CN109929944B - DNA strip for identifying kiwi fruit variety and rapid identification method based on DNA strip - Google Patents

Abstract

The invention discloses a DNA strip for identifying kiwi fruit varieties and a rapid identification method based on the DNA strip, which can adopt a molecular identification method or an identification method combining morphology and molecular identification. The shape identification is carried out by identifying the size, head and tail shape, epidermal hair and cross and longitudinal section shape of the kiwi fruit to be detected; the molecular identification is to take kiwi fruit DNA to be detected as a template, perform polymerase chain reaction amplification on the kiwi fruit DNA bar code, perform electrophoresis detection on a product obtained by amplification, wherein a DNA strip corresponding to the DNA bar code exists in an electrophoresis result, further sequence the amplification product, perform comparison analysis on the amplification product sequence, and identify through the base sequence difference of the DNA bar code. The method can quickly and accurately distinguish twelve kinds of kiwi fruits sold in the market, and solves the identification requirements of inferior food quality and safety in the existing kiwi fruit market.

Description

DNA strip for identifying kiwi fruit variety and rapid identification method based on DNA strip

Technical Field

The invention belongs to the technical field of molecular identification, and relates to a DNA strip for identifying kiwi fruit varieties and a rapid identification method based on the DNA strip.

Background

The kiwi fruit is called the king of fruit and the crown of vitamin C, has higher economic benefit, and the main planting areas in China are Sichuan, Shaanxi, Guizhou and the like. The method is a necessary means for improving the economic value of the kiwi fruit variety and promoting the economic development of the kiwi fruit industry in regions for detection, prevention and control of the kiwi fruit variety. The price of the kiwi fruit on the market at present is directly related to the quality and the taste of the variety. Because the classification of the kiwifruits by common consumers is rarely known, the phenomenon that illegal vendors' take the best place to cheat consumers often appears in the market, the food quality safety of the kiwifruits and the rights of consumers are damaged, and relevant civil disputes appear. Therefore, a method capable of rapidly and accurately identifying the variety of the kiwi fruit is urgently needed, and effective evidence is provided for scientifically solving the judicial disputes and legal judgment.

DNA barcodes are a new technology for molecular identification that enables species identification using standard, sufficiently variable, easily amplified and relatively short DNA fragments. The technology can be used for discovering new species and protecting biodiversity, can effectively monitor the business of the rare or endangered species, can realize the quick inspection of harmful organisms and invasive species, and has great significance for the biological resource protection of China. The concept of DNA barcodes was first introduced by the canadian taxonomist Pa μ L Hebert and received widespread worldwide in 2003. Around 2005, DNA barcodes were introduced into plant studies. In 2009, the international life barcode alliance Plant Working Group (CBOL Plant Working Group) initially recommended the use of the chloroplast genes rbcL and the matK fragment. Chinese scholars such as old vaseline discuss the research of DNA barcodes in medicinal plants in detail, and propose to establish a DNA barcode identification system of plant medicines with ITS2 as a core and trnH-psbA as an auxiliary. Laura Jaakola and the like successfully identify the North country and the North blue of blueberry varieties by using a DNA bar code technology and combining a high-resolution dissolution curve, and provide reference for the feasibility of identifying different resources of kiwi varieties by using DNA bar codes. The sequence of the mitochondrial COI gene is very effective as a DNA barcode in most animals. In the plant taxonomy study, the progress of the DNA barcode is relatively slow, and the validity of the proposed chloroplast DNA fragments rpoB, rpoC1, matK, rbcL and the like is still in the stage of comparison and evaluation. DNA barcodes are complementary to traditional species identification.

Chinese patent CN107326081A discloses a method for identifying actinidia arguta, actinidia kolomikta and actinidia polygama in northeast. However, no rapid and accurate molecular identification means has been found for the identification of other varieties.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide a DNA strip for identifying a kiwi variety and a rapid identification method based on the DNA strip.

In order to achieve the purpose, the invention adopts the following technical scheme to realize the purpose:

the invention discloses a DNA strip for identifying a kiwi fruit variety, wherein the nucleotide sequence of the DNA strip is shown as SEQ.ID.NO.1 or SEQ.ID.NO. 2.

Preferably, the DNA band with the nucleotide sequence shown in SEQ.ID.NO.1 can distinguish three varieties of Hongyang, Huangjinguo and Chuanjin from other nine varieties of Haiword, Xuxiang, Jinyan, Huayou, Qimei, emerald, Cuiyang, Yate and impatiens balsamina.

Further preferably, if the amplification product is 115bp,132bp and 310bp are C and 206bp and 215bp are G, the amplification product is one of the golden fruit, Sichuan golden fruit and red sun; if 115bp,132bp and 310bp are T and 206bp and 215bp are A, the other nine varieties are sold in the market.

Preferably, the DNA band with nucleotide sequence shown in SEQ.ID.NO.2 can distinguish Jinyan from Hongyang, Huangjinguo, Chuanhuangjin, Haiword, Xuxiang, Huayou, Qimei, Cuiyu, Yate and impatiens balsamina;

or, can distinguish jade from red yang, gold fruit, Sichuan gold, Haiword, Xuxiang, Huayou, Qimei, Jinyan, Cuixiang, Yate and impatiens balsamina.

More preferably, the amplification product 534bp is golden bright if it is G, and the amplification product 534bp is A, and is eleven other commercially available varieties; if 777bp of the amplified product is C, it is jade, and if 777bp is A, it is eleven other commercial varieties.

The invention also discloses a primer pair based on the DNA band for identifying the kiwi fruit variety, wherein the DNA band with the nucleotide sequence shown in SEQ.ID.NO.1 takes Seq01 and Seq02 as the primer pair during amplification, Seq01 has the nucleotide sequence shown in SEQ.ID.NO.3, and Seq02 has the nucleotide sequence shown in SEQ.ID.NO. 4;

the DNA band with the nucleotide sequence shown in SEQ.ID.NO.2 takes Seq03 and Seq04 as a primer pair during amplification, Seq03 has the nucleotide sequence shown in SEQ.ID.NO.5, and Seq04 has the nucleotide sequence shown in SEQ.ID.NO. 6.

The invention discloses a method for rapidly identifying a commercially available kiwi fruit variety, which comprises the following steps:

1) taking the DNA of the kiwi fruit to be detected as a template, carrying out polymerase chain reaction amplification on different DNA molecular markers of the kiwi fruit to be detected, and carrying out electrophoresis detection on an amplification product;

here, the DNA molecular markers refer to DNA barcode ITS2 and DNA barcode matK;

2) and if the electrophoresis result has a DNA band corresponding to the DNA molecular marker, sequencing the amplified product, and identifying through the difference of the base sequences after comparing and analyzing the sequencing result.

Preferably, if the sequencing result is 115bp,132bp and 310bp are C and 206bp and 215bp are G in the DNA base sequence shown in SEQ.ID.NO.1, the DNA base sequence is one of gold fruit, Sichuan gold and red yang; if 115bp,132bp and 310bp are T and 206bp and 215bp are A, the product is Haiword, xuxiang, Jinyan, Huayou, Qinmei, emerald, Cuiyang, Yate or impatiens balsamina.

The DNA sequence shown in SEQ.ID.NO.2 shows that 534bp is G, the DNA sequence shows golden bright, and 534bp is A, the DNA sequence shows red yang, gold fruit, Sichuan gold, Haiword, Xuxiang, Huayou, Qimei, emerald, Cuixiang, Yate or impatiens balsamina; if 777bp of the amplification product is C, it is jade, and if 777bp is A, it is other materials selected from HONGYANG, HUAJINGUO, CHUANHUAJIN, HAIWUDE, XUXIANG, HUAYOU, QINMEI, JINYAN, CUIXIANG, YATE or JIXIANLIAN.

The invention discloses another method for rapidly identifying a commercially available kiwi fruit variety, which comprises the following steps:

1) identifying the size, head and tail shape, epidermal hair and cross and longitudinal section shape of the kiwi fruit to be detected; if the varieties can be distinguished according to the forms, directly obtaining the identification result; if the shape can not be judged, performing the step 2);

2) taking the DNA of the kiwi fruit to be detected as a template, carrying out polymerase chain reaction amplification on different DNA molecular markers of the kiwi fruit to be detected, and carrying out electrophoresis detection on an amplification product;

3) if a DNA band corresponding to the DNA molecular marker exists in the electrophoresis result, sequencing the amplified product, and identifying through the difference of the base sequences after comparing and analyzing the sequencing result;

if the sequencing result is 115bp,132bp and 310bp are C and 206bp and 215bp are G in the DNA base sequence shown in SEQ.ID.NO.1, the DNA base sequence is one of the gold fruit, the Sichuan gold and the red sun; if 115bp,132bp and 310bp are T and 206bp and 215bp are A, the product is Haiword, xuxiang, Jinyan, Huayou, Qinmei, emerald, Cuiyang, Yate or impatiens balsamina.

The DNA sequence shown in SEQ.ID.NO.2 shows that 534bp is G, the DNA sequence shows golden bright, and 534bp is A, the DNA sequence shows red yang, gold fruit, Sichuan gold, Haiword, Xuxiang, Huayou, Qimei, emerald, Cuixiang, Yate or impatiens balsamina; if 777bp of the amplification product is C, it is jade, and if 777bp is A, it is other materials selected from HONGYANG, HUAJINGUO, CHUANHUAJIN, HAIWUDE, XUXIANG, HUAYOU, QINMEI, JINYAN, CUIXIANG, YATE or JIXIANLIAN.

Preferably, in step 1), the forms of the red-yang, the gold fruits, the golden cypress, the haworthia, the xuxiang, the jinyan, the huayou, the qimei, the emerald, the cuixiang, the yate and the impatiens balsamina are distinguished as follows:

compared with the prior art, the invention has the following beneficial effects:

the method for identifying the variety of the kiwi fruit can adopt a molecular identification method or an identification method combining morphology and molecular identification. The shape identification is carried out by identifying the size, head and tail shape, epidermal hair and cross and longitudinal section shape of the kiwi fruit to be detected; the molecular identification is to take kiwi fruit DNA to be detected as a template, perform polymerase chain reaction amplification on the kiwi fruit DNA bar code, perform electrophoresis detection on a product obtained by amplification, wherein a DNA strip corresponding to the DNA bar code exists in an electrophoresis result, further sequence the amplification product, compare and analyze the sequence of the amplification product, and identify through the base sequence difference of the DNA bar code. The invention adopts the polymerase chain reaction amplification of DNA, the length of the base sequence of the DNA bar code is short, the amplification strip can be obtained only in 1 to 2 hours, and the sequencing process of the amplification strip only needs about 1 hour, so the method can be used for quickly identifying the kiwifruit variety sold in the market; and because the detection result at the DNA level is unique and invariant for the species, accurate identification can be achieved. Thereby providing experiment and law basis for food quality safety supervision of the kiwi fruits and scientific judgment of such judicial cases.

Drawings

FIG. 1A shows the detected sequence alignment of the ITS2 sequences of twelve commercially available kiwi DNA barcodes;

FIG. 1B shows the results of the alignment of DNA barcode matK sequences of twelve commercially available kiwifruits to be tested;

FIG. 2 shows the phylogenetic analysis results of twelve tested commercially available kiwifruits; wherein A is a matK sequence fragment; b is ITS2 sequence fragment;

fig. 3 is photographs of the external and internal morphology of twelve commercially available tested kiwi fruit samples, scale bar: 6 mm.

Detailed Description

In order to make the technical solutions of the present invention better understood, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It should be noted that, in addition, the terms "comprises" and "comprising," and any variations thereof, are intended to cover non-exclusive inclusions, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed, but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.

The invention is described in further detail below with reference to the accompanying drawings:

firstly, identifying the size, head and tail shape, epidermal hair and cross and longitudinal section shape of the kiwi fruit to be detected; then, the molecular identification is based on a DNA barcode technology, the oligodeoxynucleotide sequences Seq01, Seq02, Seq03 and Seq04 provided by the invention are used as two DNA barcode primer pairs, the DNA of the kiwi fruit to be detected is used as a template, the Polymerase Chain Reaction (PCR) amplification is carried out on a specific DNA barcode fragment in the kiwi fruit, the product obtained by the amplification is subjected to electrophoresis detection, and specific DNA bands (with no difference in length among varieties) with the sizes of about bp (SEQ. ID. NO.1) and 889bp (SEQ. ID. NO.2) are screened out.

And further carrying out DNA sequence sequencing on the amplified products, and analyzing whether the base sequences of the DNA barcodes are different or not by comparing the sequences of the amplified products so as to identify.

The invention provides a method for rapidly identifying commercial kiwi fruits, which comprises the following specific steps:

(1) firstly, checking the external form of a kiwi fruit sample to be detected, and preliminarily judging possible varieties, specifically judging according to the external and internal shapes, the color, the epidermal hair and the head-tail shapes shown in the figure 3; taking twelve common commercial kiwifruits as an example, the external morphology results are shown in table 1:

TABLE 1 morphological description of twelve commercial kiwifruits

(2) Extracting genome DNA (namely sample DNA) of a pulp part of kiwi fruit to be detected by adopting a conventional CTAB method, wherein the extraction steps are as follows:

firstly, quickly freezing about 0.5g of pulp tissues by liquid nitrogen, quickly grinding the pulp tissues into powder, and transferring the powder into a 2mL centrifuge tube;

secondly, 700 mu L of CTAB extraction buffer solution preheated at 65 ℃ and 20 mu L of beta-mercaptoethanol are immediately added, the mixture is violently shaken to be fully mixed, the mixture is placed in a water bath at 65 ℃ for heat preservation for 20min, the mixture is continuously taken out and is inverted up and down and mixed, and then the mixture is cooled to the room temperature;

③ adding chloroform/isoamylol with the same volume as 24:1, slightly inverting and mixing evenly, centrifuging at 12000rpm for 10min at room temperature, and transferring the supernatant into a new 1.5mL centrifuge tube;

adding equal volume of isopropanol precooled at minus 20 ℃ into the supernatant, slightly inverting and mixing evenly until white flocculent precipitate appears, standing at minus 20 ℃ for 15min to generate precipitate, centrifuging at 4 ℃ and 12000rpm for 10min, pouring out the supernatant, and reserving the precipitate (DNA);

fifthly, adding 700 mu L of precooled 70% ethanol to wash the precipitate, after the precipitate is inverted up and down and mixed evenly (centrifugal for 1min at 13000 rpm), pouring out the supernatant, keeping the precipitate, and repeating the steps once;

sixthly, adding 500 mu L of precooled absolute ethyl alcohol to wash the sediment (centrifugal for 1min at 13000 rpm), pouring out the supernatant, standing the sediment, air-drying the sediment, and dissolving the sediment in 50 mu L ddH₂O at 4 ℃ overnight;

seventhly, taking 1 mu L of dissolved sample DNA, and measuring the concentration and purity of the DNA by using a nucleic acid concentration measuring instrument. The OD260/280 of the detected sample DNA is between 1.8 and 2.0, and under the condition that the DNA sample is detected to have no impurities and no obvious degradation by 0.8 percent agarose nucleic acid electrophoresis, the kiwi fruit DNA to be detected is diluted by adding water to the final concentration of 100 ng/microliter for standby;

(3) single-stranded oligomeric DNA synthesized according to the oligodeoxynucleotide sequences seq01, seq02, seq03 and seq04 provided by the invention is respectively diluted into 10 mu mol/L aqueous solution by adding water, and the sequences are respectively as follows:

Seq01:5’-ATGCGATACTTGGTGTG-3’

Seq02:5’-GACGCTTCTCCAGACTA-3’

Seq03:5’-CGTACAGTACTTTTGTGTTTAC-3’

Seq04:5’-ACCCAGTCCATCTGGAAATC-3’

(4) to a 0.2ml PCR tube were added: 4 μ L of 2.5mmol/L dNTP,1.5 μ L of 25mmol/L MgCl₂5 mu L of 10 × rTaq buffer solution, 1.0 mu L of each of seq01 primer solution and seq02 primer solution prepared in the step (3), 1.5 mu L of DNA solution of the sample to be detected prepared in the step (2), 1 unit of Taq polymerase is added, water is added to the total volume of 50 mu L, the mixture is slightly shaken and evenly mixed, and the mixture is instantaneously centrifuged; the above procedure was repeated, adding to a 0.2mL PCR tube: 4 μ L of 2.5mmol/L dNTP,1.5 μ L of 25mmol/L MgCl₂5 mu L of 10 star rTaq buffer solution, and the step (3) is carried out1.0 mu L of each prepared seq03 primer solution and seq04 primer solution, 1.5 mu L of the DNA solution of the sample to be detected prepared in the step (1), 1 unit of Taq polymerase is added, water is added to the total volume of 50 mu L, the mixture is slightly shaken and evenly mixed, and the mixture is instantaneously centrifuged;

(5) the PCR tube was placed on a PCR machine, and the following procedures were performed, respectively:

①94℃5min；[94℃30S,55℃30S,72℃35S]*35cycles；72℃10min；4℃10min；

②94℃5min；[94℃30S,56℃30S,72℃46S]*35cycles；72℃10min；4℃10min；

(6) carrying out 1.5% agarose gel electrophoresis on 6 mu L of products in the PCR tube, and checking DNA bands generated in the PCR reaction of different samples to be detected;

(7) and (3) delivering the residual product in the PCR tube to Huada gene for sequence determination, and checking the base sequences of the DNA barcodes of different samples to be detected.

Specifically, 12 kinds of common commercially available kiwi fruits (including golden fruit, emerald green, Qimei, xu-Xiang, Huayou, impatiens balsamina, Yate, Hawode, emerald jade, Chuan gold, Hongyang and Jinyan) in Shaan and Sichuan are selected for experiments, and at least 6-8 independent samples are repeated for each 2 kinds of kiwi fruits, and the materials are collected in the local kiwi fruit market. Specific experimental materials are shown in table 2:

TABLE 2 Experimental materials numbers and names

And performing sequence comparison analysis and system evolution analysis on the sequencing result to obtain the species information of the sample to be detected. Can be determined according to the sequencing result.

1. The DNA bands are 491bp in total length, as shown in the sequence alignment chart in FIG. 1A:

1)ITS2-F ATGCGATACTTGGTGTG

2)ITS2-R GACGCTTCTCCAGACTA

there are 5 differences:

115bp of three varieties of the golden fruit, the Sichuan golden fruit and the red yang, and 3 positions of 132bp and 310bp are C and other varieties are T; the 206bp and the 2bp of the three varieties of the golden fruit, the Sichuan golden fruit and the red yang are G, and the other varieties are A.

2. The DNA bands were each 889bp in total length, as shown in the alignment chart in FIG. 1B:

1)matK-F CGTACAGTACTTTTGTGTTTAC

2)matK-R ACCCAGTCCATCTGGAAATC

there are 2 differences:

g is 534bp of Jinyan and A is the other species; 777bp in emerald is C and the other species is A.

At the same time, phylogenetic analysis of the two DNA barcode sequencing results of the twelve commercially available kiwifruits tested also demonstrated the above results. Specifically, the phylogenetic tree is constructed by the following steps:

1. changing the format of the amplified sequencing result corresponding to the DNA barcode into a fasta format, and placing the format in a txt file;

2. clicking Align in MEGA5.0 software, and carrying out sequence comparison according to default options;

3. storing the aligned sequence files, wherein the aligned sequence files are stored in a meg format;

4. clicking Phytogeny to construct an evolutionary tree, and constructing the evolutionary tree by a Neighbor-Joining method, wherein the evolutionary tree is repeated 1000 times by using a bootstrap method, and the obtained system evolution analysis result is shown in FIG. 2, wherein A is an ITS2 sequence fragment; b is a matK sequence segment; as can be seen from fig. 2, the result of the evolutionary tree obtained through the systematic analysis is consistent with the result of the technical scheme of the present invention, and the identification result is consistent, further illustrating the accuracy and reliability of the present invention.

The kiwi fruit is adopted to extract DNA for detection in any season, the sampling position does not influence the consistency of the detection result, and the sampling position and the sampling time do not influence the detection result. The method can be used for quickly and accurately identifying the commercial kiwi fruit variety, thereby providing an experiment and law basis for food quality safety supervision of kiwi fruits and scientific judgment of such judicial cases.

The above-mentioned contents are only for illustrating the technical idea of the present invention, and the protection scope of the present invention is not limited thereby, and any modification made on the basis of the technical idea of the present invention falls within the protection scope of the claims of the present invention.

Sequence listing

<120> DNA strip for identifying kiwi variety and rapid identification method based on DNA strip

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 491

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgcgatact tggtgtgaat tgcagaatcc cgtgaaccat cgagtttttg aacgcaagtt 60

gcgcctgaag ccattaggcc gagggcacgt ctgcctgggc gtcacgcatt gtgtcgccca 120

cccaactcaa gccttaccaa ggattgggtg tgggtgggcg gatattggcc ccccgtgcac 180

attagtgaac ggtcggccta aaaatgaagt ccttggcaat ggacgtcaca acaagtggtg 240

gttgacaaac cgttgcgtcc tgttgtgctt gcccccattg ctaatggttt acttttgacc 300

ctaatgtgcc gttatcacgg cttcgatcgc gaccccaggt caggcgggat tacccgctga 360

gtttaagcat atcaataagc ggaggaaaag aaacttacaa ggattccctt agtaacggcg 420

agcgaaccgg gaatagccca gcttgaaaat cgggcgatct cgttgtccga attgtagtct 480

ggagaagcgt c 491

<210> 2

<211> 889

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgtacagtac ttttgtgttt acgagccaaa gttctagcac aagaaagtcg aagtatatac 60

tttattcgat acaaactcgt tttttttaag gatccgctat gataatgaga aagatttcta 120

tatatacgcc cgaatcggtc aataatatca gaatcggata aatcggccca gactggctta 180

ctaacgggat gtcctaagac gttacaaaat ttcgctttat acaaggatcc aatcagagga 240

ataattggaa ctatggtatc aaacttctta atagcatttc ctattagaaa tgaattttct 300

agcatttgac tccgtaccat tgaagggttt aatcgcacac ttgaaagata gcccagaaag 360

tcgagagagt gattagataa ttggtttatc tgaatccttc ctggttgaca ccacatgtaa 420

aaataacatt gccagaaatt gacaagataa tatttccatt tattcattaa aagagacgtc 480

ccttttgaag ccaaaattga atttccttga tacctaacat aatgcatgaa aggatccttg 540

aacaaccata aaatgtcctg aaaatcctta gtaaaaactt ttacaaaatg ttcgattttt 600

ccatagaaat agattcgttc aagaaaggtt ccagaagata ttgatcgtaa atgagaagat 660

tggttgcgga gaaaaacgaa gatagattcg gattcacata catgaaaatt atataggaac 720

aagaaaaatc tttgatttct ttttgaaaaa gaaaaactag atttctttgg agtaatacga 780

gtattccaat tacgatactc gtgaagaaaa aatcgtaata aatgcaaaga agaagcatct 840

tttacccaat agcgaagagt ttgaaccaag atttccagat ggactgggt 889

<210> 3

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgcgatact tggtgtg 17

<210> 4

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gacgcttctc cagacta 17

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgtacagtac ttttgtgttt ac 22

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acccagtcca tctggaaatc 20

Claims (3)

1. A method for rapidly identifying a commercially available kiwi fruit variety is characterized by comprising the following steps:

1) taking the DNA of the kiwi fruit to be detected as a template, carrying out polymerase chain reaction amplification on different DNA molecular markers of the kiwi fruit to be detected, and carrying out electrophoresis detection on an amplification product;

2) if a DNA band corresponding to the DNA molecular marker exists in the electrophoresis result, sequencing the amplified product, and identifying through the difference of the base sequences after comparing and analyzing the sequencing result;

if the sequencing result is 115bp,132bp and 310bp are C and 206bp and 215bp are G in the DNA base sequence shown in SEQ.ID.NO.1, the DNA base sequence is one of the gold fruit, the Sichuan gold and the red sun; if 115bp,132bp and 310bp are T and 206bp and 215bp are A, the product is Haiword, xuxiang, Jinyan, Huayou, Qinmei, emerald jade, Cuiyang, Yate or impatiens balsamina;

the DNA sequence shown in SEQ.ID.NO.2 shows that 534bp is G, the DNA sequence shows golden bright, and 534bp is A, the DNA sequence shows red yang, gold fruit, Sichuan gold, Haiword, Xuxiang, Huayou, Qimei, emerald, Cuixiang, Yate or impatiens balsamina; if 777bp of the amplification product is C, it is jade, and if 777bp is A, it is other materials selected from HONGYANG, HUAJINGUO, CHUANHUAJIN, HAIWUDE, XIANGXIANG, HUAYOU, QINMEI, JINYAN, CUIXIANG, YATE or JIXIANLIAN;

wherein, the DNA band with the nucleotide sequence shown in SEQ.ID.NO.1 takes Seq01 and Seq02 as a primer pair during amplification, Seq01 has the nucleotide sequence shown in SEQ.ID.NO.3, and Seq02 has the nucleotide sequence shown in SEQ.ID.NO. 4; the DNA band with the nucleotide sequence shown in SEQ.ID.NO.2 takes Seq03 and Seq04 as a primer pair during amplification, Seq03 has the nucleotide sequence shown in SEQ.ID.NO.5, and Seq04 has the nucleotide sequence shown in SEQ.ID.NO. 6.

2. A method for rapidly identifying a commercially available kiwi fruit variety is characterized by comprising the following steps:

1) identifying the size, head and tail shape, epidermal hair and cross and longitudinal section shape of the kiwi fruit to be detected;

2) taking the DNA of the kiwi fruit to be detected as a template, carrying out polymerase chain reaction amplification on different DNA molecular markers of the kiwi fruit to be detected, and carrying out electrophoresis detection on an amplification product;

3) if a DNA band corresponding to the DNA molecular marker exists in the electrophoresis result, sequencing the amplified product, and identifying through the difference of the base sequences after comparing and analyzing the sequencing result;

if the sequencing result is 115bp,132bp and 310bp are C and 206bp and 215bp are G in the DNA base sequence shown in SEQ.ID.NO.1, the DNA base sequence is one of the gold fruit, the Sichuan gold and the red sun; if 115bp,132bp and 310bp are T and 206bp and 215bp are A, the product is Haiword, xuxiang, Jinyan, Huayou, Qinmei, emerald jade, Cuiyang, Yate or impatiens balsamina;

the DNA sequence shown in SEQ.ID.NO.2 shows that 534bp is G, the DNA sequence shows golden bright, and 534bp is A, the DNA sequence shows red yang, gold fruit, Sichuan gold, Haiword, Xuxiang, Huayou, Qimei, emerald, Cuixiang, Yate or impatiens balsamina; if 777bp of the amplification product is C, it is jade, and if 777bp is A, it is other materials selected from HONGYANG, HUAJINGUO, CHUANHUAJIN, HAIWUDE, XIANGXIANG, HUAYOU, QINMEI, JINYAN, CUIXIANG, YATE or JIXIANLIAN;

wherein, the DNA band with the nucleotide sequence shown in SEQ.ID.NO.1 takes Seq01 and Seq02 as a primer pair during amplification, Seq01 has the nucleotide sequence shown in SEQ.ID.NO.3, and Seq02 has the nucleotide sequence shown in SEQ.ID.NO. 4; the DNA band with the nucleotide sequence shown in SEQ.ID.NO.2 takes Seq03 and Seq04 as a primer pair during amplification, Seq03 has the nucleotide sequence shown in SEQ.ID.NO.5, and Seq04 has the nucleotide sequence shown in SEQ.ID.NO. 6.

3. The method for rapidly identifying the varieties of commercially available kiwi fruits according to claim 2, wherein in the step 1), the forms of red yang, golden fruit, golden yellow, haworth, xuxiang, jinyan, huayou, qimei, emerald green, cuixiang, yate and impatiens are distinguished as follows:

Images