CN109929017A - Plant leaf width GAP-associated protein GAP KRDP1 and its encoding gene and application - Google Patents

Abstract

The invention discloses a kind of plant leaf width GAP-associated protein GAP KRDP1 and its encoding gene and applications.Protein provided by the invention is named as KRDP1 albumen, is protein shown in sequence 1 in sequence table.The nucleic acid molecules of encoded K RDP1 albumen also belong to protection scope of the present invention.A kind of method that the present invention also protects prepare transgenosis plant includes the following steps: to import the substance for inhibiting the nucleic acid molecules expression in recipient plant, obtains the genetically modified plants of width of blade reduction.The present invention is to study the biological function of corn related gene around corn yield and this important character of growth potential and ultimate aim.On the one hand it is remarkably improved the level of China's corn gene breeding, reduce the gap with international most advanced level, on the other hand brute force technique support is provided to ensure national food security, ecological safety and improving agricultural product international competitiveness, revolutionary variation will be brought to the development of China's Maize Industry.

Description

Plant leaf width GAP-associated protein GAP KRDP1 and its encoding gene and application

Technical field

The invention belongs to field of plant breeding, and in particular to a kind of plant leaf width GAP-associated protein GAP KRDP1 and its encoding gene And application.

Background technique

Corn is that grown worldwide is widest in area, the maximum cereal crops of yield, is occupied three generalized grains (corn, wheat, rice) First of.China is maize production and consumption big country, and sown area, total output, consumption figure are only second to the U.S., occupy the second in the world Position.In recent years, although China's corn growth momentum is good, a large amount of imports are still needed to, and import volume is quickly incremented by year by year.With work Industry, urbanization is fast-developing and living standards of the people are continuously improved, and China has entered corn consumption Fast growth phase.Never Seen to develop, corn will be China's demand growth it is most fast, also will be the maximum grain variety of yield potential.Maize production is done a good job of it, The key of grain sustainable and stable development is just caught.It taps the production potential, reduces production cost, keeps corn can substantially certainly It gives, is to ensure that a major issue of national food security.With national agricultural structure adjustment, the cultivated area of corn 2016 and The trend reduced year by year is presented within 2017, is main channel to ensure that the promotion of total output improves per unit area yield area, cultivates excellent product Kind, increasing planting density is main means, and density is excessively high often to be reduced with field light transmission, gas permeability, the effect being not achieved, The appropriate width of blade that reduces is to solve corn field permeability, increase planting density to improve the important means of yield.

According to the successful experience for developing maize production with western developed countries such as the U.S., with the swift and violent hair of biotechnology Exhibition, transgenic technology, which has become, cultivates most real, the most potential approach of superior corn new varieties.The experience of history and reality is equal It was demonstrated that China's corn per unit area yield is solved the problems, such as, only based on China oneself.Therefore, ideotype, resistance to dense planting are screened Shape transgenic corns new material outstanding, formulates excellent objective trait transgenic breeding new germ plasm, will cultivate high yield for China Solid foundation is established in the cultivation of new varieties.

Developed country, the especially U.S. cultivate, promote transgenic corns it was verified that being cultivated using transgenic technology New varieties are to significantly improve or improve the effective way of the characters such as corn Resistant, degeneration-resistant and quality.The prosperities such as US and European Country cultivates pest-resistant a batch, antiweed, disease-resistant, salt tolerant, drought-enduring, male sterility, high-quality etc. using transgenic technology and turns Gene corn new germ plasm or new varieties.

The big core technology of the three of plant transgene primary study is that functional gene is cloned and verifying, scale target gene turn Change, bio-safety evaluation.Currently, efficiently, safe plants transgenic technology achieve important breakthrough, technical system Xiang Dangcheng Ripe, selectable marker gene knocks out the plants such as technology and target gene product timing degradation technique, non selecting sign transgene technology Important breakthrough has been obtained in terms of transgenosis Core-technology.China scientist passes through unremitting effort in more than 20 years, just Step establishes the transformation system of the staple crops such as cotton, rice, soybean rataria, mature embryo, forms efficient, safe transgenosis Technical system has formulated the genetically modified crops new varieties, new product such as large quantities of high-quality, disease-resistant, pest-resistant, drought resistings, salt tolerant, antiweed System and new material, and be widely applied in production, huge society, economy, ecological benefits are achieved, to ensure China's grain Food safety, ecological safety and increasing peasant income are made that tremendous contribution.In China, vast maize genetic and the arduous of breeding scholar are exerted Under power, corn gene Engineering Breeding also has been achieved for breakthrough, built to erect more mature maize genetic conversion System has cloned functional gene required for a collection of excellent corn gene Engineering Breeding, and has converted, screens and cultivated one It criticizes with high-lysine, pest-resistant, antiweed, degeneration-resistant, disease-resistant and excellent functionality transgenic corns material.

In recent years, the rapid development of biotechnology has greatly pushed the innovation and research level of plant breeding research means Continuous improvement, Genes For Plant Tolerance disease pest, antiweed biotechnology breeding have initially entered practical stage.Utilize biotechnology hand Section imports external source desinsection, anti-herbicide gene in Plant Genome, has broken and has been difficult to hybridize between plant species even species Natural barrier, realize pest-resistant, anti-herbicide gene transfer, thus make plant promptly, directionally obtain insect resistace and Mechanization weeding, while original good economical character can be retained again.Since every plant of plant of transgenic corns all has quite The resistance of degree, thus its is pest-resistant, antiweed effect well and is stablized than artificial control's control efficiency, additionally it is possible to save manpower With the investment of material resources, social resources are effectively saved.Other economical characters improve transgenic corns progress and application not as good as it is pest-resistant, Herbicide resistance is ideal, and mainly due to unexcellent character improvement gene, most economical character mainly has one slightly Caused by the controlled by multiple genes of effect, such as in terms of width of blade improvement, never ideal gene is operated.

Summary of the invention

The object of the present invention is to provide a kind of plant leaf width GAP-associated protein GAP KRDP1 and its encoding gene and applications.

Protein provided by the invention is named as KRDP1 albumen, for as follows (a1) or (a2) or (a3) or (a4):

(a1) protein shown in sequence 1 in sequence table；

(a2) fusion protein obtained in N-terminal or/and C-terminal the connection label of (a1) described protein；

(a3) by (a1) by one or several amino acid residues substitution and/or deletion and/or addition obtain with plant The relevant protein of object width of blade；

(a4) there is 98% or more identity and protein relevant with plant leaf blade width from corn and to (a1).

Label is specifically as shown in table 1.

The sequence of 1 label of table

Label	Residue	Sequence
			Poly-Arg	5-6 (usually 5)	RRRRR
Poly-His	2-10 (usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL
HA	9	YPYDVPDYA

Protein can be artificial synthesized, can also first synthesize its encoding gene, then carries out biological expression and obtain.

The nucleic acid molecules of encoded K RDP1 albumen also belong to protection scope of the present invention.

The nucleic acid molecules are following (b1) or (b2) or (b3) or (b4):

(b1) code area DNA molecular as shown in 1-2088 nucleotide in sequence 2 in sequence table；

(b2) DNA molecular shown in sequence 2 in sequence table；

(b3) there are the DNA of 95% or more identity and code for said proteins points from corn and with (b1) or (b2) Son；

(b4) under strict conditions with (b1) or (b2) limit nucleotide sequence hybridization and code for said proteins DNA Molecule.

The stringent condition is to hybridize at 68 DEG C in 2 × SSC, the solution of 0.1%SDS and wash film 2 times, every time 5min, but in 0.5 × SSC, the solution of 0.1%SDS, hybridize at 68 DEG C and washes film 2 times, each 15min.

Expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecules all belong to the scope of protection of the present invention.

The present invention also protects the application of KRDP1 albumen, for as follows (c1) or (c2):

(c1) regulate and control the width of blade of plant；

(c2) increase the width of blade of plant.

The present invention also protects the application of the nucleic acid molecules, for as follows (d1) or (d2):

(d1) genetically modified plants that width of blade changes are cultivated；

(d2) the increased genetically modified plants of width of blade are cultivated.

The present invention also protects the application for inhibiting the substance of KRDP1 albumen, for as follows (e1) or (e2):

(e1) regulate and control the width of blade of plant；

(e2) reduce the width of blade of plant.

The present invention also protects the application for inhibiting the substance of the nucleic acid molecules, for as follows (f1) or (f2):

(f1) genetically modified plants that width of blade changes are cultivated；

(f2) genetically modified plants that width of blade reduces are cultivated.

A kind of method that the present invention also protects prepare transgenosis plant includes the following steps: to import suppression in recipient plant The substance for making the nucleic acid molecules expression, obtains the genetically modified plants of width of blade reduction.

The present invention also protects a kind of plant breeding method, includes the following steps: to reduce KRDP1 albumen in purpose plant and contains Amount and/or activity, to reduce the width of blade of purpose plant.

The substance of the nucleic acid molecules is inhibited concretely to inhibit the substance of the nucleic acid molecules expression.Inhibit the nucleic acid The substance of molecule includes but is not limited to the substance for inhibiting the nucleic acid molecules expression based on gene editing technology.Inhibit the nucleic acid The substance of molecule includes but is not limited to the substance for passing through Cas9 system and inhibiting the nucleic acid molecules expression.Illustratively, described The target sequence of Cas9 system is concretely " GTCGGACATGAACAACCAGC ".The substance for inhibiting the nucleic acid molecules includes but not It is limited to special recombinant plasmid.The coded sequence of coded sequence and Cas9 albumen in special recombinant plasmid with gRNA.Cas9 egg It is white specifically can be as shown in the sequence 5 of sequence table.Illustratively, the target sequence of gRNA is concretely "GTCGGACATGAACAACCAGC".Special recombinant plasmid concretely recombinant plasmid pCAMBIA3301+SpCas9+gRNA. PCAMBIA3301 carrier is the carrier that sets out, between III restriction enzyme site of Sma I and Hind shown in the sequence 3 of insetion sequence table DNA molecular, the DNA molecular shown in the sequence 4 of insetion sequence table between HindIII and PstI restriction enzyme site, in NcoI and DNA molecular shown in the sequence 6 of insetion sequence table, obtains recombinant plasmid pCAMBIA3301+ between BstEII restriction enzyme site SpCas9+gRNA。

Corn belongs to annual crop, and Monocotyledonae, grass family (Gramineae), maize are belonged on taxology Race (Maydae), Zea (Zea L.), maize seed (Zea mays L), cultivated maize subspecies (mays).

Any description above plant can be Monocotyledonae.The monocotyledon concretely gramineae plant.Institute State gramineae plant concretely Zea plant.The Zea plant concretely maize seed plant.The corn Plant plant concretely cultivated maize subspecies plant.Illustratively, the plant can be corn inbred line X178.

The present invention is to study corn related gene around corn yield and this important character of growth potential and ultimate aim Biological function.On the one hand it is remarkably improved the level of China's corn gene breeding, reduces the gap with international most advanced level, On the other hand brute force technique support is provided to ensure national food security, ecological safety and improving agricultural product international competitiveness, it must Revolutionary variation will be brought to the development of China's Maize Industry.

Detailed description of the invention

Fig. 1 is seedling stage plant leaf width phenotype photo in embodiment 1.

Fig. 2 is maturity period plant leaf width phenotype photo in embodiment 1.

Fig. 3 is the structural schematic diagram of recombinant plasmid pCAMBIA3301+SpCas9+gRNA

Fig. 4 is in embodiment 2 for trying plant KRDP1 gene point of impact on target neighboring area sequencing result.

Fig. 5 is the electrophoresis detection result in embodiment 2 for trying plant SpCas9 gene.

Fig. 6 is the electrophoresis detection result in embodiment 2 for trying plant gRNA gene.

Fig. 7 is the electrophoresis detection result in embodiment 2 for trying plant bar gene.

Fig. 8 is in embodiment 2 for trying plant seedling stage phenotype photo.

Fig. 9 is in embodiment 2 for trying plant maturity period phenotype photo.

Figure 10 is in embodiment 2 for trying plant maturity period plant height statistical result.

Figure 11 is in embodiment 2 for trying the long statistical result of plant maturity period leaf.

Figure 12 is in embodiment 2 for trying plant maturity period leaf width statistical result.

Specific embodiment

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even Mean value.

Corn inbred line X178, also known as X178 Elite Maize Inbred Lines, are cultivars.

SpCas9 is a kind of adaptive immunity defence that bacterium and archeobacteria are formed during long-term evolution, be can be used to pair The virus and exogenous DNA of anti-invasion.And SpCas9 gene editing technology, then it is the skill that specific DNA modification is carried out to target gene Art, this technology are also the method currently used for forward position in gene editing.Gene editing technology based on SpCas9 is one The application field of serial genes treatment all shows great application prospect, such as blood disease, tumour and other genetic diseases.Mesh Before, the genome which has been applied to the mankind, animal, plant and microorganism is accurately modified.

Guide RNA (guide RNA, gRNA), also referred to as small guide RNA (small guide RNA, sgRNA), acts on One kind is known as in the rear transcription modification of rna editing (RNA editing) kinetoplast (kinetoplastid) in vivo, and A kind of small-sized non-coding RNA.Guide RNA can be matched with pre-mRNA, and be inserted into some uracils (U) wherein, and generation has The mRNA of effect.The RNA molecule of guide rna editing, length are about 60~80 nucleotide, are by individual genetic transcription , the tail with 3' oligomerization U, centre has one section with by the sequence of editor's mRNA exact complementarity, and the end 5' is an anchor series, It is complementary with unedited mRNA sequence.

The discovery of embodiment 1, gene

The present inventor identifies a pair of of blade width degree from Nongda108 recombinant inbred lines natural population, and there are bright The different near isogenic lines of significant difference has cloned corn by the method for map based cloning using the target group that near isogenic lines constructs KRDP1 gene, protein shown in the sequence 1 of polynucleotide.With the sequence of sequence table in the cDNA of corn inbred line X178 DNA molecular shown in column 2, wherein the 1-2088 open reading frame for KRDP1 gene.

It is specific as follows:

Corn inbred line X178 and corn self rotary series yellow C hybridization obtains F1 generation (i.e. Nongda108), and Nongda108 is selfed to obtain F₂Generation, F₂In generation, continuous selfing obtained F_6:7, multiple RILs are obtained, including near isogenic lines W964 and W968.RIL group leaf width At normal distribution.In BC1 group leaf width segregation ratio close to 1:3, wide leaf be dominant character.

Seedling stage plant leaf width phenotype photo is shown in Fig. 1.Maturity period plant leaf width phenotype photo is shown in Fig. 2.

The great vascular bundle spacing and lateral cell number difference differnce table 2 of different in width maize leaf.

Table 2

Note: the double-layer circular that the vascular bundle sheath cell of C4 plant and the circle mesophyll cell for being close to this confluent monolayer cells collectively form Structure is defined as Kranz structure.

With Nongda108 recombinant inbred lines, the main effect QTL of control corn leaf width is excavated by linkage analysis, chr4: Bin4_73, LOD value are up to 40 or more, explain 24% or more phenotypic variation.

Embodiment 2 obtains transgenosis pure lines KRDP1-1 by gene editing and selfing

One, the building of recombinant plasmid

Carrier is carrier uses pCAMBIA3301 carrier.Selected marker of the pCAMBIA3301 carrier in bacterium is that is mould for card Plain resistant gene encodes aminoglycoside phosphotransferase, does not have still at present it has been reported that its coded product is to the toxic pair of animal Effect, since it is located at T-DNA area periphery, will not be transferred in plant cell, therefore it does not have pathogenic, develops into pathogenic The probability of property is also extremely low.From Escherichia coli, main function is to aid in the replication orgin PBR ori of pCAMBIA3301 carrier Duplication of the carrier in coliform, is widely used in the building of engineered vector, is intended only as replication orgin presence, does not compile Code albumen, and it is located at T-DNA area periphery, cannot be transferred in plant cell, therefore it does not have pathogenic, develops into cause The probability of characteristic of disease is also extremely low.Another replication orgin pvs1sta of pCAMBIA3301 carrier is main to make from Pseudomonas alba It is replicated with plasmid is to aid in bacterium, which is widely used in the building of engineered vector, in this carrier It is mainly used for duplication of the engineered vector in Agrobacterium, is intended only as replication orgin presence, does not encode albumen, Er Qieyou It is located at T-DNA area periphery in it, cannot be transferred in plant cell, therefore it does not have pathogenic, develops into pathogenic general Rate is also extremely low.Pvs1repA in pCAMBIA3301 carrier encodes replication protein, main function is from Pseudomonas alba It helps plasmid to be replicated in bacterium, is widely used in the building of engineered vector, engineering is chiefly to facilitate in this carrier Duplication of the carrier in Agrobacterium does not have still at present it has been reported that its coded product is to animal toxic side effect, since it is located at T-DNA area periphery, therefore cannot be transferred in plant cell, therefore it does not have pathogenic, develops into pathogenic probability It is extremely low.Pbr bom in pCAMBIA3301 carrier comes from Agrobacterium, is cis elements, connects plasmid by referred to as bacterium The effect of conjunction is transferred in new host, and engineered vector starting T-DNA transfer is chiefly to facilitate in this carrier, is not reported still at present Think that it is thin cannot to be transferred to plant since it is located at T-DNA area periphery to animal toxic side effect for its coded product in road In born of the same parents, therefore it does not have pathogenic, and it is also extremely low to develop into pathogenic probability.The T-DNA of pCAMBIA3301 carrier derives from Ti The area T-DNA of plasmid pti37, but eliminated carcinoma gene and shifted unrelated sequence with T-DNA, it only remains T-DNA and turns Right border sequence (RB) necessary to moving and left margin sequence (LB), RB and LB are that exonuclease identifies sequence when T-DNA is shifted Column, do not encode any gene product.Selectable marker gene bar, derives from streptomyces hygroscopicus, and bar gene can produce phosphorylation Transacetylase can make the freedom of phosphine oxamate class herbicide acetylated, reach removing toxic substances purpose, so that convenient turn with heredity The screening of positive callus in change.

PCAMBIA3301 carrier is the carrier that sets out, the sequence 3 of insetion sequence table between III restriction enzyme site of Sma I and Hind Shown in DNA molecular (the 1-405 nucleotide of sequence 3 form U3 promoters, and 406-501 nucleotide transcribe to obtain GRNA), DNA molecular shown in the sequence 4 of insetion sequence table (the UBI promoter) between HindIII and PstI restriction enzyme site, DNA molecular (SpCas9 gene, polynucleotide shown in the sequence 6 of insetion sequence table between NcoI and BstEII restriction enzyme site Sequence 5 shown in protein), obtain recombinant plasmid pCAMBIA3301+SpCas9+gRNA.Recombinant plasmid pCAMBIA3301+ The structural schematic diagram of SpCas9+gRNA is shown in Fig. 3.There is Bar gene expression in recombinant plasmid pCAMBIA3301+SpCas9+gRNA Box (reverse complementary sequence of Bar expression casette as shown in the sequence 8 of sequence table, albumen shown in the sequence 7 of polynucleotide Matter).

Two, the preparation of regeneration plant and its self progeny

1, recombinant plasmid pCAMBIA3301+SpCas9+gRNA is imported into Agrobacterium EHA105, obtains recombinational agrobacterium.

2, the recombinational agrobacterium for obtaining step 1 infects the Embryonic Ovule of corn inbred line X178, then screens resistance Callus (carries out two-wheeled screening, first round screening uses 25mg/L glufosinate, and the second wheel screening uses 50mg/L glufosinate), Resistant calli is cultivated, T is obtained₀For plant.

3、T₀For plant selfing, T is obtained₁For plant；T₁For plant selfing, T is obtained₂For plant.

Three, the screening transgenic plant from regeneration plant

1, the detection of KRDP1 gene

For the T that examination plant is corn inbred line X178, step 2 obtains₀The T obtained for plant, step 2₁For plant and step Rapid two obtained T₂For plant.

The genomic DNA for trying plant is extracted, PCR amplification is carried out using the primer pair that KRDP1F and KRDP1R is formed and (is expanded Increasing fragment length is 900bp), then pcr amplification product is sequenced.

KRDP1F:5'-AAGGGAACTCGCCGACCATCTC-3'；

KRDP1R:5'-CTACGCATTCTGAGGCTTTCTTGGT-3'.

Obtain a plant mutant strain (T0 is for plant).The mutant strain is named as KRDP1-1 mutant strain.Corn inbred line The target sequence of gRNA is " GTCGGACATGAACAACCAGC " in X178, and the part becomes in KRDP1-1 mutant strain “GTCGGACATGAACC。

The T of corn inbred line X178, KRDP1-1 mutant strain₁For plant, the T of KRDP1-1 mutant strain₂It is carried out for plant above-mentioned The sequencing result of step is shown in Fig. 4.The mutant form of KRDP1-1 mutant strain is in T₁For plant, T₂For heredity stable in plant, and KRDP1-1 mutant strain has obtained homozygous self progeny.

2, the detection of SpCas9 gene

For the T that examination plant is corn inbred line X178, KRDP1-1 mutant strain, KRDP1-1 mutant strain step 2 obtains₁Generation The T that plant and KRDP1-1 mutant strain step 2 obtain₂For plant.

The genomic DNA for trying plant is extracted, carrying out PCR amplification using the primer pair that F1 and R1 is formed, (amplified fragments are long Degree is 868bp).

F1:5'-TCATCCACGACGACTCCCTCAC-3'；R1:5'-TGGGCGTGGTGGTAGTTGTTGAT-3'.

As a result see Fig. 5.In Fig. 5: M, molecular weight standard, DL2000plus；1, (distilled water is the amplification of template for blank control Product)；2, CK- (amplified production that the genomic DNA of corn inbred line X178 is template)；3, the gene of KRDP1-1 mutant strain Group DNA is the amplified production of template；4, the T of KRDP1-1 mutant strain₁Genomic DNA for plant is the amplified production of template；5, The T of KRDP1-1 mutant strain₂Genomic DNA for plant is the amplified production of template；6, CK+ (recombinant plasmid pCAMBIA3301+ SpCas9+gRNA is template amplification product).From amplification as can be seen that T₁For plant and T₂SpCas9 base is not contained for plant Cause.

3, the detection of gRNA gene

For the T that examination plant is corn inbred line X178, KRDP1-1 mutant strain, KRDP1-1 mutant strain step 2 obtains₁Generation The T that plant and KRDP1-1 mutant strain step 2 obtain₂For plant.

The genomic DNA for trying plant is extracted, carrying out PCR amplification using the primer pair that F2 and R2 is formed, (amplified fragments are long Degree is 359bp).

F2:5'-CAGGGACCATAGCACAAGACAGG-3'；R2:5'-TTTTCAAGTTGATAACGGACTAGCC-3'.

As a result see Fig. 6.In Fig. 6: M, molecular weight standard, DL2000plus；1, (distilled water is the amplification of template for blank control Product)；2, CK- (amplified production that the genomic DNA of corn inbred line X178 is template)；3, the gene of KRDP1-1 mutant strain Group DNA is the amplified production of template；4, the T of KRDP1-1 mutant strain₁Genomic DNA for plant is the amplified production of template；5, The T of KRDP1-1 mutant strain₂Genomic DNA for plant is the amplified production of template；6, CK+ (recombinant plasmid pCAMBIA3301+ SpCas9+gRNA is template amplification product).From amplification as can be seen that T₁For plant and T₂GRNA base is not contained for plant Cause.

4, the detection of bar gene

For the T that examination plant is corn inbred line X178, KRDP1-1 mutant strain, KRDP1-1 mutant strain step 2 obtains₁Generation The T that plant and KRDP1-1 mutant strain step 2 obtain₂For plant.

The genomic DNA for trying plant is extracted, carrying out PCR amplification using the primer pair that F3 and R3 is formed, (amplified fragments are long Degree is 669bp).

F3:5'-TCTCGGTGACGGGCAGGAC-3'；R3:5'-TGACGCACAATCCCACTATCCTT-3'.

As a result see Fig. 7.In Fig. 7: M, molecular weight standard, DL2000plus；1, (distilled water is the amplification of template for blank control Product)；2, CK- (amplified production that the genomic DNA of corn inbred line X178 is template)；3, the gene of KRDP1-1 mutant strain Group DNA is the amplified production of template；4, the T of KRDP1-1 mutant strain₁Genomic DNA for plant is the amplified production of template；5, The T of KRDP1-1 mutant strain₂Genomic DNA for plant is the amplified production of template；6, CK+ (recombinant plasmid pCAMBIA3301+ SpCas9+gRNA is template amplification product).From amplification as can be seen that T₁For plant and T₂Bar gene is not contained for plant.

The mutant form that can be seen that KRDP1-1 mutant strain from the testing result of three generations is stablized in different generations to be lost It passes, from T₁Targeted mutagenesis only occurs without exogenous genetic fragment and homozygous single plant for having screened in plant.The single plant from It hands over offspring for transgenosis pure lines, is named as KRDP1-1 strain.

Four, character compares

It is the T of corn inbred line X178, KRDP1-1 strain for examination plant₂For plant.

Normal culture is shown in Fig. 8 for trying plant, seedling stage phenotype, and maturity period phenotype is shown in Fig. 9.

The plant height statistics of maturity period plant is shown in Figure 10 (every kind counts 20 plants or more for examination plant), and the long statistics of leaf is shown in Figure 11 (every kind counts 20 plants or more for examination plant), leaf width statistics are shown in Figure 12 (every kind counts 20 plants or more for examination plant).Corn selfing It is the plant height of X178 plant and KRDP1-1 strain plant without significant difference.Corn inbred line X178 plant and KRDP1-1 strain are planted The Ye Changwu significant difference of strain.The leaf width of KRDP1-1 strain plant is significantly less than corn inbred line X178 plant.The result shows that Inhibit KRDP1 gene expression, the blade of plant can be made to narrow.

Carry out continuous three generations's observation for examination plant: being zoogamy, and can normal loose powder, filigree can be just after receiving pollen It is often solid；Dormant period, seed can normally germinate after drying without significant difference, and current year germination percentage is entirely given birth to 70% or more Phase was at 105-125 days；Struggle for existence ability is without significant difference.

SEQUENCE LISTING

<110>China Agricultural University

<120>plant leaf width GAP-associated protein GAP KRDP1 and its encoding gene and application

<130> GNCYX190565

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 695

<212> PRT

<213> Zea mays L.

<400> 1

Met Pro Lys Met Phe Gly Phe Ser Arg Arg Arg Met Lys Leu Gly Arg

1 5 10 15

Leu Lys Gly His Leu His Asp His Phe His Gly Pro Arg Ser Pro Ser

20 25 30

Arg Thr Thr Lys Arg Ser Ser Ser His His Asn Ala Glu Asp Pro Leu

35 40 45

Ala Thr Ser Val Ser Gly Arg Ala Asp Asp Leu Ala Trp Arg Cys Ser

50 55 60

Ser Asp Thr Phe Asp Leu Asn Gly Arg Asp Phe Glu Ser Ser Glu Asn

65 70 75 80

Trp Ala Val Leu Ser Thr Glu Gly Asp Lys Pro Ala Pro Arg Phe Asp

85 90 95

His Ala Ala Ala Met Val Gly Ser Lys Met Val Val Phe Gly Gly Asp

100 105 110

Ser Gly Gln Ser Leu Leu Asp Asp Thr Lys Ile Leu Ser Leu Asp Lys

115 120 125

Leu Thr Trp Asp Ser Val Ala Pro Lys Val Arg Pro Pro Leu Asn Gly

130 135 140

Arg Ser Leu Lys Leu Arg Pro Cys Arg Gly His Cys Leu Val Ser Trp

145 150 155 160

Gly Lys Asn Val Ile Leu Val Gly Gly Lys Ser Asp Gln Pro Tyr Asp

165 170 175

Lys Ile Ser Val Trp Thr Phe Asn Thr Glu Ser Glu Leu Trp Ser His

180 185 190

Met Glu Ala Lys Gly Asp Ile Pro Val Ser Arg Ser Gly His Thr Val

195 200 205

Ile Arg Ala Gly Pro Val Leu Ile Leu Phe Gly Gly Glu Asp Ala Lys

210 215 220

Gly Lys Lys Leu His Asp Leu His Met Phe Asp Leu Lys Ser Leu Thr

225 230 235 240

Trp Leu Pro Leu Asn Tyr Lys Gly Ala Gly Pro Ser Pro Arg Ser Asn

245 250 255

His Val Ala Ala Leu Tyr Asp Asp Arg Val Leu Leu Ile Phe Gly Gly

260 265 270

Gln Ser Lys Ser Lys Thr Leu Asn Asp Ile His Ala Leu Asp Phe Glu

275 280 285

Thr Met Val Trp Ser Arg Val Lys Thr His Gly His His Pro Ser Pro

290 295 300

Arg Ala Gly Cys Cys Gly Ala Leu Cys Gly Thr Lys Trp Tyr Ile Ala

305 310 315 320

Gly Gly Gly Ser Lys Lys Lys Arg His Pro Glu Thr Trp Val Phe Asp

325 330 335

Val Leu Glu Ser Arg Trp Ser Val Cys Val Val Pro Pro Ser Ser Ser

340 345 350

Ile Thr Thr Lys Lys Gly Phe Ser Met Val Pro Leu Tyr Tyr Arg Asp

355 360 365

Lys Ile Val Leu Val Ala Phe Gly Gly Asn Lys Lys Glu Pro Ser Asp

370 375 380

Lys Val Glu Val Leu Val Val Leu Gln Asn Glu His Cys Phe Ser Trp

385 390 395 400

Arg Ser Ala Pro Glu Val Glu Pro Leu Leu Tyr Asp Glu Ser Pro Pro

405 410 415

Gly Ser Arg Glu Leu Ala Asp His Leu Ser Ser Cys Ala Pro Pro Tyr

420 425 430

Pro Thr Ser Ser Ala Ala Arg Ser Gly Leu Ala Ala Thr Ala Glu Asn

435 440 445

Ser Cys Gly Arg Lys Pro Leu Pro Asp Ser Leu Leu Arg Thr Ser Asn

450 455 460

Leu Gly Gly Ser Ser Leu Arg Arg Gln Phe Arg Gln Glu Glu Glu Cys

465 470 475 480

Ser Ser Leu Ala Gln Lys Leu Gln Lys Pro Ile Asp Asp Asp Arg Tyr

485 490 495

Lys Asp Ala Ala Asp Glu Cys Ser Glu His Gln Pro Pro Ser Ala Thr

500 505 510

Asn Pro Lys Pro Arg Asn Asp Ala Arg Arg Ser Ser Pro Glu Val Val

515 520 525

Val Asp Ala Lys Ala Arg Arg Leu Leu Gly Arg Ser Ser Ser Asp Met

530 535 540

Asn Asn His Gln Asp Ala Arg Val Ala Ala Leu Val Arg Arg Asn Val

545 550 555 560

Ala Leu Glu Glu Gln Leu Ser Ala Ala Leu Ala Ser Lys Asp Glu Ala

565 570 575

Glu Lys Asn Leu Ser Leu Val Ile Asp Ser Lys Asp Gly Leu Glu Lys

580 585 590

Arg Leu Ala Glu Lys Asp Arg Glu Val Glu Ala Leu Arg Glu Lys Ala

595 600 605

Thr Gly Leu Glu Leu Ala Gln Glu Glu Ala Asn Ser Leu Ser Asn Thr

610 615 620

Val His Ala Asp Asn Val Arg Leu Glu Arg Glu Val Ala Phe Leu Lys

625 630 635 640

Ala Val Met Asp Glu Thr Gln Lys Glu Leu His Ser Thr Arg Gly Val

645 650 655

Leu Ala Gly Glu Arg Ala Arg Ala Phe Gln Leu Gln Val Arg Pro Tyr

660 665 670

His Ala Arg Leu Ser Phe Phe Leu Phe Phe Val His Ala Leu Gly Ser

675 680 685

Ala Arg Leu Lys Ser Phe Ile

690 695

<210> 2

<211> 2153

<212> DNA

<213> Zea mays L.

<400> 2

atgcccaaga tgttcgggtt ctctcggcgc cggatgaagc tgggcaggtt gaagggccat 60

ctgcacgacc atttccatgg ccctcgaagc ccgtctcgga ccaccaagcg ttccagcagt 120

catcacaacg cagaggatcc attggctacc tcagtgagtg ggcgcgccga cgacctcgcc 180

tggcgctgct cgtccgacac tttcgatctc aatgggcgcg atttcgagag ctccgagaac 240

tgggcggtcc tgtccaccga gggtgacaag ccagctcctc gtttcgatca tgcagcagcc 300

atggttggga gcaaaatggt ggtgtttggt ggcgactccg gtcaatcttt gctagatgat 360

actaagatat tgagcttaga caagcttacc tgggattctg ttgctcctaa agttcgacca 420

ccattgaacg ggcgttctct gaagctgagg ccatgcagag gtcattgcct ggtttcgtgg 480

ggaaagaatg ttattcttgt gggagggaaa agtgatcaac cttatgacaa gatatcagta 540

tggaccttca atacagagag tgagctctgg tctcatatgg aagcgaaggg tgacattccg 600

gtgtctcgaa gtgggcatac ggtgattaga gccggtcctg ttttaattct ctttggaggt 660

gaagatgcca aagggaagaa actacatgac cttcatatgt ttgatctgaa gtcattaaca 720

tggcttcctc tgaactataa gggtgctgga ccttctccaa gatcaaatca tgtagccgcc 780

ctttacgatg atagagtcct attgattttt ggaggtcagt cgaagtccaa gaccctgaat 840

gatattcatg ctctagattt tgaaacaatg gtatggtcaa gggtcaaaac ccatgggcat 900

catccatcac ctcgagcagg ttgctgcgga gctctttgtg gaactaaatg gtatattgca 960

ggaggtggaa gcaagaaaaa acggcaccct gaaacatggg ttttcgatgt ccttgagtcc 1020

agatggtctg tttgtgtagt gcctcctagt tcctcaatca ctacaaagaa aggtttcagc 1080

atggttccat tgtactacag ggacaagatc gtgcttgttg cttttggagg gaacaaaaag 1140

gaaccatccg acaaggttga agtactagtg gtgctgcaaa acgagcactg tttcagctgg 1200

cggtctgcgc ccgaggtgga acccttactg tacgacgagt ctcctccagg ctcaagggaa 1260

ctcgccgacc atctcagcag ctgcgctcca ccgtatccta ctagctccgc ggcgaggagc 1320

ggtctcgccg ccacagcgga gaactcctgc gggaggaaac ccctcccgga ctcactgcta 1380

cggacctcga acctcggggg ctcgtcgctc cgcaggcagt tccgtcagga agaggagtgc 1440

agcagcctgg cgcaaaagct gcagaaaccg atcgacgacg acaggtacaa ggacgccgcc 1500

gacgagtgct ccgagcatca accaccctcg gccacgaacc ctaaaccgcg gaacgacgcg 1560

cggcggtcgt ccccggaggt cgtcgtcgac gcaaaagcga ggaggctgct gggcaggagc 1620

tcgtcggaca tgaacaacca ccaggacgca agggtggccg ccctggtcag gaggaacgtg 1680

gcgctggaag agcagctgtc ggcggcgctg gcgagcaagg acgaggcgga gaagaacctg 1740

tccctggtca tcgacagcaa ggacggcctg gagaagaggc tggccgagaa ggacagggag 1800

gtcgaggcgc tgagggagaa ggcgacgggg ttggagctgg cgcaggagga ggccaacagc 1860

ctctccaaca ccgtccacgc cgacaacgtg cggctggagc gcgaggtggc gttcctgaag 1920

gccgtcatgg acgagaccca gaaggaactg cactcgactc gcggagttct tgcaggagaa 1980

cgcgcacggg cattccagct tcaggtaaga ccttatcatg ctagactttc tttctttctt 2040

ttttttgttc atgccttggg ctctgccagg ttgaagtctt tcatctgaag cagcgcctgc 2100

agacgatgga agggaggtca cccgcagcac caagaaagcc tcagaatgcg tag 2153

<210> 3

<211> 507

<212> DNA

<213> Artificial sequence

<400> 3

ttcagaactg caacttattt tatcaaggaa tctttaaaca tacgaacaga tcacttaaag 60

ttcttctgaa gcaacttaaa gttatcaggc atgcatggat cttggaggaa tcagatgtgc 120

agtcagggac catagcacaa gacaggcgtg ttctactggt gctaccagca aatgctggaa 180

gccgggaaca ctgggtacgt tggaaaccac gtgatgtgaa gaagtaagat aaactgtagg 240

agaaaagcat ttcgtagtgg gccatgaagc ctttcaggac atgtattgca gtatgggccg 300

gcccattacg caattggacg acaacaaaga ctagtattag taccacctcg gctatccaca 360

tagatcaaag ctgatttaaa agagttgtgc agatgatccg tggcagtcgg acatgaacaa 420

ccaccgtttt agagctagaa atagcaagtt aaaataaggc tagtccgtta tcaacttgaa 480

aaagtggcac cgagtcggtg ctttttt 507

<210> 4

<211> 1991

<212> DNA

<213> Artificial sequence

<400> 4

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaatgc gtggcggagc ggcagacgtg agccggcacg 780

gcaggcggcc tcctcctcct ctcacggcac ggcagctacg ggggattcct ttcccaccgc 840

tccttcgctt tcccttcctc gcccgccgta ataaatagac accccctcca caccctcttt 900

ccccaacctc gtgttgttcg gagcgcacac acacacaacc agatctcccc caaatccacc 960

cgtcggcacc tccgcttcaa ggtacgccgc tcgtcctccc cccccccccc tctctacctt 1020

ctctagatcg gcgttccggt ccatggttag ggcccggtag ttctacttct gttcatgttt 1080

gtgttagatc cgtgtttgtg ttagatccgt gctgctagcg ttcgtacacg gatgcgacct 1140

gtacgtcaga cacgttctga ttgctaactt gccagtgttt ctctttgggg aatcctggga 1200

tggctctagc cgttccgcag acgggatcga tttcatgatt ttttttgttt cgttgcatag 1260

ggtttggttt gcccttttcc tttatttcaa tatatgccgt gcacttgttt gtcgggtcat 1320

cttttcatgc ttttttttgt cttggttgtg atgatgtggt ctggttgggc ggtcgttcta 1380

gatcggagta gaattctgtt tcaaactacc tggtggattt attaattttg gatctgtatg 1440

tgtgtgccat acatattcat agttacgaat tgaagatgat ggatggaaat atcgatctag 1500

gataggtata catgttgatg cgggttttac tgatgcatat acagagatgc tttttgttcg 1560

cttggttgtg atgatgtggt gtggttgggc ggtcgttcat tcgttctaga tcggagtaga 1620

atactgtttc aaactacctg gtgtatttat taattttgga actgtatgtg tgtgtcatac 1680

atcttcatag ttacgagttt aagatggatg gaaatatcga tctaggatag gtatacatgt 1740

tgatgtgggt tttactgatg catatacatg atggcatatg cagcatctat tcatatgctc 1800

taaccttgag tacctatcta ttataataaa caagtatgtt ttataattat tttgatcttg 1860

atatacttgg atgatggcat atgcagcagc tatatgtgga tttttttagc cctgccttca 1920

tacgctattt atttgcttgg tactgtttct tttgtcgatg ctcaccctgt tgtttggtgt 1980

tacttctgca g 1991

<210> 5

<211> 1389

<212> PRT

<213> Artificial sequence

<400> 5

Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val

1 5 10 15

Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe

20 25 30

Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile

35 40 45

Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu

50 55 60

Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys

65 70 75 80

Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser

85 90 95

Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys

100 105 110

His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr

115 120 125

His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp

130 135 140

Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His

145 150 155 160

Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro

165 170 175

Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr

180 185 190

Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala

195 200 205

Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn

210 215 220

Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn

225 230 235 240

Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe

245 250 255

Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp

260 265 270

Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp

275 280 285

Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp

290 295 300

Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser

305 310 315 320

Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys

325 330 335

Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe

340 345 350

Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser

355 360 365

Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp

370 375 380

Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg

385 390 395 400

Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu

405 410 415

Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe

420 425 430

Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile

435 440 445

Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp

450 455 460

Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu

465 470 475 480

Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr

485 490 495

Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser

500 505 510

Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys

515 520 525

Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln

530 535 540

Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr

545 550 555 560

Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp

565 570 575

Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly

580 585 590

Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp

595 600 605

Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr

610 615 620

Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala

625 630 635 640

His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr

645 650 655

Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp

660 665 670

Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe

675 680 685

Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe

690 695 700

Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu

705 710 715 720

His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly

725 730 735

Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly

740 745 750

Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln

755 760 765

Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile

770 775 780

Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro

785 790 795 800

Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu

805 810 815

Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg

820 825 830

Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys

835 840 845

Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg

850 855 860

Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys

865 870 875 880

Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys

885 890 895

Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp

900 905 910

Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr

915 920 925

Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp

930 935 940

Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser

945 950 955 960

Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg

965 970 975

Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val

980 985 990

Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe

995 1000 1005

Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala

1010 1015 1020

Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe

1025 1030 1035

Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala

1040 1045 1050

Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu

1055 1060 1065

Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val

1070 1075 1080

Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr

1085 1090 1095

Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys

1100 1105 1110

Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro

1115 1120 1125

Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val

1130 1135 1140

Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys

1145 1150 1155

Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser

1160 1165 1170

Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys

1175 1180 1185

Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu

1190 1195 1200

Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly

1205 1210 1215

Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val

1220 1225 1230

Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser

1235 1240 1245

Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys

1250 1255 1260

His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys

1265 1270 1275

Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala

1280 1285 1290

Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn

1295 1300 1305

Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala

1310 1315 1320

Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser

1325 1330 1335

Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr

1340 1345 1350

Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp

1355 1360 1365

Gly Ser Gly Ser Pro Lys Lys Lys Arg Lys Val Glu Asp Pro Lys

1370 1375 1380

Lys Lys Arg Lys Val Asp

1385

<210> 6

<211> 4263

<212> DNA

<213> Artificial sequence

<400> 6

ggtaccagat ctatggacta caaggaccac gacggcgact acaaggacca cgacatcgac 60

tacaaggacg acgacgacaa gatggacaag aagtactcca tcggcctcga catcggcacc 120

aactccgtcg gctgggccgt catcaccgac gagtacaagg tcccctccaa gaagttcaag 180

gtcctcggca acaccgaccg ccactccatc aagaagaacc tcatcggcgc cctcctcttc 240

gactccggcg agaccgccga ggccacccgc ctcaagcgca ccgcccgccg ccgctacacc 300

cgccgcaaga accgcatctg ctacctccag gagattttct ccaacgagat ggccaaggtc 360

gacgactcct tcttccaccg cctcgaggag tccttcctcg tcgaggagga caagaagcac 420

gagcgccacc ccatcttcgg caacatcgtc gacgaggtcg cctaccacga gaagtacccc 480

accatctacc acctccgcaa gaagctcgtc gactccaccg acaaggccga cctccgcctc 540

atctacctcg ccctcgccca catgatcaag ttccgcggcc acttcctcat cgagggcgac 600

ctcaaccccg acaactccga cgtcgacaag ctcttcatcc agctcgtcca gacctacaac 660

cagctcttcg aggagaaccc catcaacgcc tccggcgtcg acgccaaggc catcctctcc 720

gcccgcctct ccaagtcccg ccgcctcgag aacctcatcg cccagctccc cggcgagaag 780

aagaacggcc tcttcggcaa cctcatcgcc ctctccctcg gcctcacccc caacttcaag 840

tccaacttcg acctcgccga ggacgccaag ctccagctct ccaaggacac ctacgacgac 900

gacctcgaca acctcctcgc ccagatcggc gaccagtacg ccgacctctt cctcgccgcc 960

aagaacctct ccgacgccat cctcctctcc gacatcctcc gcgtcaacac cgagatcacc 1020

aaggcccccc tctccgcctc catgatcaag cgctacgacg agcaccacca ggacctcacc 1080

ctcctcaagg ccctcgtccg ccagcagctc cccgagaagt acaaggagat tttcttcgac 1140

cagtccaaga acggctacgc cggctacatc gacggcggcg cctcccagga ggagttctac 1200

aagttcatca agcccatcct cgagaagatg gacggcaccg aggagctgct cgtcaagctc 1260

aaccgcgagg acctcctccg caagcagcgc accttcgaca acggctccat cccccaccag 1320

atccacctcg gcgagctgca cgccatcctc cgccgccagg aggacttcta ccccttcctc 1380

aaggacaacc gcgagaagat cgagaagatc ctcaccttcc gcatccccta ctacgtcggc 1440

cccctcgccc gcggcaactc ccgcttcgcc tggatgaccc gcaagtccga ggagaccatc 1500

accccctgga acttcgagga ggtcgtcgac aagggcgcct ccgcccagtc cttcatcgag 1560

cgcatgacca acttcgacaa gaacctcccc aacgagaagg tcctccccaa gcactccctc 1620

ctctacgagt acttcaccgt ctacaacgag ctgaccaagg tcaagtacgt caccgagggc 1680

atgcgcaagc ccgccttcct ctccggcgag cagaagaagg ccatcgtcga cctcctcttc 1740

aagaccaacc gcaaggtcac ggtcaagcag ctcaaggagg actacttcaa gaagatcgag 1800

tgcttcgact ccgtcgagat cagcggcgtc gaggaccgct tcaacgcctc cctcggcacc 1860

taccacgacc tcctcaagat catcaaggac aaggacttcc tcgacaacga ggagaacgag 1920

gacatcctcg aggacatcgt cctcaccctc accctcttcg aggaccgcga gatgatcgag 1980

gagcgcctca agacctacgc ccacctcttc gacgacaagg tcatgaagca gctcaagcgc 2040

cgccgctaca ccggctgggg ccgcctctcc cgcaagctca tcaacggcat ccgcgacaag 2100

cagtccggca agaccatcct cgacttcctc aagtccgacg gcttcgccaa ccgcaacttc 2160

atgcagctca tccacgacga ctccctcacc ttcaaggagg acatccagaa ggcccaggtc 2220

tccggccagg gcgactccct ccacgagcac atcgccaacc tcgccggctc ccccgccatc 2280

aagaagggca tcctccagac cgtcaaggtc gtcgacgagc tggtcaaggt catgggccgc 2340

cacaagcccg agaacatcgt catcgagatg gcccgcgaga accagaccac ccagaagggc 2400

cagaagaact cccgcgagcg catgaagcgc atcgaggagg gcatcaagga gctgggctcc 2460

cagatcctca aggagcaccc cgtcgagaac acccagctcc agaacgagaa gctctacctc 2520

tactacctcc agaacggccg cgacatgtac gtcgaccagg agctggacat caaccgcctc 2580

tccgactacg acgtcgacca catcgtcccc cagtccttcc tcaaggacga ctccatcgac 2640

aacaaggtcc tcacccgctc cgacaagaac cgcggcaagt ccgacaacgt cccctccgag 2700

gaggtcgtca agaagatgaa gaactactgg cgccagctcc tcaacgccaa gctcatcacc 2760

cagcgcaagt tcgacaacct caccaaggcc gagcgcggcg gcctctccga gctggacaag 2820

gccggcttca tcaagcgcca gctcgtcgag acccgccaga tcaccaagca cgtcgcccag 2880

atcctcgact cccgcatgaa caccaagtac gacgagaacg acaagctcat ccgcgaggtc 2940

aaggtcatca ccctcaagtc caagctcgtc tccgacttcc gcaaggactt ccagttctac 3000

aaggtccgcg agatcaacaa ctaccaccac gcccacgacg cctacctcaa cgccgtcgtc 3060

ggcaccgccc tcatcaagaa gtaccccaag ctcgagtccg agttcgtcta cggcgactac 3120

aaggtctacg acgtccgcaa gatgatcgcc aagtccgagc aggagatcgg caaggccacc 3180

gccaagtact tcttctactc caacatcatg aacttcttca agaccgagat caccctcgcc 3240

aacggcgaga tccgcaagcg ccccctcatc gagaccaacg gcgagaccgg cgagatcgtc 3300

tgggacaagg gccgcgactt cgccaccgtc cgcaaggtcc tctccatgcc ccaggtcaac 3360

atcgtcaaga agaccgaggt ccagaccggc ggcttctcca aggagtccat cctccccaag 3420

cgcaactccg acaagctcat cgcccgcaag aaggactggg accccaagaa gtacggcggc 3480

ttcgactccc ccaccgtcgc ctactccgtc ctcgtcgtcg ccaaggtcga gaagggcaag 3540

tccaagaagc tcaagtccgt caaggagctg ctcggcatca ccatcatgga gcgctcctcc 3600

ttcgagaaga accccatcga cttcctcgag gccaagggct acaaggaggt caagaaggac 3660

ctcatcatca agctccccaa gtactccctc ttcgagctgg agaacggccg caagcgcatg 3720

ctcgcctccg ccggcgagct gcagaagggc aacgagctgg ccctcccctc caagtacgtc 3780

aacttcctct acctcgcctc ccactacgag aagctcaagg gctcccccga ggacaacgag 3840

cagaagcagc tcttcgtcga gcagcacaag cactacctcg acgagatcat cgagcagatc 3900

agcgagttct ccaagcgcgt catcctcgcc gacgccaacc tcgacaaggt cctctccgcc 3960

tacaacaagc accgcgacaa gcccatccgc gagcaggccg agaacatcat ccacctcttc 4020

accctcacca acctcggcgc ccccgccgcc ttcaagtact tcgacaccac catcgaccgc 4080

aagcgctaca cctccaccaa ggaggtcctc gacgccaccc tcatccacca gtccatcacc 4140

ggcctctacg agacccgcat cgacctctcc cagctcggcg gcgacggctc cggatccccc 4200

aagaagaagc gcaaggtcga ggaccccaag aagaagcgca aggtcgactg agctagcgag 4260

ctc 4263

<210> 7

<211> 183

<212> PRT

<213> Artificial sequence

<400> 7

Met Ser Pro Glu Arg Arg Pro Ala Asp Ile Arg Arg Ala Thr Glu Ala

1 5 10 15

Asp Met Pro Ala Val Cys Thr Ile Val Asn His Tyr Ile Glu Thr Ser

20 25 30

Thr Val Asn Phe Arg Thr Glu Pro Gln Glu Pro Gln Glu Trp Thr Asp

35 40 45

Asp Leu Val Arg Leu Arg Glu Arg Tyr Pro Trp Leu Val Ala Glu Val

50 55 60

Asp Gly Glu Val Ala Gly Ile Ala Tyr Ala Gly Pro Trp Lys Ala Arg

65 70 75 80

Asn Ala Tyr Asp Trp Thr Ala Glu Ser Thr Val Tyr Val Ser Pro Arg

85 90 95

His Gln Arg Thr Gly Leu Gly Ser Thr Leu Tyr Thr His Leu Leu Lys

100 105 110

Ser Leu Glu Ala Gln Gly Phe Lys Ser Val Val Ala Val Ile Gly Leu

115 120 125

Pro Asn Asp Pro Ser Val Arg Met His Glu Ala Leu Gly Tyr Ala Pro

130 135 140

Arg Gly Met Leu Arg Ala Ala Gly Phe Lys His Gly Asn Trp His Asp

145 150 155 160

Val Gly Phe Trp Gln Leu Asp Phe Ser Leu Pro Val Pro Pro Arg Pro

165 170 175

Val Leu Pro Val Thr Glu Ile

180

<210> 8

<211> 1489

<212> DNA

<213> Artificial sequence

<400> 8

acaaatacaa atacatacta agggtttctt atatgctcaa cacatgagcg aaaccctata 60

ggaaccctaa ttcccttatc tgggaactac tcacacatta ttatggagaa actcgagtca 120

aatctcggtg acgggcagga ccggacgggg cggtaccggc aggctgaagt ccagctgcca 180

gaaacccacg tcatgccagt tcccgtgctt gaagccggcc gcccgcagca tgccgcgggg 240

ggcatatccg agcgcctcgt gcatgcgcac gctcgggtcg ttgggcagcc cgatgacagc 300

gaccacgctc ttgaagccct gtgcctccag ggacttcagc aggtgggtgt agagcgtgga 360

gcccagtccc gtccgctggt ggcgggggga gacgtacacg gtcgactcgg ccgtccagtc 420

gtaggcgttg cgtgccttcc aggggcccgc gtaggcgatg ccggcgacct cgccgtccac 480

ctcggcgacg agccagggat agcgctcccg cagacggacg aggtcgtccg tccactcctg 540

cggttcctgc ggctcggtac ggaagttgac cgtgcttgtc tcgatgtagt ggttgacgat 600

ggtgcagacc gccggcatgt ccgcctcggt ggcacggcgg atgtcggccg ggcgtcgttc 660

tgggctcatg gtagactcga gagagataga tttgtagaga gagactggtg atttcagcgt 720

gtcctctcca aatgaaatga acttccttat atagaggaag gtcttgcgaa ggatagtggg 780

attgtgcgtc atcccttacg tcagtggaga tatcacatca atccacttgc tttgaagacg 840

tggttggaac gtcttctttt tccacgatgc tcctcgtggg tgggggtcca tctttgggac 900

cactgtcggc agaggcatct tgaacgatag cctttccttt atcgcaatga tggcatttgt 960

aggtgccacc ttccttttct actgtccttt tgatgaagtg acagatagct gggcaatgga 1020

atccgaggag gtttcccgat attacccttt gttgaaaagt ctcaatagcc ctttggtctt 1080

ctgagactgt atctttgata ttcttggagt agacgagagt gtcgtgctcc accatgttat 1140

cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc 1200

tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga ggcatcttga acgatagcct 1260

ttcctttatc gcaatgatgg catttgtagg tgccaccttc cttttctact gtccttttga 1320

tgaagtgaca gatagctggg caatggaatc cgaggaggtt tcccgatatt accctttgtt 1380

gaaaagtctc aatagccctt tggtcttctg agactgtatc tttgatattc ttggagtaga 1440

cgagagtgtc gtgctccacc atgttggcaa gctgctctag ccaatacgc 1489

Claims (10)

1. a kind of protein, for as follows (a1) or (a2) or (a3) or (a4):

(a1) protein shown in sequence 1 in sequence table；

(a2) fusion protein obtained in N-terminal or/and C-terminal the connection label of (a1) described protein；

(a3) obtain (a1) by the substitution and/or deletion and/or addition of one or several amino acid residues and leaves of plants The relevant protein of piece width；

(a4) there is 98% or more identity and protein relevant with plant leaf blade width from corn and to (a1).

2. encoding the nucleic acid molecules of protein described in claim 1.

3. nucleic acid molecules as claimed in claim 2, it is characterised in that: the nucleic acid molecules are following (b1) or (b2) or (b3) Or (b4):

(b1) code area DNA molecular as shown in 1-2088 nucleotide in sequence 2 in sequence table；

(b2) DNA molecular shown in sequence 2 in sequence table；

(b3) there is the DNA molecular of 95% or more identity and code for said proteins from corn and with (b1) or (b2)；

(b4) DNA under strict conditions with (b1) or (b2) nucleotide sequence hybridization limited and code for said proteins divides Son.

4. expression cassette, recombinant vector or recombinant microorganism containing nucleic acid molecules described in Claims 2 or 3.

5. the application of protein described in claim 1, for as follows (c1) or (c2):

(c1) regulate and control the width of blade of plant；

(c2) increase the width of blade of plant.

6. the application of nucleic acid molecules described in Claims 2 or 3, for as follows (d1) or (d2):

(d1) genetically modified plants that width of blade changes are cultivated；

(d2) the increased genetically modified plants of width of blade are cultivated.

7. inhibit the application of the substance of protein described in claim 1, for as follows (e1) or (e2):

(e1) regulate and control the width of blade of plant；

(e2) reduce the width of blade of plant.

8. inhibit the application of the substance of nucleic acid molecules described in Claims 2 or 3, for as follows (f1) or (f2):

(f1) genetically modified plants that width of blade changes are cultivated；

(f2) genetically modified plants that width of blade reduces are cultivated.

9. a kind of method of prepare transgenosis plant includes the following steps: to import inhibition Claims 2 or 3 in recipient plant The substance of the nucleic acid molecules expression, obtains the genetically modified plants of width of blade reduction.

10. a kind of plant breeding method includes the following steps: the content for reducing protein described in claim 1 in purpose plant And/or activity, to reduce the width of blade of purpose plant.