215 220

Asp Glu Ala Leu Ser Lys Ile Leu Ile Asn Gly Lys Thr Val Ala Ser

225 230 235 240

Thr Glu Lys Leu Ala Ser Asp Leu Gln Asn Gln Gln Leu Arg Tyr Trp

245 250 255

Leu Lys Asp Leu Val Pro Pro Glu Lys Ala Phe Gln Leu Leu Ser Leu

260 265 270

Asn Lys Gly Ala Asp Asp Val Phe Gly Ser Pro Gln Leu Gln Thr Trp

275 280 285

Ile Arg Tyr Asn Ala Ala Tyr Ala Lys Gln Asn Pro Tyr Ala His Lys

290 295 300

Ala ThrLeu Ile Asp Thr Leu Leu Glu Asn Phe Asp Thr Ala Ala Arg

305 310 315 320

Val Lys Met Leu Lys Thr Arg Pro Asn Thr Ala Tyr Gly Lys His Leu

325 330 335

Ala Gly Gly Val Glu Arg Asp Leu Ile Lys Arg Trp Val Thr Asp Gly

340 345 350

Lys Pro Leu Lys Phe Val Val Glu Asn Leu Gly Ser Ser Ser Pro Ala

355 360 365

Lys Lys Glu Phe Val Thr Gly Leu Tyr Asn Lys Tyr Lys Ala Ala Ala

370 375 380

<210>4

<211>1155

<212>DNA

<213>Phytophthora capsici

<400>4

atgcgtcttc attatatcgt tgtgctcgcg gtcattgcct tcgccacgaa cgggaatgaa 60

gtctcagctg gcaagtcccg tgtcgccata actactactg atacaattga cacccctaca 120

gccagactct tgaggaacca gtacacggac gaagagaggg cgttcggcct caatcttctc 180

cctggaagca agaaaatctc aagtatcata acaaacaaga aactgtccaa gtatctcaag 240

agtaaccaag aattcgacga tgttttcatc aagctgaggc tcgacaaggc cggagacaag 300

ttgttcgaga acccgaaatt cctcgcttgg gctcaatacg tggacgattt caaccagaaa 360

caccagaccc agaactcgat gctccccacg cttgtgcgac agtttggagg cgatgatctg 420

tcgattatgt tggaaaaggc caagcaggcg gacaagacct acggcgtggc gttgagactt 480

cagggcgaac agatgaaact ctggagacgt gaaggtctca ctacggacat gctattcaaa 540

atctacaaat tagatgatgg ggctacgaat ctgctggaaa acccaggcat caaaatttgg 600

atgaggtacg cggatgaact tttccctgga gactccacgc ttctcttcaa gaagctgcaa 660

aagacgtatt cggacgaggc gttatccaaa atcttgatca acgggaaaac agtcgcgagt 720

acggagaagt tggcgtcgga cttgcagaac cagcaacttc gttattggtt gaaggatctt 780

gtacctccgg agaaggcctt ccagctgctg tcactcaaca agggggcgga cgatgtgttt 840

ggtagtcccc aactgcagac gtggattcgg tacaatgcag cttacgccaa gcagaatccg 900

tacgctcaca aggcgacgct gatcgataca ctcctggaga atttcgacac tgccgctagg 960

gtcaaaatgc ttaaaacgag gccgaataca gcttacggca agcatttggc tggtggggtg 1020

gaacgtgatc tcatcaaaag gtgggttaca gacggaaaac cgctcaaatt tgttgtcgag 1080

aacctggggt cgtcatcgcc tgccaagaag gagtttgtga cggggttata caataagtat 1140

aaggcggcgg cgtag 1155

<210>5

<211>384

<212>PRT

<213>Phytophthora capsici

<400>5

Met Arg Leu His Tyr Ile Val Val Leu Ala Val Ile Ala Phe Ala Thr

1 5 10 15

Asn Gly Asn Glu Val Ser Ala Gly Lys Ser Arg Val Ala Ile Thr Thr

20 25 30

Thr Asp Thr Ile Asp Thr Pro Thr Ala Arg Leu Leu Arg Asn Gln Tyr

35 40 45

Thr Asp Glu Glu Arg Ala Phe Gly Leu Asn Leu Leu Pro Gly Ser Lys

50 55 60

Lys Ile Ser Ser Ile Ile Thr Asn Lys Lys Leu Ser Lys Tyr Leu Lys

65 70 75 80

Ser Asn Gln Glu Phe Asp Asp Val Phe Ile Lys Leu Arg Leu Asp Lys

85 90 95

Ala Gly Asp Lys Leu Phe Glu Asn Pro Lys Phe Leu Ala Trp Ala Gln

100 105 110

Tyr Val Asp Asp Phe Asn Gln Lys His Gln Thr Gln Asn Ser Met Leu

115 120 125

Pro Thr Leu Val Arg Gln Phe Gly Gly Asp Asp Leu Ser Ile Met Leu

130 135 140

Glu Lys Ala Lys Gln Ala Asp Lys Thr Tyr Gly Val Ala Leu Arg Leu

145 150 155 160

Gln Gly Glu Gln Met Lys Leu Trp Arg Arg Glu Gly Leu Thr Thr Asp

165 170 175

Met Leu Phe Lys Ile Tyr Lys Leu Asp Asp Gly Ala Thr Asn Leu Leu

180 185 190

Glu Asn Pro Gly Ile Lys Ile Trp Met Arg Tyr Ala Asp Glu Leu Phe

195 200 205

Pro Gly Asp Ser Thr Leu Leu Phe Lys Lys Leu Gln Lys Thr Tyr Ser

210 215 220

Asp Glu Ala Leu Ser Lys Ile Leu Ile Asn Gly Lys Thr Val Ala Ser

225 230 235 240

Thr Glu Lys Leu Ala Ser Asp Leu Gln Asn Gln Gln Leu Arg Tyr Trp

245 250 255

Leu Lys Asp Leu Val Pro Pro Glu Lys Ala Phe Gln Leu Leu Ser Leu

260 265 270

Asn Lys Gly Ala Asp Asp Val Phe Gly Ser Pro Gln Leu Gln Thr Trp

275 280 285

Ile Arg Tyr Asn Ala Ala Tyr Ala Lys Gln Asn Pro Tyr Ala His Lys

290 295 300

Ala Thr Leu Ile Asp Thr Leu Leu Glu Asn Phe Asp Thr Ala Ala Met

305 310 315 320

Val Lys Met Leu Lys Thr Arg Pro Asn Thr Ala Tyr Gly Lys His Leu

325 330 335

Ala Gly Gly Val Glu Arg Asp Leu Ile Lys Arg Trp Val Thr Asp Gly

340 345 350

Lys Pro Leu Lys Phe Val Val Glu Asn Leu Gly Ser Ser Ser Pro Ala

355 360 365

Lys Lys Glu Phe Val Thr Gly Leu Tyr Asn Lys Tyr Lys Ala Ala Ala

370 375 380

<210>6

<211>1155

<212>DNA

<213>Phytophthora capsici

<400>6

atgcgtcttc attatatcgt tgtgctcgcg gtcattgcct tcgccacgaa cgggaatgaa 60

gtctcagctg gcaagtcccg tgtcgccata actactactg atacaattga cacccctaca 120

gccagactct tgaggaacca gtacacggac gaagagaggg cgttcggcct caatcttctc 180

cctggaagca agaaaatctc aagtatcata acaaacaaga aactgtccaa gtatctcaag 240

agtaaccaag aattcgacga tgttttcatc aagctgaggc tcgacaaggc cggagacaag 300

ttgttcgaga acccgaaatt cctcgcttgg gctcaatacg tggacgattt caaccagaaa 360

caccagaccc agaactcgat gctccccacg cttgtgcgac agtttggagg cgatgatctg 420

tcgattatgt tggaaaaggc caagcaggcg gacaagacct acggcgtggc gttgagactt 480

cagggcgaac agatgaaact ctggagacgt gaaggtctca ctacggacat gctattcaaa 540

atctacaaat tagatgatgg ggctacgaat ctgctggaaa acccaggcat caaaatttgg 600

atgaggtacg cggatgaact tttccctgga gactccacgc ttctcttcaa gaagctgcaa 660

aagacgtatt cggacgaggc gttatccaaa atcttgatca acggaaaaac agtcgcgagt 720

acggagaagt tggcgtcgga cttgcagaac cagcaacttc gttattggtt gaaggatctt 780

gtacctccgg agaaggcctt ccagctgctg tcactcaaca agggggcgga cgatgtgttt 840

ggtagtcccc aactgcagac gtggattcgg tacaatgcag cttacgccaa gcagaatccg 900

tacgctcaca aggcgacgct gatcgataca ctcctggaga atttcgacac tgccgctatg 960

gtcaaaatgc tcaaaacgag gccgaataca gcttacggca agcatttggc tggtggggtg 1020

gaacgtgatc tcatcaaaag gtgggttaca gacggaaaac cgctcaaatt tgttgtcgag 1080

aacctggggt cgtcatcgcc tgccaagaag gagtttgtga cggggttata caataagtat 1140

aaggcggcgg cgtag 1155

<210>7

<211>384

<212>PRT

<213>Phytophthora capsici

<400>7

Met Arg Leu His Tyr Ile Val Val Leu Ala Val Ile Ala Phe Ala Thr

1 5 10 15

Asn Gly Asn Glu Val Ser Ala Gly Lys Ser Arg Val Ala Ile Thr Thr

20 25 30

Thr Asp Thr Ile Asp Thr Pro Thr Ala Arg Leu Leu Arg Asn Gln Tyr

35 40 45

Thr Asp Glu Glu Arg Ala Phe Gly Leu Asn Leu Leu Pro Gly Ser Lys

50 55 60

Lys Ile Ser Ser Ile Ile Thr Asn Lys Lys Leu Ser Lys Tyr Leu Lys

65 70 75 80

Ser Asn Gln Glu Phe Asp Asp Val Phe Ile Lys Leu Arg Leu Asp Lys

85 90 95

Ala Gly Asp Lys Leu Phe Glu Asn Pro Lys Phe Leu Ala Trp Ala Gln

100 105 110

Tyr Val Asp Asp Phe Asn Gln Lys His Gln Thr Gln Asn Ser Met Leu

115 120 125

Pro Thr Leu Val Arg Gln Phe Gly Gly Asp Asp Leu Ser Ile Met Leu

130 135 140

Glu Lys Ala Lys Gln Ala Asp Lys Thr Tyr Gly Val Ala Leu Arg Leu

145 150 155 160

Gln Gly Glu Gln Met Lys Leu Trp Arg Arg Glu Gly Leu Thr Thr Asp

165 170 175

Met Leu Phe Lys Ile Tyr Lys Leu Asp Asp Gly Ala Thr Asn Leu Leu

180 185 190

Glu Asn Pro Gly Ile Lys Ile Trp Met Arg Tyr Ala Asp Glu Leu Phe

195 200 205

Pro Gly Asp Ser Thr Leu Leu Phe Lys Lys Leu Gln Glu Thr Tyr Ser

210 215 220

Asp Glu Ala Leu Ser Lys Ile Leu Ile Asn Gly Lys Thr Val Ala Ser

225 230 235 240

Thr Glu Lys Leu Ala Ser Asp Leu Gln Asn Gln Gln Leu Arg Tyr Trp

245 250 255

Leu Lys Asp Leu Val Pro Pro Glu Lys Ala Phe Gln Leu Leu Ser Leu

260 265 270

Asn Lys Gly Ala Asp Asp Val Phe Gly Ser Pro Gln Leu Arg Thr Trp

275 280 285

Ile Arg Tyr Asn Ala Ala Tyr Ala Lys Gln Asn Pro Tyr Ala His Lys

290 295 300

Ala Thr Leu Ile Asp Thr Leu Leu Glu Asn Phe Asp Thr Ala Ala Met

305 310 315 320

Val Lys Met Leu Lys Thr Arg Pro Asn Thr Ala Tyr Gly Lys His Leu

325 330 335

Ala Gly Gly Val Glu Arg Asp Leu Ile Lys Arg Trp Val Thr Asp Gly

340 345 350

Lys Pro Leu Lys Phe Val Val Glu Asn Leu Gly Ser Ser Ser Pro Ala

355 360 365

Lys Lys Glu Phe Val Thr Gly Leu Tyr Asn Lys Tyr Lys Ala Ala Ala

370 375 380

<210>8

<211>1155

<212>DNA

<213>Phytophthora capsici

<400>8

atgcgtcttc attatatcgt tgtgctcgcg gtcattgcct tcgccacgaa cgggaatgaa 60

gtctcagctg gcaagtcccg tgtcgccata actactactg atacaattga cacccctaca 120

gccagactct tgaggaacca gtacacggac gaagagaggg cgttcggcct caatcttctc 180

cctggaagca agaaaatctc aagtatcata acaaacaaga aactgtccaa gtatctcaag 240

agtaaccaag aattcgacga tgttttcatc aagctgaggc tcgacaaggc cggagacaag 300

ttgttcgaga acccgaaatt cctcgcttgg gctcaatacg tggacgattt caaccagaaa 360

caccagaccc agaactcgat gctccccacg cttgtgcgac agtttggagg cgatgatctg 420

tcgattatgc tggaaaaggc caagcaggcg gacaagacct acggcgtggc gttgagactt 480

cagggcgaac agatgaaact ctggagacgt gaaggtctca ctacggacat gctattcaaa 540

atctacaaat tagatgatgg ggctacgaat ctgctggaaa acccaggcat caaaatttgg 600

atgaggtacg cggatgaact tttccctgga gactccacgc ttctcttcaa gaagctgcaa 660

gagacgtatt cggacgaggc gttatccaaa atcttgatca acgggaaaac agtcgcgagt 720

acggagaagt tggcgtcgga cttgcagaac cagcaacttc gttattggtt gaaggatctt 780

gtacctccgg agaaggcctt ccagctgctg tcactcaaca agggggcgga cgatgtgttt 840

ggtagtcccc aactgcggac gtggattcgg tacaatgcag cttacgccaa gcagaatccg 900

tacgctcaca aggcgacgct gatcgataca ctcctggaga atttcgacac tgccgctatg 960

gtcaaaatgc tcaaaacgag gccgaataca gcttacggca agcatttggc tggtggggtg 1020

gaacgtgatc tcatcaaaag gtgggttaca gacggaaaac cgctcaaatt tgttgtcgag 1080

aacctggggt cgtcatcgcc tgccaagaag gagtttgtga cggggttata caataagtat 1140

aaggcggcgg cgtag 1155

<210>9

<211>394

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>9

Met Arg Leu His Tyr Ile Val Val Leu Ala Val Ile Ala Phe Ala Thr

1 5 10 15

Asn Gly Asn Glu Val Ser Ala Gly Lys Ser Arg Val Ala Ile Thr Thr

20 25 30

Thr Gly Ala Leu Asp Thr Pro Thr Thr Arg Leu Leu Arg Thr Gln Tyr

35 40 45

Thr Asp Glu Glu Arg Ala Phe Gly Leu Asn Leu Leu Pro Gly Ser Lys

50 55 60

Lys Ile Ser Ser Ile Ile Thr Asn Lys Lys Leu Ser Lys Tyr Leu Lys

65 70 75 80

Ser Asn Gln Glu Phe Asp Asp Val Phe Ile Lys Leu Lys Leu Asp Lys

85 90 95

Ala Gly Asp Lys Leu Phe Glu Asn Pro Lys Phe Leu Ala Trp Ala Gln

100 105 110

Tyr Val Asp Asp Phe Asn Gln Lys His Gln Thr Gln Asn Ser Met Leu

115 120 125

Pro Thr Leu Val Arg Gln Phe Gly Gly Asp Asp Leu Ser Ile Met Leu

130 135 140

Glu Lys Ala Lys Gln Ala Asp Lys Thr Tyr Gly Val Ala Leu Arg Leu

145 150 155 160

Gln Gly Glu Gln Met Lys Leu Trp Arg Arg Glu Gly Leu Thr Thr Asp

165 170 175

Met Leu Phe Lys Ile Tyr Lys Leu Asp Asp Gly Ala Thr Asn Leu Leu

180 185 190

Glu Asn Pro Gly Ile Lys Ile Trp Met Arg Tyr Ala Asp Glu Leu Phe

195 200 205

Pro Gly Asp Ser Thr Leu Leu Phe Lys Lys Leu Gln Lys Thr Tyr Ser

210 215 220

Asp Glu Ala Leu Ser Lys Ile Leu Ile Asn Gly Lys Thr Val Ala Ser

225 230 235 240

Thr Glu Lys Leu Ala Ser Asp Leu Gln Asn Gln Gln Leu Arg Tyr Trp

245 250 255

Leu Lys Asp Leu Val Pro Pro Glu Lys Ala Phe Gln Leu Leu Ser Leu

260 265 270

Asn Lys Gly Ala Asp Asp Val Phe Gly Ser Pro Gln Leu Gln Thr Trp

275 280 285

Ile Arg Tyr Asn Ala Ala Tyr Ala Lys Gln Asn Pro Tyr Ala His Lys

290 295 300

Ala Thr Leu Ile Asp Thr Leu Leu Glu Asn Phe Asp Thr Ala Ala Met

305 310 315 320

Val Lys Met Leu Lys Thr Arg Pro Asn Thr Ala Tyr Gly Lys His Leu

325 330 335

Ala Gly Gly Val Glu Arg Asp Leu Ile Lys Arg Trp Val Thr Asp Gly

340 345 350

Lys Pro Leu Lys Phe Val Val Glu Asn Leu Gly Ser Ser Ser Pro Ala

355 360 365

Lys Lys Glu Phe Val Thr Gly Leu Tyr Asn Lys Tyr Lys Ala Ala Ala

370 375 380

Gln Pro Lys Lys Lys Arg Lys Val Gly Gly

385 390

<210>11

<211>1185

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

atgcgtcttc attatatcgt tgtgctcgcggtcattgcct tcgccacgaa cgggaatgaa 60

gtctcagctg gcaagtcccg tgtcgccata actactactg gtgcacttga cacccccaca 120

accagactct tgaggaccca gtacacggac gaagagaggg cgttcggcct caatcttctc 180

cctggaagca agaaaatctc aagtatcata acaaacaaga aactgtccaa gtatctcaag 240

agcaaccaag aattcgacga cgtgttcatc aaactcaagc tcgacaaggc cggagacaag 300

ttgttcgaga acccgaaatt cctcgcttgg gctcaatacg tggacgattt caatcagaaa 360

caccagaccc agaactcgat gctccccacg cttgtgcgac agtttggagg cgatgatctg 420

tcgattatgt tggaaaaggc caagcaggca gacaaaacct acggggtggc gttgagactt 480

cagggcgaac agatgaaact ctggagacgt gaaggtctca ctactgacat gctcttcaaa 540

atctacaaat tagatgatgg ggctacgaat ctgctggaaa acccaggcat caaaatttgg 600

atgaggtacg cagacgaact tttccctgga gactccacac ttctcttcaa gaagctgcaa 660

aagacgtatt cggacgaggc gttatccaaa atcttgatca acgggaaaac agtcgcaagt 720

acggagaagt tggcgtcgga cttgcagaac cagcaacttc gttattggtt gaaggatctt 780

gtgcctccag agaaggcctt ccagctgctg tcactcaaca agggggcgga cgatgtgttt 840

ggtagtcccc aactgcagac gtggattcgg tacaatgcag cttacgccaa gcagaatccg 900

tacgctcaca aggcgacgct gatcgatacg ctcctggaga atttcgacac tgccgctatg 960

gtcaaaatgc tcaaaacgag gccgaataca gcctacggca agcatttggc tggtggggtg 1020

gaacgtgatc tcatcaaaag gtgggttacg gacggaaaac cgctcaaatt tgttgtcgag 1080

aacctggggt cgtcatcgcc tgccaagaag gagtttgtga cggggttata caataagtat 1140

aaggcggcgg cgcagcctaa gaagaagaga aaggttggag gatag 1185

<210>11

<211>398

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>11

Met Arg Leu His Tyr Ile Val Val Leu Ala Val Ile Ala Phe Ala Thr

1 5 10 15

Asn Gly Asn Glu Val Ser Ala Gly Lys Ser Arg Val Ala Ile Thr Thr

20 25 30

Thr Gly Ala Leu Asp Thr Pro Thr Thr Arg Leu Leu Arg Thr Gln Tyr

35 40 45

Thr Asp Glu Glu Arg Ala Phe Gly Leu Asn Leu Leu Pro Gly Ser Lys

50 55 60

Lys Ile Ser Ser Ile Ile Thr Asn Lys Lys Leu Ser Lys Tyr Leu Lys

65 70 75 80

Ser Asn Gln Glu Phe Asp Asp Val Phe Ile Lys Leu Lys Leu Asp Lys

85 90 95

Ala Gly Asp Lys Leu Phe Glu Asn Pro Lys Phe Leu Ala Trp Ala Gln

100 105 110

Tyr Val Asp Asp Phe Asn Gln Lys His Gln Thr Gln Asn Ser Met Leu

115 120 125

Pro Thr Leu Val Arg Gln Phe Gly Gly Asp Asp Leu Ser Ile Met Leu

130 135 140

Glu Lys Ala Lys Gln Ala Asp Lys Thr Tyr Gly Val Ala Leu Arg Leu

145 150 155 160

Gln Gly Glu Gln Met Lys Leu Trp Arg Arg Glu Gly Leu Thr Thr Asp

165 170 175

Met Leu Phe Lys Ile Tyr Lys Leu Asp Asp Gly Ala Thr Asn Leu Leu

180 185 190

Glu Asn Pro Gly Ile Lys Ile Trp Met Arg Tyr Ala Asp Glu Leu Phe

195 200 205

Pro Gly Asp Ser Thr Leu Leu Phe Lys Lys Leu Gln Lys Thr Tyr Ser

210 215 220

Asp Glu Ala Leu Ser Lys Ile Leu Ile Asn Gly Lys Thr Val Ala Ser

225 230 235 240

Thr Glu Lys Leu Ala Ser Asp Leu Gln Asn Gln Gln Leu Arg Tyr Trp

245 250 255

Leu Lys Asp Leu Val Pro Pro Glu Lys Ala Phe Gln Leu Leu Ser Leu

260 265 270

Asn Lys Gly Ala Asp Asp Val Phe Gly Ser Pro Gln Leu Gln Thr Trp

275 280 285

Ile Arg Tyr Asn Ala Ala Tyr Ala Lys Gln Asn Pro Tyr Ala His Lys

290 295 300

Ala Thr Leu Ile Asp Thr Leu Leu Glu Asn Phe Asp Thr Ala Ala Met

305 310 315 320

Val Lys Met Leu Lys Thr Arg Pro Asn Thr Ala Tyr Gly Lys His Leu

325 330 335

Ala Gly Gly Val Glu Arg Asp Leu Ile Lys Arg Trp Val Thr Asp Gly

340 345 350

Lys Pro Leu Lys Phe Val Val Glu Asn Leu Gly Ser Ser Ser Pro Ala

355 360 365

Lys Lys Glu Phe Val Thr Gly Leu Tyr Asn Lys Tyr Lys Ala Ala Ala

370 375 380

Asn Glu Leu Ala Leu Lys Leu Ala Gly Leu Asp Ile Asn Lys

385 390 395

<210>12

<211>1197

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

atgcgtcttc attatatcgt tgtgctcgcg gtcattgcct tcgccacgaa cgggaatgaa 60

gtctcagctg gcaagtcccg tgtcgccata actactactg gtgcacttga cacccccaca 120

accagactct tgaggaccca gtacacggac gaagagaggg cgttcggcct caatcttctc 180

cctggaagca agaaaatctc aagtatcata acaaacaaga aactgtccaa gtatctcaag 240

agcaaccaag aattcgacga cgtgttcatc aaactcaagc tcgacaaggc cggagacaag 300

ttgttcgaga acccgaaatt cctcgcttgg gctcaatacg tggacgattt caatcagaaa 360

caccagaccc agaactcgat gctccccacg cttgtgcgac agtttggagg cgatgatctg 420

tcgattatgt tggaaaaggc caagcaggca gacaaaacct acggggtggc gttgagactt 480

cagggcgaac agatgaaact ctggagacgt gaaggtctca ctactgacat gctcttcaaa 540

atctacaaat tagatgatgg ggctacgaat ctgctggaaa acccaggcat caaaatttgg 600

atgaggtacg cagacgaact tttccctgga gactccacac ttctcttcaa gaagctgcaa 660

aagacgtatt cggacgaggc gttatccaaa atcttgatca acgggaaaac agtcgcaagt 720

acggagaagt tggcgtcgga cttgcagaac cagcaacttc gttattggtt gaaggatctt 780

gtgcctccag agaaggcctt ccagctgctg tcactcaaca agggggcgga cgatgtgttt 840

ggtagtcccc aactgcagac gtggattcgg tacaatgcag cttacgccaa gcagaatccg 900

tacgctcaca aggcgacgct gatcgatacg ctcctggaga atttcgacac tgccgctatg 960

gtcaaaatgc tcaaaacgag gccgaataca gcctacggca agcatttggc tggtggggtg 1020

gaacgtgatc tcatcaaaag gtgggttacg gacggaaaac cgctcaaatt tgttgtcgag 1080

aacctggggt cgtcatcgcc tgccaagaag gagtttgtga cggggttata caataagtat 1140

aaggcggcgg cgaacgagct tgctcttaag ttggctggac ttgatattaa caagtag 1197

Claims

1. The protein is the following protein A1), A2) or A3):

A1) the protein of which the amino acid sequence is the sequence 1 in the sequence table or the protein of which the amino acid sequence is the 19 th to 384 th sites in the sequence table 1;

2. The protein of claim 1, wherein a2 is a21, a22, a23, a24, a25, or a26 wherein:

a21, protein with amino acid sequence shown as sequence 3;

a23, protein with amino acid sequence shown as sequence 3;

a25, protein with amino acid sequence shown as sequence 3;

3. The protein of claim 1, wherein the fusion protein in A3 is A31, A32, A33 or A34, wherein:

a31, protein with amino acid sequence shown as sequence 9;

a33, protein with amino acid sequence shown as sequence 11;

4. The biomaterial related to the protein of any one of claims 1 to 3, which is any one of the following B1) to B9):

B1) a nucleic acid molecule encoding the protein of any one of claims 1-3;

B2) an expression cassette comprising the nucleic acid molecule of B1);

5. The related biological material according to claim 4, wherein: B1) the nucleic acid molecule has the following nucleotides of B101, B102, B103, B104, B105, B106, B107, B108, B109, B110, B111 and B112:

b101, cDNA molecules or DNA molecules of a sequence 2 in a sequence table;

b103, cDNA molecules or DNA molecules of a sequence 4 in a sequence table;

b105, cDNA molecules or DNA molecules of a sequence 6 in a sequence table;

b107, cDNA molecules or DNA molecules of a sequence 8 in a sequence table;

b109, cDNA molecules or DNA molecules of a sequence 10 in a sequence table;

b111, cDNA molecules or DNA molecules of a sequence 12 in a sequence table;

6. Use of any one of the following P1-P9 of the protein of any one of claims 1-3, or the biomaterial of claim 4 or 5:

use of P1, a protein according to any one of claims 1 to 3, or a biomaterial according to claim 4 or 5 for modulating leaf cell necrosis in a plant;

use of P2, a protein according to any one of claims 1 to 3, or a biomaterial according to claim 4 or 5 in the manufacture of a product for reducing necrosis of plant leaves;

use of P3, a protein according to any one of claims 1 to 3, or a biomaterial according to claim 4 or 5 for the cultivation of a plant for the reduction of leaf necrosis in a plant;

use of P4, a protein according to any one of claims 1 to 3, or a biomaterial according to claim 4 or 5 for the manufacture of a product for reducing leaf necrosis in a plant;

use of P5, a protein according to any one of claims 1 to 3, or a biomaterial according to claim 4 or 5 for modulating phytophthora capsici infestation in plants;

use of P6, a protein according to any one of claims 1 to 3, or a biomaterial according to claim 4 or 5 in the manufacture of a product for increasing the resistance of a plant to phytophthora capsici infestation;

use of P7, a protein according to any one of claims 1 to 3, or a biomaterial according to claim 4 or 5 for growing plants resistant to phytophthora capsici infestation;

use of P8, a protein according to any one of claims 1 to 3, or a biomaterial according to claim 4 or 5 for the preparation of a product for combating phytophthora capsici infestation in plants;

use of P9, a protein according to any one of claims 1 to 3, or a biological material according to claim 4 or 5 in plant breeding.

7. Use according to claim 6, characterized in that: the plant of claim 6, which is a monocotyledonous plant or a dicotyledonous plant.

8. Use according to claim 6, characterized in that: the plant of claim 6, which is Nicotiana benthamiana or Capsicum annuum.