CN109870432A - One kind is based on the inhibition active detection method of Chinese medicine composition of COX-2 - Google Patents
One kind is based on the inhibition active detection method of Chinese medicine composition of COX-2 Download PDFInfo
- Publication number
- CN109870432A CN109870432A CN201711268953.6A CN201711268953A CN109870432A CN 109870432 A CN109870432 A CN 109870432A CN 201711268953 A CN201711268953 A CN 201711268953A CN 109870432 A CN109870432 A CN 109870432A
- Authority
- CN
- China
- Prior art keywords
- cox
- chinese medicine
- weight
- medicine composition
- parts
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/06—Aluminium, calcium or magnesium; Compounds thereof, e.g. clay
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/78—Saururaceae (Lizard's-tail family)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Medical Informatics (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Inorganic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Alternative & Traditional Medicine (AREA)
- Biotechnology (AREA)
- Botany (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Pain & Pain Management (AREA)
- Rheumatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicines Containing Plant Substances (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of detection method of Chinese medicine composition, this method using the Chinese medicine composition to the inhibiting rate of COX-2 enzyme as testing index, detect its anti-inflammatory activity.The described method includes: A) prepare Chinese medicine composition sample solution and/or reference substance solution；B sample solution and reference substance solution) are measured to the inhibiting rate of COX-2 enzyme activity；C) using COX-2 enzyme activity inhibiting rate as index, potency and Reliable limit rate are calculated.
Description
Technical field
The present invention relates to the biological detecting methods of Chinese medicine composition, belong to field of medicaments.
Background technique
Currently, the quality evaluation of Chinese medicine compound prescription is only carried out by measuring single chemical component, firstly, the chemical component is
It is no be compound play drug effect substance, second, whether the minimum content for controlling the chemical component can be effectively controlled having for its quality
Effect property and consistency? from the current study, only aobvious to Chinese medicine compound prescription progress quality evaluation by measuring single chemical component
It is so not all right.Therefore, how according to the concrete condition of Chinese medicine compound prescription, in conjunction with modern science and technology, exploration can meet Chinese medicine
Medicine feature had not only been associated with clinical efficacy but also correlation mechanism to a certain extent, the compound Chinese medicinal preparation matter with operability
Amount comments prosecutor method, guarantees the consistency and stability of Chinese medicine compound prescription clinical efficacy, is most important project in traditional Chinese medicine research field
One of.
Biological activity determination guideline is included by " Chinese Pharmacopoeia ", and is used in the control of the quality of the medicinal materials such as leech
The method of biological assessment；U.S. FDA also clearly proposes that biological assessment will be used as plant in " botanical medicine researches and develops industry guide "
The main contents of medicine registration evaluation.As it can be seen that biological assessment has become the developing direction of Chinese medicine and compound Chinese medicinal preparation quality evaluation.
For Chinese medicine, the clinical application overwhelming majority is Chinese medicine compound prescription, seldom there is the case where single flavour of a drug use, it is complicated at
Divide and the pharmacological action of multiplicity all determines that the one or more of active constituents of detection can not embody its whole drug effect, only passes through
It is unworkable that this standard, which evaluates Chinese medicine,.Biological assessment method introducing traditional Chinese medicine quality control system can not only be identified into product
Kind, evaluation quality can also mutually be linked up with its drug effect, and observe its toxic side effect.For to a certain extent, biology is utilized
There is apparent superiority compared with traditional chemical routes for the quality of evaluation method detection Chinese medicine.Wherein point of compound big for Chinese medicine
Analysis can more embody its advantage.
Summary of the invention
In view of the deficienciess of the prior art, the present invention provides a kind of biological detecting method of Chinese medicine composition, relative to
The prior art only detects the detection method of one or more of active constituents, and biological detecting method of the invention can be characterized more fully
The whole drug effect of Chinese medicine composition, to control its quality.
A kind of detection method of Chinese medicine composition, this method comprises: Chinese medicine composition is prepared as detectable sample, with
Cycloxygenase (COX) contact, inhibiting rate of the measurement sample to Cycloxygenase (COX).
In a particular embodiment, the detection method includes the following steps:
A Chinese medicine composition sample solution and/or reference substance solution) are prepared；
B sample solution and reference substance solution) are measured to the inhibiting rate of COX-2 enzyme activity；
C) using COX-2 enzyme activity inhibiting rate as index, potency and Reliable limit rate are calculated；
Wherein, step B measures sample solution and enzyme immunoassay can be used to the inhibiting rate of COX-2 enzyme activity in reference substance solution
Etc. being measured.
As preferred embodiment, inhibiting rate can be measured as follows:
A) COX-2 enzyme is added into solution to be measured, cultivates certain time；
B) ADHP and AA is added into solution to be measured；
C) it develops the color, fluorescence intensity；
D) inhibiting rate is calculated as follows,
Inhibiting rate %=(fluorescence intensity-sample to be tested fluorescence intensity of initial activity sample)/initial activity sample
Fluorescence intensity × 100%.
Preferably, COX-2 enzyme dosage is 500U/mL~1000U/mL in step a；
Preferably, AA passes through purifying in step b；
Preferably, fluorescence intensity is detected at excitation wavelength 530-540nm, launch wavelength 585-595nm in step c.
In a particular embodiment, reference substance described in step A is selected from conventional antiinflammatory drug, such as celecoxib, Rofe
Former times cloth (refocoxib), or it is used as the traditional chinese medicine composition of the invention of reference substance.The preparation method of the reference substance solution
Include: to take reference substance, is extracted added with solvent, extracting solution is reference substance solution；Preferably, the reference substance solution concentration is
1×105U/mL~2 × 105U/mL；It is furthermore preferred that the reference substance solution concentration is 1.2 × 105U/mL。
The preparation method of Chinese medicine composition sample solution described in step A includes: to take Chinese medicine composition, is mentioned added with solvent
It takes, extracting solution is reference substance solution；Preferably, the sample solution concentration is 1 × 105U/mL~2 × 105U/mL；More preferably
, the sample solution concentration is 1.2 × 105U/mL。
Wherein, the organic solvent is selected from dimethyl sulfoxide (DMSO), methanol, ethyl alcohol etc.；The extracting method is selected from super
Sound extraction, refluxing extraction, any one in Microwave Extraction.
" potency " described in step C is with " Reliable limit rate " by " qualitative response is parallel in " drug biological standardization " (Zhou Haijun chief editor)
Collimation method " calculates；500U μ g must not be lower than by inhibiting the potency of COX-2 enzyme activity-1, average Reliable limit rate is less than 25%.
Chinese medicine composition of the present invention is made of the following raw material medicine:
Fructus Forsythiae 200-300 parts by weight, ephedra 50-100 parts by weight, fry semen armeniacae amarae 50- at honeysuckle 200-300 parts by weight
100 parts by weight, gypsum 200-300 parts by weight, Radix Isatidis 200-300 parts by weight, thick wood-fern rhizome 200-300 parts by weight, cordate houttuynia
200-300 parts by weight, Pogostemon cablin 50-100 parts by weight, rheum officinale 30-80 parts by weight, root of kirilow rhodiola 50-100 parts by weight, menthol 5-
10 parts by weight, Radix Glycyrrhizae 50-100 parts by weight.
Preferably, the Chinese medicine composition is made of the following raw material medicine:
Fructus Forsythiae 210-270 parts by weight, ephedra 60-90 parts by weight, fry semen armeniacae amarae 60-90 at honeysuckle 210-270 parts by weight
Parts by weight, gypsum 210-270 parts by weight, Radix Isatidis 210-270 parts by weight, thick wood-fern rhizome 210-270 parts by weight, cordate houttuynia 210-
270 parts by weight, Pogostemon cablin 60-90 parts by weight, rheum officinale 40-60 parts by weight, root of kirilow rhodiola 60-90 parts by weight, menthol 6-8 weight
Part, Radix Glycyrrhizae 60-90 parts by weight.
More there is choosing, the Chinese medicine composition is made of the following raw material medicine:
255 parts by weight of Fructus Forsythiae, 85 parts by weight of ephedra, fry 85 parts by weight of semen armeniacae amarae, gypsum 255 at 255 parts by weight of honeysuckle
Parts by weight, 255 parts by weight of Radix Isatidis, 255 parts by weight of thick wood-fern rhizome, 255 parts by weight of cordate houttuynia, 85 parts by weight of Pogostemon cablin, rheum officinale
51 parts by weight, 85 parts by weight of root of kirilow rhodiola, 7.5 parts by weight of menthol, 85 parts by weight of Radix Glycyrrhizae.
The preparation method of the Chinese medicine composition: above 13 taste, Pogostemon cablin add water to distill extract volatile oil, and collection is waved
Hair oil, aqueous extract filtration are spare；Fructus Forsythiae, ephedra, cordate houttuynia, rheum officinale extract secondary, 2 hours first times with 70% ethyl alcohol,
Second 1.5 hours, extracting solution filtration merged, and recycles ethyl alcohol, spare；Honeysuckle, gypsum, Radix Isatidis, thick wood-fern rhizome, Radix Glycyrrhizae,
Root of kirilow rhodiola is added water to cook to boiling, is added and is fried semen armeniacae amarae, is decocted secondary, 1.5 hours first times, second 1 hour, decocting liquid filtration,
Filtrate merges, and Pogostemon cablin is added and mentions spare aqueous solution after oil, and being concentrated into relative concentration is 1.10~1.15 (60 DEG C), adds ethyl alcohol
Make alcohol content up to 70%, is refrigerated 24 hours at 4 DEG C, filtration, filtrate recycling ethanol, the spare alcohol extracting with four tastes such as above-mentioned Fructus Forsythiae
Liquid merges, and being concentrated into relative density is 1.10~1.15 (60 DEG C), and spray drying mixes with appropriate amount of starch, particle is made, and does
Dry, sieving sifts out appropriate fine powder, menthol, Herba Pogostemonis Volatile oil is dissolved with ethanol in proper amount, sprays into fine powder, mixes, and upper
State particle mixing, closed 30 minutes, be packed into capsule, be made 1000 to get.
The principle of detection method is based on fluorescence method, under COX-2 effect, before arachidonic acid (AA) is changed into
Column parathyrine endoperoxide (PGG2) is catalyzed PGG2 and ADHP (10-Acetyl-3, the 7- of generation
Dihydroxyphenoxazine it reacts between) and generates fluorescent material resorufin.Fluorescence is generated at a particular wavelength, is passed through
The fluorescence intensity for detecting resorufin can embody the size of COX-2 enzyme activity, and then evaluate the work of Drug inhibition COX-2 to be measured
Property (see Fig. 1).
Beneficial effects of the present invention:
1, the present invention is based on the prediction of network pharmacology, the analysis of the verifying of transcription group and whole animal metabolism group,
Establishing COX-2 is the quality biomass activity rating method that anti-inflammatory index of biological activity establishes Chinese medicine composition；
2, the present invention is using COX-2 enzyme activity as index, has rated Chinese medicine composition to the inhibiting effect of COX-2 enzyme activity,
The anti-inflammatory biological assessment method for establishing a kind of enzyme level of combination clinical indication, by methodological study, the biological assessment
Method precision is higher, repeatability preferably, RSD value control within 10%, compared with cellular level anti-inflammatory biological value method more
Stablize；
3, biological evaluation is carried out to Chinese medicine composition using this method, finds the biology of inhibition COX-2 between its batch
There is also certain differences for potency, and from the point of view of 40 batch commercial samples, biological value range is in 510U/ μ g~1413U/ μ g
Between, average organism potency is 856U/ μ g.The homemade destructive sample in laboratory inhibit the biological value of COX-2 enzyme activity compared with
Normal qualified samples are substantially reduced, and prompt this method that can also distinguish the sample of different quality；
4, the method for the present invention makes up the deficiency of the single index's quality evaluation method of chemistry, provides for the Chinese medicinal composition preparation
The detection method of power more on evidence；
5, the method for the present invention can be applied not only to the quality evaluation of Chinese medicine composition of the present invention, can be used for it
He has Chinese medicine and the quality evaluation of Chinese medicine compound prescription of anti-inflammatory activity, has universality.
Detailed description of the invention
Fig. 1 is COX-2 Activity determination principle；
Fig. 2 is inhibiting effect of the various concentration Chinese medicine composition to COX-2 enzyme activity
1 Chinese medicine composition of experimental example is to the protective effect of H1N1 influenza infection mouse and the verifying of biological assessment index
1. experimental material
1.1 laboratory apparatus
LEICA DM3000 inverted microscope (German Leica company)；D3024R desk type high speed frozen type microcentrifuge
(DragonLab)；SIGMAJ-26 refrigerated centrifuge (German SIGMA company)；AL201 electronic balance (Mei Tele-support benefit instrument
Device (Shanghai) Co., Ltd.)；The split type paraffin wax embedding of the manual rotary microtome, EG1150H (Germany of the automatically controlled sample introduction of RM2245
Leica company)；S1000Thermal Cycler PCR instrument (BIO-RAD company)；JY-1000M type electric heating constant temperature forced air drying
Case (Wujiang Zhi Sheng oven equipment factory)；Stepone plus fluorescence quantitative PCR instrument (American AB I company)；SW-CJ-1FD is ultra-clean
Workbench (the safe and sound company of Su Jing)；NanoDrop2000 ultramicrospectrophotometer (Thermo company, the U.S.).
1.2 drugs and reagent
Chinese medicinal composition capsules agent (preparation of embodiment 1)；PBS is purchased from Gibco company；4% paraformaldehyde solution is purchased from
GBCBIO company；Dimethylbenzene is purchased from Guangzhou Chemical Reagent Factory；Haematoxylin dyestuff, Yihong dyestuff, which are purchased from Zhuhai shellfish rope biotechnology, to be had
Limit company；IL-6, COX-2, GAPDH primer are purchased from Life company, the U.S.；TRizol Reagent is purchased from life company (lot number
15596-026), DEPC handles water and is purchased from Solarbio (lot number R1600)；CDNASynthesis SuperMix is purchased from
Novoprotein company (lot number E044-01B)；Chloroform, isopropanol, dehydrated alcohol, which are purchased from Chinese medicines group chemical reagent, to be had
Limit company (lot number 10006818,80109218,10009218)；First chain cDNA synthetic agent box is purchased from Thermo company, the U.S.
(lot number #K1622)；FastStart Universal SYBRGreen Master (Rox) is purchased from Roche company, the U.S. (lot number
04913914001)。
1.3 animal
BALB/c mouse, female, 6-8 week old, cleaning grade, weight 18-20g, Guangdong Province's Experimental Animal Center, the quality certification
Number: [SCXK (Guangdong) 2003-0002].The raising of IVC cage tool, free water feeding, 25 ± 2 DEG C of room temperature, humidity 60-70%, setting
12 hours light/dark circulations in interior, are raised with standard chow and water, keep cage tool, the sanitation and hygiene of tableware and environment, keep room
Interior peace and quiet.All animals are preparatory adaptive feeding 7 days before experiment, and all mouse are all by scrupulous care in experiment.It is moved
The approval of the object Experimental Ethical committee.
1.4 viruses and cell strain
PR8 plants of Influenza A1 virus (A/PR/8/34, H1N1), it is purchased from American classic culture collecting center (ATCC).
9-11 age in days chick embryo allantoic cavity is inoculated with when use, 37 DEG C are cultivated 3 days, and it is spare (blood clotting survey potency) to collect allantoic fluid.According to Reed-
The method of Muench is in mouse assay LD50(50% lethal dose).(Madin Darby Canine Kidney, dog kidney are thin by MDCK
Born of the same parents) cell be purchased from Chinese Academy of Sciences's consonance cell bank.
2. experimental method
Median lethal dose (the LD of 2.1 measurement mouse infection viruses50)
BALB/c mouse 50,6-8 week old is female, and stochastic averagina is divided into 5 groups, carries out 10 times with sterilizing PBS and is serially diluted
Viral (A/PR/8/34, H1N1) is 10-2,10-3,10-4,10-5,10-6 totally 5 dilutions.Mouse is through ether light anesthesia
Afterwards, with collunarium approach infecting mouse, every 50 μ L of mouse infection is observed 15 days, and the virus liquid infection for recording different dilutions is small
The survival and death condition of mouse.Virus is calculated to the median lethal dose LD of mouse according to the method for Reed-Muench50。
2.2 zooperies grouping and administration
Mouse is randomly divided into 5 groups, every group 15.Respectively normal group (Normal), model group (Model), Ao Sita
High dose group (1300mg/kg/day), low dose group is administered in Wei group (Oseltamivir) (60mg/kg/day), Chinese medicine composition
(650mg/kg/day).The breathing anesthesia of mouse either shallow, 2 LD of model group50H1N1 viral dilution, with collunarium approach sense
Dye, every 50 μ L of mouse；Blank group instills sterile PBS with method.The infection same day was administered in infection first 2 hours, and successive administration 5 days.
Every gastric infusion 0.2mL of Oseltamivir group and Chinese medicine composition high and low dose group is spaced 8 hours and is administered 2 times a day, blank
Group and model group are the same as canonical physiological saline.
The measurement of IL-6 and COX-2mRNA expression in 2.3 lung tissues
2.3.1 in lung tissue total serum IgE extraction
Each group mouse lung tissue 100mg is weighed, Trizol 1mL, 15000rpm is added, each 10s is homogenized three times.
Homogenate is completed to extract RNA by Trizol method.OD260/OD280 is between 1.8~2.0 for RNA purity.For subsequent experimental.
2.3.2PCR reaction system and program
PCR reaction system: 1211 μ L, Reaction Buffer of μ L, Rt of μ L, Ri of μ L, 10 × dNTP of Primer, 4 μ
L；It adjusts to Template RNA and DEPC the water totally 11 μ L of same concentrations.Total 20μL.Reverse transcription reacts item at cDNA
Part: 25 DEG C of 5min, 42 DEG C of 60min, 70 DEG C of 5min.
PCR response procedures: after the completion of reverse transcription, 5 times are diluted with DEPC water.1 μ l of sample, 9 μ l of premixed liquid is added in every hole
(4 1 μ L, R1 μ L, DEPC water of μ L, F of SYBRGreen, 3 μ L), overlay film, upper machine testing after centrifugation.Detection program: 95 DEG C of initial denaturation
10min recycles 40 95 DEG C of 15s → 60 DEG C 60s, and 75 DEG C → 95 DEG C of solubility curve, every 20s heats up 1 DEG C.
PCR primer sequence is shown in Table 1.
1 PCR primer sequence of table
| Gene | F | R |
| IL-6 | GCTACCAAACTGGATATAATCAGGA | CCAGGTAGCTATGGTACTCCAGAA |
| COX-2 | CCCTGCTGGTGGAAAAGCCTGGTCC | TACTGTAGGGTTAATGTCATCTAG |
| GAPDH | GTCCTCAGTGTAGCCCAAGAT | CAATGTGTCCGTCGTGGATCT |
2.4 statistical analysis
GraphPad Prism 6.0 and the processing of 9.2 software of OriginPro, t, which is examined, carries out statistical analysis, P < 0.05
It is statistically significant.Using GAPDH as internal reference, using 2-△△CtMethod carries out Relative gene expression analysis.
3. experimental result
The 5th day collection each group mouse lung tissue sample after each infection administration is tested, IL-6, COX-2 in lung tissue are extracted
Real-time quantitative PCR detection is carried out after RNA.The results are shown in Table 2, and Chinese medicine composition high and low dose group is to IL-6 and COX-2
The expression of mRNA has significant inhibiting effect (P < 0.01, P < 0.05), and has amount-result relation.
The influence that 2 Chinese medicine composition of table expresses IL-6, COX-2 mRNA in mouse lung tissue
* p < 0.01 p < 0.05, * * is compared with Model
The above result shows that normally the group mouse state of mind is good, to take action quicker, for hair compared with gloss, breathing is more uniform,
Body weight increase.For model group mouse after infection second day, breathing is uneven, rolls up, and hair alarms tarnish, and diet significantly reduces, disappears
It is thin.Illustrate that the H1N1 influenza virus mouse model is successful.After virus infection, mouse weight is begun to decline, and gives Ao Sita
Wei positive drug and Chinese medicine composition can reduce the amplitude of mouse weight reduction.Mouse lung virus load, Lung Exponent data and
Pathologic slice also indicates that Chinese medicine composition can effectively inhibit influenza virus in the intracorporal duplication of mouse, has obvious
Resist influenza virus cause pneumonia effect.
Using Real-time quantitative PCR, the mRNA expression of IL-6 and COX-2 in mouse lung tissue is determined, finds Chinese medicine
Composition can significantly reduce the expression of two kinds of genes in lung tissue, and have dose-dependence, from whole animal level verification
The reliability of the anti-inflammatory biological assessment index selection IL-6 and COX-2 of Chinese medicine composition.
Experimental example 2 is based on inhibiting the active Chinese medicine composition biological detecting method of COX-2
Based on the result of study of experimental example 1, determine that the mechanisms of anti-inflammatory of COX-2 and Chinese medicine composition is closely related, because
This establishes Chinese medicine composition biological assessment method as the index of Chinese medicine composition biological assessment.
1. experimental material
1.1 instruments and material
SynergyH2 global function micropore board detector (BioTek company, the U.S.)；Table model high speed centrifuge (U.S. Thermo
Company)；Micropipettor, multichannel pipettor (German Eppendorf company)；A ten thousandth electronic analytical balance (Mei Tele-support
Benefit instrument Shanghai Co., Ltd)；The constant temperature water tank of DK-600S tri- (the upper macro experimental facilities Co., Ltd of Nereid)；Vortex-2 vortex instruments (pacify invincible Science and Technology Ltd. in Shenzhen)；Centrifuge tube (Corning Incorporated).
1.2 drugs and reagent
DMSO is purchased from AMRESCO company, the U.S. (lot number 3304C252)；K547-100COX-2 inhibitor
Screening kit (F) is purchased from Biovision company, the U.S. (lot number 2F280547)；Chinese medicine composition is prepared by embodiment 1,
Totally 40 batches (number S01-S40)；Capsule 's content is respectively at high temperature (60 DEG C), high humidity (RH95%), illumination (4500lx)
Under the conditions of place 20d sample A1, A2, A3 (number S41-S43)；Celecoxib is purchased from aladdin company (lot number #
E1528116)。
2. experimental method
2.1 detecting step
Step 1: in 96 orifice plates, drug to be measured is added；COX-2 is added and is incubated for certain time, sends out drug and COX-2
It is raw to inhibit reaction；
Step 2: being separately added into ADHP and AA, the PGG2 combination ADHP generated using catalysis generates resorufin；
Step 3: developing the color, detected under excitation wavelength 530-540nm, launch wavelength 585-595nm glimmering to enzyme mark hole
Drug is calculated by formula to the inhibiting rate of COX-2 compared with blank and 100% active hole in luminous intensity；
Step 4: after inhibiting rate of the drug to COX-2 is carried out coordinate conversion, calculating potency and Reliable limit rate.
The preparation of 2.2 medical fluids
Assay buffer R (10 ×) is diluted 10 times with sterile ultrapure water, as the buffer after dilution；With dilution
Buffer afterwards is by 1: 10 dilution ferroheme (Heme), COX-2 (operating on ice), ADHP (with preceding preparation)；It is dilute by 1: 1 with KOH
AA is released, is diluted to 2mM by 1: 5 with sterile ultrapure water again after vortex.
It is a certain amount of that precision weighs celecoxib, and DMSO is added to dissolve ultrasonic extraction 10min, and 0.45 μm of membrane filtration adds DMSO
It is diluted to the mother liquor of 0.45 μ g/mL, sets in 4 DEG C of refrigerators and saves backup, the used time is diluted to required concentration.
Precision weighs that Chinese medicine composition is a certain amount of, and DMSO dissolution is added to be made into the mother liquor of 1mg/mL, ultrasonic extraction 10min,
12000rpm/min is centrifuged 10min, takes supernatant spare.Used time is diluted to required concentration.
The measurement of 2.3COX-2 inhibiting rate
Experimental setup background group (Background), 100% initial activity group (100%Initial of COX-2
Activity), Pharmacological inhibitors group (Inhibitor).In 96 orifice plates, 150 μ L are added in the hole 100%Initial Activity
Reaction buffer, 10 μ L ferrohemes, 10 μ L COX-2 and 10 μ L solvents；The hole Background be added 160 μ L reaction buffers,
10 μ L ferrohemes and 10 μ L solvents；Be added in Inhibitor 150 μ L reaction buffers, 10 μ L ferrohemes, 10 μ L COX-2 and
The inhibitor of 10 μ L various concentrations.It is incubated at room temperature 10min；The ADPH of 10 μ L is added in each hole；Each hole is rapidly added arachidonic acid
10 μ L are incubated at room temperature 5 minutes with starting to react.It is put into microplate reader, excitation wavelength 530-540nm, launch wavelength 585-595nm
Lower fluorescence intensity.
The fluorescence intensity of 100% initial activity sample and inhibitor sample needs the fluorescence intensity of background correction.To deduct
The fluorescence intensity (Initial Activity) of 100% initial activity sample of background subtracts the fluorescence intensity of each inhibitor sample
(Sample Activity), then sample is obtained to the inhibiting rate of COX-2 multiplied by 100 divided by Initial Activity
(Inhibition%), calculation formula is as follows.
Inhibiting rate %=(Initial Activity-Sample Activity)/Initial Activity × 100%
2.4 Chinese medicine composition estimation of biological potency
It is dense by 1: 0.5 doubling dilution 4 as standard control substance and Chinese medicine composition object of reference (S40) using celecoxib
Degree, multiple 3 holes measure the inhibiting rate to COX-2 respectively, define Chinese medicine composition object of reference (S40) original titer and are assigned a value of 1000U/
μg.The sample of other different batches is test sample group, is calculated according to the principle of simple probability per unit system and inhibits the active effect of COX-2
Valence (PT) and Reliable limit rate (FL%).
3. experimental result
3.1 reagent A A are before purification afterwards on the active influence of Drug inhibition COX-2
According to above-mentioned experimental method, the fluorescence intensity in each concentration celecoxib hole is measured, investigates AA before purification afterwards to measurement
As a result influence.
The result shows that the fluorescence background value that before purification, detects of AA is 317, and having inhibiting rate is more than 100% to show
As；And it is 50 or less that (purity > 95%) background value, which is remarkably decreased, after purification.The IC50 of celecoxib is 2.5 μM after purification.Cause
This, needs to select AA after purification as detection reagent in experimentation.
3.2COX-2 enzyme dosage is on the active influence of Drug inhibition COX-2
According to above-mentioned experimental method, selects the COX-2 enzyme amount of 500U/mL and 1000U/mL for reacting, measure Chinese medicine group
Object is closed to the biological value of COX-2 inhibitory activity.The result shows that different enzyme amount are to the active biological value of Drug inhibition COX-2
Influence is smaller, and from a cost perspective, enzyme dosage is selected as 500U/mL.
Inhibiting effect of 3.3 Chinese medicine compositions to COX-2 enzyme activity
The Chinese medicine composition test solution of preparation is investigated into Chinese medicine group by the fluorescence intensity of 2.2.4 method measurement each group
Object is closed to the inhibiting effect of COX-2 enzyme activity, as a result sees Fig. 2.
The result shows that each administration group of Chinese medicine composition be remarkably decreased than the fluorescence intensity of 100% initial activity group (P <
0.01), show that Chinese medicine composition has significant inhibiting effect to COX-2 enzyme activity, and there is concentration-dependent relation.
3.4 methodological study results
3.4.1 precision is investigated
It takes with a same concentrations (60 μ gmL-1) Chinese medicine composition solution, measure according to the above method, measurement 6 times its
To the inhibiting effect of COX-2, calculating Chinese medicine composition COX-2 vigor average inhibition is 67.23%, RSD 5.14%, method
Withinday precision is good.
The Chinese medicine composition solution of same lot number same concentrations is taken, totally 6 parts, in the 1st day to the 6th day, is surveyed according to the above method
Its fixed inhibiting effect to COX-2, calculating Chinese medicine composition COX-2 vigor average inhibition are 64.73%, RSD 8.56%,
Method day to day precision is good.
3.4.2 repeatability is investigated
Same 6 parts of lot number Chinese medicine composition sample (S40) is taken, test solution is made, measures according to the above method, in calculating
Drug composition COX-2 vigor average inhibition is 70.48%, RSD 9.32%.
To sum up, precision is high, reproducible, meets the requirement of biological assessment method, can be used for biological assessment.
The biological value mark of 3.5 Chinese medicine composition objects of reference
Using the method for above-mentioned foundation, using celecoxib as control substance of plant drug, according to " qualitative response parallel method " to Chinese medicine group
The valence value for closing the inhibition COX-2 enzymatic activity of object object of reference is standardized.Define Chinese medicine composition object of reference biological value be
1000U·μg-1, detect the potency of celecoxib.It the results are shown in Table 3.
The conversion of the potency of 3 Chinese medicine composition object of reference of table and celecoxib
After inhibiting rate and corresponding administration concentration are carried out coordinate conversion, input potency software for calculation calculates potency, calculates knot
Fruit is the celecoxib for functioning as 3.805ng of 1U Chinese medicine composition object of reference.
3.6 Chinese medicine compositions inhibit the active estimation of biological potency of COX-2
Inhibit COX-2 enzyme activity force value to be measured Chinese medicine composition test sample according to above-mentioned detection method, is calculated
Each batch Chinese medicine composition is to the inhibiting rate of COX-2 enzyme activity, using S40 as marker, by inhibiting rate and is accordingly administered dense
After degree carries out coordinate conversion, input potency software for calculation obtains the potency that each batch Chinese medicine composition inhibits COX-2 enzyme activity,
Measurement result is shown in Table 4.
4 Chinese medicine composition of table inhibits COX-2 titration result
Measurement result shows that it is 510U/ μ g~1413U/ μ that the Chinese medicine composition of different batches, which inhibits COX-2 activity potency,
G, average organism potency are 856U/ μ g.There is some difference for the inhibition COX-2 potency of Chinese medicine composition different batches, S26 sample
The potency highest of product, the potency of S05 sample is minimum, and improper test sample measurement result is compared between normal specimens under potency
Drop has notable difference, wherein inhibiting the sequence of COX-2 activity potency decline is high humidity > high temperature > illumination.
The evaluation of 3 Chinese medicine composition quality chemistry of experimental example and biological assessment correlation analysis
It is (chlorogenic acid, rutin, forsythiaside A, Forsythoside, 4,5-Dicaffeoylquinic acid, different with 9 kinds of chemical components in Chinese medicine composition
Chlorogenic acid B, caffeic acid, menthol, patchouli alcohol) content's index be independent variable, biological value is dependent variable, to 40 batch Chinese medicines
Composition is statistical analysis sample, investigates and inhibits COX-2 biological value, inhibits macrophages secrete IL-6 biological value and 9 kinds
The correlation analysis of chemical composition content measurement result is calculated using multivariate statistics SPSS statistical software.
It the results are shown in Table 5.
The correlation analysis of table 5 bioactivity and chemical composition content
From the point of view of inhibiting the active anti-inflammatory biological value of COX-2, there are the ingredient of correlation be chlorogenic acid, 3,4-Dicaffeoylquinic acid,
The acrylic components such as 4,5-Dicaffeoylquinic acid, and to be positively correlated (p < 0.05), it prompts the content of this 3 kinds of ingredients higher, inhibits COX-2 enzyme
The level of vigor also has the tendency that increasing.Therefore, be considered as increasing when chemical component is accused this kind of active index of association at
The detection divided, that improves the consistency of Chinese traditional medicine composition amount of substance to a certain extent comments control ability.
It is Fructus Forsythiae there are the ingredient of correlation from the point of view of inhibiting the active anti-inflammatory biological value of macrophages secrete IL-6
Glycosides, and to be positively correlated (p < 0.05), it prompts the content of forsythin ingredient higher, the level of cell secretion IL-6 is inhibited also to have increasing
High trend.Prompt, forsythin are the effective component for playing anti-inflammatory effect, and content has centainly Chinese medicine composition quality
It influences.
Specific embodiment
Embodiment 1
Prescription: Fructus Forsythiae 255g, honeysuckle 255g, ephedra 85g, semen armeniacae amarae 85g, gypsum 255g, Radix Isatidis 255g, silk floss are fried
Horse rhizome of cyrtomium 255g, cordate houttuynia 255g, Pogostemon cablin 85g, rheum officinale 51g, root of kirilow rhodiola 85g, menthol 7.5g, Radix Glycyrrhizae 85g；
Preparation method: above 13 taste, Pogostemon cablin add water distillating extracting oil, collect volatile oil, and aqueous extract filters,
It is spare；Fructus Forsythiae, ephedra, cordate houttuynia, rheum officinale are extracted secondary, 2 hours first times with 70% ethyl alcohol, second 1.5 hours, are extracted
Liquid filtration, merges, recycling ethyl alcohol, spare；Honeysuckle, gypsum, Radix Isatidis, thick wood-fern rhizome, Radix Glycyrrhizae, root of kirilow rhodiola add water to cook to
Boiling is added and fries semen armeniacae amarae, decocts secondary, 1.5 hours first times, second 1 hour, and decocting liquid filtration, filtrate merges, and the wide leaves of pulse plants is added
Perfume (or spice) mentions spare aqueous solution after oil, and being concentrated into relative density is 1.10~1.15 (60 DEG C), adds ethyl alcohol to make alcohol content 70%, 4
DEG C refrigeration 24 hours, filtration, filtrate recycling ethanol merged with the spare alcohol extract of four tastes such as above-mentioned Fructus Forsythiae, is concentrated into relatively
Close is 1.15~1.20 (60 DEG C), and spray drying mixes with appropriate amount of starch, particle is made, dry, and appropriate fine powder is sifted out in sieving,
Menthol, Herba Pogostemonis Volatile oil are dissolved with ethanol in proper amount, sprayed into fine powder, is mixed, is mixed with above-mentioned particle, closed 30 points
Clock, be packed into capsule, be made 1000 to get.
Biological detecting method:
The preparation of reference substance: precision weighs Chinese medicine composition work object of reference (with celecoxib chemistry sterling mark potency
1000U·μg-1), it is finely ground, add DMSO ultrasonic extraction 30min, 10000r/min to be centrifuged 10min, take supernatant that every 1ml is made and contain
1.2×105The solution of U to get.
The preparation of test sample: taking Chinese medicine composition content appropriate, finely ground, adds DMSO ultrasonic extraction 30min, 10000r/
Min is centrifuged 10min, takes supernatant, faces and every 1ml is made containing 1.2 × 10 with by estimation potency5The solution of U to get.
Measuring method: take reference substance solution and test solution by thinner ratio between 1:0.8~1:0.5, by experimental example 2
Inhibiting rate is measured under " 2.1 detecting step " item, using the inhibiting rate of COX-2 enzyme activity as index, by " drug biological standardization " (week
Hai Jun chief editor) in " qualitative response parallel method " calculate potency and Reliable limit rate.Inhibiting the potency of COX-2 enzyme activity must not be lower than
500U·μg-1, average Reliable limit rate is less than 25%.
Embodiment 2
Biological detecting method:
The preparation of reference substance: precision weighs Chinese medicine composition work object of reference (rofecoxib chemistry sterling mark potency
1000U·μg-1), it is finely ground, add methanol solution ultrasonic extraction 30min, 10000r/min to be centrifuged 10min, supernatant is taken to be made often
1ml contains 1.2 × 105The solution of U to get.
The preparation of test sample: taking Chinese medicine composition content appropriate, finely ground, adds DMSO ultrasonic extraction 30min, 10000r/
Min is centrifuged 10min, takes supernatant, faces and every 1ml is made containing 1.2 × 10 with by estimation potency5The solution of U to get.
Measuring method: take reference substance solution and test solution by thinner ratio between 1:0.8~1:0.5, by commercially available COX-2
The operation of fluorescence detection reagent kit (the green skies Bioisystech Co., Ltd in Shanghai) specification, measures inhibiting rate, with COX-2 enzyme activity
Inhibiting rate as index, by " qualitative response parallel method " calculating potency in " drug biological standardization " (Zhou Haijun chief editor) and credible
Limit rate.500U μ g must not be lower than by inhibiting the potency of COX-2 enzyme activity-1, average Reliable limit rate is less than 25%.
Embodiment 3
Biological detecting method:
The preparation of reference substance: precision weighs Chinese medicine composition work object of reference (celecoxib chemistry sterling mark potency
1000U·μg-1), it is finely ground, add ethanol solution ultrasonic extraction 30min, 10000r/min to be centrifuged 10min, supernatant is taken to be made often
1ml contains 1.2 × 105The solution of U to get.
The preparation of test sample: taking Chinese medicine composition content appropriate, finely ground, adds DMSO ultrasonic extraction 30min, 10000r/
Min is centrifuged 10min, takes supernatant, faces and every 1ml is made containing 1.2 × 10 with by estimation potency5The solution of U to get.
Measuring method: take reference substance solution and test solution by thinner ratio between 1:0.8~1:0.5, by experimental example 2
Inhibiting rate is measured under " 2.1 detecting step " item, using the inhibiting rate of COX-2 enzyme activity as index, by " drug biological standardization " (week
Hai Jun chief editor) in " qualitative response parallel method " calculate potency and Reliable limit rate.Inhibiting the potency of COX-2 enzyme activity must not be lower than
500U·μg-1, average Reliable limit rate is less than 25%.
Embodiment 4
Biological detecting method:
The preparation of reference substance: precision weighs Chinese medicine composition work object of reference (rofecoxib chemistry sterling mark potency
1000U μ g-1), it is finely ground, add DMSO ultrasonic extraction 30min, 10000r/min to be centrifuged 10min, take supernatant that every 1ml is made and contain
The solution of 1.2 × 105U to get.
The preparation of test sample: taking Chinese medicine composition content appropriate, finely ground, adds DMSO ultrasonic extraction 30min, 10000r/
Min is centrifuged 10min, takes supernatant, faces and every 1ml is made containing 1.2 × 10 with by estimation potency5The solution of U to get.
Measuring method: taking reference substance solution and test solution by thinner ratio between 1:0.8~1:0.5, by " radiation enzyme is exempted from
Epidemic disease method " determines inhibiting rate, using the inhibiting rate of COX-2 enzyme activity as index, by (three) the biology inspections of version " Chinese Pharmacopoeia " in 2015
Determine qualitative response parallel method under statistic law item and calculates potency and Reliable limit rate.Inhibiting the potency of COX-2 enzyme activity must not be lower than
500U·μg-1, average Reliable limit rate is less than 25%.
Claims (10)
1. a kind of detection method of Chinese medicine composition, which is characterized in that the described method includes: Chinese medicine composition is prepared as to examine
The sample of survey is contacted with Cycloxygenase (COX), inhibiting rate of the measurement sample to Cycloxygenase (COX)；
Wherein, the Chinese medicine composition is made of the following raw material medicine:
Fructus Forsythiae 200-300 parts by weight, ephedra 50-100 parts by weight, fry semen armeniacae amarae 50-100 weight at honeysuckle 200-300 parts by weight
Measure part, gypsum 200-300 parts by weight, Radix Isatidis 200-300 parts by weight, thick wood-fern rhizome 200-300 parts by weight, cordate houttuynia 200-
300 parts by weight, Pogostemon cablin 50-100 parts by weight, rheum officinale 30-80 parts by weight, root of kirilow rhodiola 50-100 parts by weight, menthol 5-10 weight
Measure part, Radix Glycyrrhizae 50-100 parts by weight.
2. detection method as described in claim 1, which is characterized in that the detection method includes the following steps:
A Chinese medicine composition sample solution and/or reference substance solution) are prepared；
B sample solution and reference substance solution) are measured to the inhibiting rate of COX-2 enzyme activity.
3. detection method as claimed in claim 2, which is characterized in that the measuring method of the inhibiting rate of the COX-2 enzyme activity
Include the following steps:
A) COX-2 enzyme is added into solution to be measured, cultivates certain time；
B) ADHP and arachidonic acid are added into solution to be measured；
C) it develops the color, fluorescence intensity；
D) inhibiting rate is calculated as follows,
The fluorescence of inhibiting rate %=(fluorescence intensity-sample to be tested fluorescence intensity of initial activity sample)/initial activity sample
Intensity × 100%.
4. detection method as claimed in claim 3, which is characterized in that in step a COX-2 enzyme dosage be 500U/mL~
1000U/mL。
5. detection method as claimed in claim 3, which is characterized in that AA is by purifying in step b.
6. detection method as claimed in claim 3, which is characterized in that fluorescence intensity is in excitation wavelength 530- in step c
It is detected under 540nm, launch wavelength 585-595nm.
7. detection method as claimed in claim 2, which is characterized in that reference substance described in step A is selected from conventional antiinflammatory drug
Or it is used as the traditional chinese medicine composition of the invention of reference substance.
8. detection method as claimed in claim 7, which is characterized in that the reference substance is celecoxib or rofecoxib.
9. detection method as claimed in claim 8, which is characterized in that the reference substance solution concentration is 1 × 105U/mL~2 ×
105U/mL；Preferably, the reference substance solution concentration is 1.2 × 105U/mL。
10. detection method as claimed in claim 2, it is characterised in that the method comprising the steps of C: with the inhibition of COX-2 enzyme activity
Rate is index, calculates potency and Reliable limit rate；Chinese medicine composition inhibits the potency of COX-2 enzyme activity that must not be lower than 500U μ g-1,
Average Reliable limit rate is less than 25%.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711268953.6A CN109870432A (en) | 2017-12-05 | 2017-12-05 | One kind is based on the inhibition active detection method of Chinese medicine composition of COX-2 |
| PCT/CN2018/114831 WO2019109779A1 (en) | 2017-12-05 | 2018-11-09 | Detection method for chinese medicine composition based on inhibition of cox-2 activity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711268953.6A CN109870432A (en) | 2017-12-05 | 2017-12-05 | One kind is based on the inhibition active detection method of Chinese medicine composition of COX-2 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109870432A true CN109870432A (en) | 2019-06-11 |
Family
ID=66750050
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711268953.6A Pending CN109870432A (en) | 2017-12-05 | 2017-12-05 | One kind is based on the inhibition active detection method of Chinese medicine composition of COX-2 |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN109870432A (en) |
| WO (1) | WO2019109779A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110531076A (en) * | 2019-07-19 | 2019-12-03 | 江苏康缘药业股份有限公司 | A method of COX-2 enzymatic activity in detection medicine analgesic evaluation procedure |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101683424A (en) * | 2008-09-26 | 2010-03-31 | 北京以岭药业有限公司 | Application of Chinese medicine composition in preparation of medicament for treating tonsillitis |
| CN102379957A (en) * | 2010-09-03 | 2012-03-21 | 北京以岭药业有限公司 | TCM composition applied to preparation of medication for treating herpes zoster |
| CN103251725A (en) * | 2012-02-15 | 2013-08-21 | 北京以岭药业有限公司 | Application of Chinese medicinal composition in preparation of drugs treating keratitis |
| CN105543328A (en) * | 2014-10-30 | 2016-05-04 | 周亚伟 | Anti-rheumatism traditional Chinese medicine quality evaluation method based on bioavailability |
-
2017
- 2017-12-05 CN CN201711268953.6A patent/CN109870432A/en active Pending
-
2018
- 2018-11-09 WO PCT/CN2018/114831 patent/WO2019109779A1/en active Application Filing
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101683424A (en) * | 2008-09-26 | 2010-03-31 | 北京以岭药业有限公司 | Application of Chinese medicine composition in preparation of medicament for treating tonsillitis |
| CN102379957A (en) * | 2010-09-03 | 2012-03-21 | 北京以岭药业有限公司 | TCM composition applied to preparation of medication for treating herpes zoster |
| CN103251725A (en) * | 2012-02-15 | 2013-08-21 | 北京以岭药业有限公司 | Application of Chinese medicinal composition in preparation of drugs treating keratitis |
| CN105543328A (en) * | 2014-10-30 | 2016-05-04 | 周亚伟 | Anti-rheumatism traditional Chinese medicine quality evaluation method based on bioavailability |
Non-Patent Citations (1)
| Title |
|---|
| CAYMAN CHEMICAL COMPANY: "COX Fluorescent Inhibitor Screening Assay Kit Item No.700100", 《HTTP://WWW.INTERCHIM.FR/FT/V/VY0780.PDF》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110531076A (en) * | 2019-07-19 | 2019-12-03 | 江苏康缘药业股份有限公司 | A method of COX-2 enzymatic activity in detection medicine analgesic evaluation procedure |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2019109779A1 (en) | 2019-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wu et al. | Scientific and regulatory approach to botanical drug development: a US FDA perspective | |
| Mariswamy et al. | Chromatographic finger print analysis of steroids in Aerva lanata L by HPTLC technique | |
| Booker et al. | St John's wort (Hypericum perforatum) products–an assessment of their authenticity and quality | |
| Santana de Oliveira et al. | Extraction yield, chemical composition, preliminary toxicity of bignonia nocturna (bignoniaceae) essential oil and in silico evaluation of the interaction | |
| Markowitz et al. | Limitations of in vitro assessments of the drug interaction potential of botanical supplements | |
| Dog et al. | Assessing safety of herbal products for menopausal complaints: An international perspective | |
| Butterweck et al. | Potential of pharmacokinetic profiling for detecting herbal interactions with drugs | |
| Zonyane et al. | Geographic-based metabolomic variation and toxicity analysis of Sutherlandia frutescens LR Br.–An emerging medicinal crop in South Africa | |
| Zhang et al. | An anti-influenza virus activity-calibrated chemical standardization approach for quality evaluation of indigo naturalis | |
| CN109870432A (en) | One kind is based on the inhibition active detection method of Chinese medicine composition of COX-2 | |
| Liu et al. | Angelica keiskei water extract Mitigates Age-Associated Physiological Decline in Mice | |
| Abdulai et al. | Antimalarial activities of a therapeutic combination of Azadirachta indica, Mangifera indica and Morinda lucida leaves: a molecular view of its activity on Plasmodium falciparum proteins | |
| Folorunso et al. | Picralima nitida leaf extract ameliorates oxidative stress and modulates insulin signaling pathway in high fat-diet/STZ induced diabetic rats | |
| Zakłos-Szyda et al. | Cicer arietinum L. Sprouts’ Influence on Mineralization of Saos-2 and Migration of MCF-7 Cells | |
| Gou et al. | Anti‐Diabetic Effects and Molecular Mechanisms of Amide Alkaloids from Piper longum Based on Network Pharmacology Integrated with Cellular Assays | |
| Zhang et al. | From Tea to Health: Exploring Abrus mollis for Liver Protection and Unraveling Its Potential Mechanisms | |
| Li et al. | Characterization of chemical components and the potential anti-influenza mechanism of Fructus Arctii by a strategy integrating pharmacological evaluations, chemical profiling, serum pharmacochemistry, and network pharmacology | |
| CN109813879A (en) | A kind of biological detecting method of Chinese medicine composition | |
| RU2786440C1 (en) | Method for quantitative determination of the amount of flavonoids in nigerus grass | |
| Li et al. | Neuroprotective effects of polyphyllin VI against rotenone-induced toxicity in SH-SY5Y cells | |
| Rumpa et al. | TRPV1-Dependent Antiproliferative Activity of Dioecious Maclura pomifera Extracts in Estrogen Receptor-Positive Breast Cancer Cell Lines Involves Multiple Apoptotic Pathways | |
| Uçar | Polygonum aviculare L.'s biological Activities: Investigating its Anti-Proliferative, Antioxidant, chemical properties supported by molecular docking study | |
| Ali et al. | Habibullah; Quah, Y.; Lee, E | |
| Evanjelene et al. | Chemo and bioinformatics resources for in silico drug discovery from Acalypha hispida beyond their traditional use | |
| Mirza et al. | New technologies and interventions for the standardization of Unani drugs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190611 |