CN109852730A - Kit and detection method a kind of while that detect potent virus and bacterium - Google Patents
Kit and detection method a kind of while that detect potent virus and bacterium Download PDFInfo
- Publication number
- CN109852730A CN109852730A CN201910233229.2A CN201910233229A CN109852730A CN 109852730 A CN109852730 A CN 109852730A CN 201910233229 A CN201910233229 A CN 201910233229A CN 109852730 A CN109852730 A CN 109852730A
- Authority
- CN
- China
- Prior art keywords
- virus
- hemorrhagic fever
- kit
- brucella
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides kit and detection method a kind of while that detect potent virus and bacterium, mainly for four kinds of Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis pathogenic microorganisms.Kit of the invention includes the high stability positive quality control product of the specific primer probe combination for detecting Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis, the micro-fluidic Solid phase PCR chip that specific probe is fixed thereon and the resistance to RNase being made of the virus-like particle comprising viral nucleic acid and the thallus comprising carrying specific nucleic acid plasmid.Detection while kit of the invention realizes Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis, have many advantages, such as that detection flux height, high sensitivity, high specificity, reproducible, detection time is short, testing cost is low, operating technology requirement is low and not easy to pollute, has broad application prospects in multiple pathogenic microorganisms Fast synchronization detection field.
Description
Technical field
The present invention relates to viral diagnosis and technical field of molecular biology, and in particular to a kind of to detect ebola disease simultaneously
Poison, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis kit and detection method.
Background technique
Strong pathogenic microorganism can be divided into virus type, bacterium class, actinomyces, fungi, clothing according to its source of species difference
Substance, Richettsia and conveyor screw, wherein based on virus and bacterium class: virus type such as Ebola virus, xinjiang hemorrhagic fever disease
Malicious (crimean-Congo hemorrhagic fever virus) and zika virus etc.；Bacterium class such as primary gram of bacillus anthracis, brucella, glanders bacterium
With native La Refulangxisi bacterium etc..It is shown according to the World Health Organization (WHO) data, is passed caused by strong pathogenic microorganism
Infectious diseases are the important components of human morbidity and the death rate, are to threaten human health and cause the main of social fear
Factor.The fast parallel detection method for establishing a variety of strong pathogenic microorganisms is of great significance to epidemic prevention and control ability is promoted.
The detection method of traditional pathogenic microorganism mainly has colony identification based on microculture and based on specificity
The immunological method that antigen-antibody combines, these methods are not only complicated for operation, take a long time and (need could complete within 3-4 days), and
Sensitivity is lower, is unable to satisfy the requirement that highly pathogenic pathogenic microorganism quickly detects.Based on polymerase chain reaction (PCR) skill
The nucleic acid detection method of art has specific good, high sensitivity, fireballing advantage, and it is fast to be widely used in pathogenic microorganism
Speed detection.But regular-PCR is mainly in the detection of the same target spot of multiple samples, past when facing unknown source of infection sample
Toward needing to carry out screening to the multiple pathogenic microorganisms including including bacterium and virus simultaneously, PCR reaction needs completion more
A target spot detection.Traditional tubular type multiplex PCR is limited with fluorescence detection channel due to interfering with each other between primer and probe, once most
3-4 target gene can only be mostly expanded simultaneously.In recent years, the appearance of Solid phase PCR (Solid Phase PCR), solves difference
The problem that primer interferes with each other.Solid phase PCR is by fixed on a glass substrate by specific primer or probe, so that raw after amplification
At PCR product be anchored on chip, avoid and interfere between multiple PCR primer, meanwhile, increase flux and not by fluorescence detection
Channel limitation.Micro-fluidic chip is as novel micro-nano analytical technology platform, by sample involved in the fields such as biological and chemical
Preparation, separation and the basic operation units such as detection are integrated on one piece several square centimeters of chip, and there are a variety of monotechnicses to exist
The integrated feature and advantage of flexible combination, scale on whole controllable small platform.Micro-fluidic chip because its consume sample it is few, at
This low, simple operation and other advantages, has been applied in the pathogenic microorganism examination.
It there is no at present about strong pathogenic microorganism Ebola virus, xinjiang hemorrhagic fever virus, brucella and anthrax bar
The report of kit and method that bacterium detects simultaneously, therefore, needing exploitation quickly and efficiently while can detect above-mentioned four kinds of height
The kit of pathogenic pathogenic microorganism.
Summary of the invention
To solve the problems of the prior art, it is an object of the invention to one kind to detect Ebola virus simultaneously, Xinjiang goes out
Fever virus, brucella and bacillus anthracis kit and detection method.
To achieve the above object, technical scheme is as follows: the present invention passes through to xinjiang hemorrhagic fever virus, Ebola
Virus, bacillus anthracis and brucella genomic information analyzed, by designing and screening obtains and can be avoided Xinjiang
It is interfered with each other between hemorrhagic fever viruse, Ebola virus, bacillus anthracis and brucella, there is high degree of specificity and amplification efficiency
Specific primer and probe.And high sensitivity, high specificity, repeatability further are developed using specific primer and probe
Well, xinjiang hemorrhagic fever virus, Ebola virus, bacillus anthracis and the kit of brucella can be detected simultaneously.For maximum journey
Reduce interfering with each other for xinjiang hemorrhagic fever virus, Ebola virus, bacillus anthracis and brucella detection target spot, the present invention in degree ground
Micro-fluidic chip is combined with Solid phase PCR technology (testing principle is as shown in Figure 1), establishes a kind of multiple micro-fluidic solid phase
RT-PCR nucleic acid detection method will test probe and be fixed on micro-fluidic chip.Further, for xinjiang hemorrhagic fever virus, angstrom
Rich that the highly infectious and authentic sample of virus, bacillus anthracis and brucella is drawn to be not easy to obtain problem, the present invention utilizes inverse
Transcribe recombinant virus technology, construct include xinjiang hemorrhagic fever virus and Ebola virus specific nucleic acid sequence virus-like
Particle；Meanwhile the specific DNA recombinant plasmid of bacillus anthracis and brucella is prepared for using artificial synthesis, it will be above-mentioned
Virus-like particle and DNA recombinant plasmid as the positive quality control product of detection kit have stability it is high, can long term storage use
Advantage.
The present invention provides a kind of while detecting Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis
Primer combination of probe, including 4 pairs of specific primers and 4 specific probes；Wherein, the specific primer pair of Ebola virus
Sequence is as shown in SEQ ID NO.5-6, and specific probe sequence is as shown in SEQ ID NO.13；Xinjiang hemorrhagic fever virus it is special
The sequence of property primer pair is as shown in SEQ ID NO.7-8, and specific probe sequence is as shown in SEQ ID NO.14；Brucella
The sequence of specific primer pair is as shown in SEQ ID NO.9-10, and specific probe sequence is as shown in SEQ ID NO.15；Anthrax
The sequence of the specific primer pair of bacillus is as shown in SEQ ID NO.11-12, specific probe sequence such as SEQ ID NO.16 institute
Show.
The sequence of above-mentioned primer combination of probe is specific as follows:
For detecting the specific primer sequence of Ebola virus as shown in SEQ ID NO.5 and SEQ ID NO.6, specifically
Property probe sequence is as shown in SEQ ID NO.13:
SEQ ID NO.5:GTGCGAATAACTATGAGGAAG；
SEQ ID NO.6:TGATGCCCTTGCCCCCT；
SEQ ID NO.13:GGTTTGTTTCAGAGCCATATCACCAAGA.
For detecting the specific primer sequence such as SEQ ID NO.7 and SEQ ID NO.8 of xinjiang hemorrhagic fever virus, specifically
Property probe sequence is as shown in SEQ ID NO.14:
SEQ ID NO.7:GTTCAAGAAAGGAAATGGACT；
SEQ ID NO.8:CTTTTGTGCATCATCAGTGGCA；
SEQ ID NO.14:AACTCCTACTCCTTTTGTGAGAGTGTTCCA.
For detecting the specific primer sequence such as SEQ ID NO.9 and SEQ ID NO.10 of brucella, specificity is visited
Needle sequence is as shown in SEQ ID NO.15:
SEQ ID NO.9:GGCAAGACCGCAGTTAC；
SEQ ID NO.10:TACCGCCCCAGGCATTGT；
SEQ ID NO.15:GCGAGTGGAAAGACACCGTTGCTG.
For detecting the specific primer sequence such as SEQ ID NO.11 and SEQ ID NO.12 of bacillus anthracis, specificity is visited
Needle sequence is as shown in SEQ ID NO.15:
SEQ ID NO.11:TGGTTGTTCTTTCGTTGC；
SEQ ID NO.12:GACTATGTGGGTGCTGGTGAAAAT；
SEQ ID NO.16:GCAACCCTAACACCATTTACATTTTGATACAC.
For convenient for detection, it is preferable that of the present invention for detecting Ebola virus, xinjiang hemorrhagic fever virus, Bu Lu
The specific primer of Salmonella and bacillus anthracis is marked with fluorescent reporter group.
It is further preferred that the Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis specificity
The end of downstream primer 5 ' of primer is marked using fluorophor FAM.
The present invention also provides above-mentioned primer combination of probe prepare and meanwhile detect Ebola virus, xinjiang hemorrhagic fever virus,
Application in the kit of brucella and bacillus anthracis.
Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis are detected simultaneously the present invention also provides a kind of
Kit, include it is described detection Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis primed probe group
It closes.
Preferably, the kit further includes micro-fluidic Solid phase PCR chip, fixed on the micro-fluidic Solid phase PCR chip
Just like the Ebola virus shown in SEQ ID NO.13-16, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis spy
Specific probes.
As a preferred solution of the present invention, the concentration of the specific probe is 100 μM.
Preferably, the kit further includes positive quality control product and selected from dUTP, MgCl2, archaeal dna polymerase, UNG enzyme,
One of reverse transcriptase, RNase inhibitor, PCR reaction solution, negative control are a variety of.
Preferably, the positive quality control product includes Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis
Positive quality control product；Wherein, the positive quality control product of Ebola virus and xinjiang hemorrhagic fever virus is the special comprising virus of resistance to RNase
The virus-like particle of specific nuclease.
As a preferred solution of the present invention, the viral specific nucleic acids are NP gene and the Xinjiang bleeding of Ebola virus
The S gene of fever virus.
It is further preferred that the preparation method of the virus-like particle comprising viral specific nucleic acids includes following step
It is rapid:
(1) acquisition of viral specific nucleic acids: the NP gene and Xinjiang for obtaining Ebola virus respectively by PCR amplification go out
The S gene of fever virus；
(2) viral specific nucleic acids building of retroviral vector: are connect building with retroviral vector
The recombinant retroviral vector of the S gene of NP gene and xinjiang hemorrhagic fever virus containing Ebola virus respectively；
(3) cell transfecting: by the recombinant retroviral vector transfection host cell；
(4) extraction and purifying of the virus-like particle comprising viral nucleic acid: culture Positive transfections host cell is simultaneously collected
Clear liquid, it is purified to obtain the virus-like particle.
As a preferred solution of the present invention, the preparation method of the virus-like particle comprising viral nucleic acid includes following step
It is rapid:
(1) acquisition of specificity virus nucleic acid: sequence is guarded in the NP gene 5 ' UTR and NP gene of Ebola virus genome
A pair of of specificity amplification primer is designed between column, sequence is as shown in NO.1~2 SEQ ID；It is protected in xinjiang hemorrhagic fever virus S gene
Sequence design pair of primers is kept, sequence is as shown in NO.3~4 SEQ ID；RT-PCR amplification is carried out using above-mentioned primer pair, respectively
Obtain the viral specific nucleic acids of Ebola virus and xinjiang hemorrhagic fever virus；
SEQ ID NO:1: upstream primer GAAGATCTCGGACACACAAAAAGAAAGAA；
SEQ ID NO:2: downstream primer CCGCTCGAGAGTGATGCCCTTGCCCC；
SEQ ID NO:3: upstream primer GAAGATCTAGGTGAATAACAAAGATGAGATG；
SEQ ID NO:4: downstream primer CCGCTCGAGCCATCTGAAATACAAATCTATCCA；
(2) correct viral specific nucleic acids and pDON-5 retrovirus the building of retroviral vector: will be sequenced
Carrier connection building recombinant retroviral vector；
(3) cell transfecting: the recombinant retroviral vector is transfected to 293T cell；
(4) cell changes liquid: after transfection 24 hours, changing liquid to cell using 4ml fresh DMEM medium (10%FBS)；
(5) it the extraction and purifying of the virus-like particle comprising viral specific nucleic acids: after transfection 48 hours, collects on cell
Clear liquid is simultaneously filtered using 0.45 μm of aseptic filter membrane, using affinity chromatography purified virus sample particle, then uses DNA enzymatic
Digestion remove extra plasmid to get.
Preferably, the positive control of the brucella and bacillus anthracis is special containing carrying brucella and bacillus anthracis
The thallus of the plasmid of specific gene segment.
It should be appreciated by those skilled in the art that kit of the present invention is in addition to including Ebola virus, Xinjiang bleeding
Fever virus, brucella and bacillus anthracis detection primer and probe, can according to need selection comprising dUTP, MgCl2、DNA
One of substance needed for the PCR such as polymerase, UNG enzyme, reverse transcriptase, RNase inhibitor, PCR reaction solution reaction is a variety of.
The negative control includes but is not limited to PCR reaction solution, sterile water and physiological saline.
Various components in kit of the present invention can choose individually packaging or with various ingredients mixed liquor
Form packaging, such as dUTP, MgCl2, PCR reaction solution can be prepared as mixed liquor, it is common to pack.
As a preferred solution of the present invention, kit of the present invention includes following component: PCR reaction solution (50mM
Tris-HCl, 75mM KCl, 3mM MgCl2, 10mM DTT, 2.5mM dUTP), it is rich as shown in NO.5~12 SEQ ID angstrom
Draw mixed liquor (concentration is 50 μM), the enzyme system of the specific primer of virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis
(0.1U/ μ l Hitaq thermal starting archaeal dna polymerase, 0.2U/ μ l UNG enzyme, 2.4U/ μ l super M-MLV reverse transcriptase,
0.32U/ μ l IRNasin RNase inhibitor), fixation go out just like Ebola virus shown in NO.13~16 SEQ ID, Xinjiang
The micro-fluidic Solid phase PCR chip of the specific probe of fever virus, brucella and bacillus anthracis, positive quality control product and feminine gender are right
According to.
Preferably, kit of the present invention is carrying out Ebola virus, xinjiang hemorrhagic fever virus, brucella and anthrax
20 μ L reaction systems when the detection of bacillus include following component: 1 × PCR buffer, 3.0mM Mg2+, 200 μM of dUTP,
2.5U archaeal dna polymerase, 5U UNG enzyme, 120U reverse transcriptase, Ebola virus, xinjiang hemorrhagic fever virus, brucella, anthrax
The specific primer 400nM of bacillus and one of selected from sample to be tested nucleic acid, positive quality control product and negative control.
It is further preferred that the concentration of the positive quality control product is 10 in the reaction system3copies/μl。
Preferably, kit of the present invention is carrying out Ebola virus, xinjiang hemorrhagic fever virus, brucella and anthrax
The response procedures when detection of bacillus are as follows: 42 DEG C, 5min；95 DEG C, 5min；95 DEG C, 15s, 55 DEG C, 30s, 72 DEG C, 40s, 25
A circulation；95 DEG C, 15s, 62 DEG C, 30s, 72 DEG C, 40s, 20 circulations.
The present invention also provides detect Ebola virus, xinjiang hemorrhagic fever virus, brucella simultaneously using mentioned reagent box
With the method for bacillus anthracis, include the following steps:
(1) sample acquisition and pretreatment；
(2) extraction of sample nucleic；
(3) reagent for detecting Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis simultaneously is utilized
Box prepares PCR reaction system, is separately added into sample nucleic, negative control, positive control in the reaction system；
(4) PCR reaction is carried out, carries out testing result interpretation after reaction.
As a preferred solution of the present invention, described at the same detect Ebola virus, xinjiang hemorrhagic fever virus, brucella and
The method of bacillus anthracis, includes the following steps:
(1) sample acquisition and pretreatment:
When the sample is blood sample, blood is acquired using EDTA heparin tube, is mixed well.Sample can be immediately available for
Detection；If do not detected immediately, sample is saved at 4 DEG C to be no more than 24 hours, and -20 DEG C of preservation no more than 3 moons, -70 DEG C can be long-term
It saves, multigelation is no more than 5 times.
(2) extraction of sample nucleic
Commercially available nucleic acid extraction kit can be used in blood sample, such as the QIAampMinElute of QIAGEN company
Virus Spin Kit (article No.: 57704), Tiangeng biochemical technology Co., Ltd virus genom DNA/RNA extracts kit (goods
Number: DP315) or TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 (article No.: 9766), has
Body extraction step please refers to corresponding extracts kit specification.
(3) preparation of PCR reaction system
PCR reaction system (20 μ L) includes: 16 μ L of PCR reaction solution, 2 μ L of enzyme system, 2 μ L of primer and probe mixed liquor.
The concentration of each component is as follows in reaction system: 1 × PCR buffer, 3.0mM Mg2+, 200 μM of dUTPs, 2.5U
Archaeal dna polymerase, 5U UNG enzyme, 120U reverse transcriptase, Ebola virus, xinjiang hemorrhagic fever virus, brucella, bacillus anthracis
Specific primer 400nM.
(4) it is loaded
Processed sample nucleic, negative control, each 5 μ L of positive quality control product are added separately to equipped with reaction system
In PCR reaction tube, reaction solution one-to-one correspondence is added in micro-fluidic Solid phase PCR chip after mixing centrifugation.
(5) PCR amplification
Micro-fluidic Solid phase PCR chip is put into micro-fluidic fluorescent PCR instrument and is expanded, after reaction inhales reaction solution
It rinses 2 times out and using 0.1 × SSC and 0.1%SDS mixed liquor, is put into fluorescence detecting system analysis result.
(6) result interpretation
Negative findings determine: not having fluorescence in fixed probe area；
Positive findings determine: having fluorescence in fixed probe area.
The beneficial effects of the present invention are: amplification Ebola of the present invention by exploitation with high degree of specificity and sensitivity
Virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis primer combination of probe and detection kit, and creatively
In conjunction with micro-fluidic Solid phase PCR chip technology, viral (Ebola virus and xinjiang hemorrhagic fever virus) and bacterium (cloth Lu Shi are realized
Bacterium and bacillus anthracis) while detect, in detection process, viral nucleic acid amplification will not generate mutually dry with bacterial nucleic acid amplification
It disturbs, has detection flux is high, primary first-order equation realizes RNA with DNA class pathogenic microorganism synchronous detection, high sensitivity (detectable
Virus of the template concentrations down to 10copies/ μ L), high specificity, reproducible, detection time is short, testing cost is low, operation skill
Art requires the advantages that low and not easy to pollute, in clinical diagnosis, the environmental pollution for being related to the detection of multiple pathogenic microorganisms Fast synchronization
Monitoring and the biological emergency event of prevention and treatment etc. have broad application prospects.In addition, the present invention, which uses, includes specificity virus
Positive quality control product of the virus-like particle of nucleic acid as kit, have be easy to purifying, inanimate object infectiousness, stability height, it is resistance to
The advantage of RNase, RNA virus can be detected in the overall processes such as Viral extraction, reverse transcription, PCR carry out quality monitoring, be suitable for making
For the positive criteria quality-control product of RNA virus detection.
Detailed description of the invention
Fig. 1 is the schematic diagram of Solid phase PCR in summary of the invention of the present invention.
Fig. 2 is the real-time PCR qualification figure of Ebola virus sample particle in experimental example 1 of the present invention.
Fig. 3 is the real-time PCR qualification figure of xinjiang hemorrhagic fever virus sample particle in experimental example 1 of the present invention.
Fig. 4 is the Electronic Speculum qualification figure of Ebola virus sample particle in experimental example 2 of the present invention.
Fig. 5 is the Electronic Speculum qualification figure of xinjiang hemorrhagic fever virus sample particle in experimental example 2 of the present invention.
Fig. 6 is the spy of Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis in experimental example 3 of the present invention
Specific primer expands electrophoresis result figure, wherein M:Marker2000；Swimming lane 1-3: Ebola virus；Swimming lane 4-6: Xinjiang bleeding
Fever virus；Swimming lane 7-9: brucella；Swimming lane 10-12: bacillus anthracis.
Fig. 7 is that kit detects Ebola virus, xinjiang hemorrhagic fever virus, brucella and charcoal in experimental example 4 of the present invention
The sensitivity results figure of subcutaneous ulcer bacillus.
Fig. 8 is the specific outcome figure that kit detects Ebola virus in experimental example 5 of the present invention.
Fig. 9 is the specificity knot that kit detects Ebola virus and brucella result simultaneously in experimental example 6 of the present invention
Fruit figure.
Figure 10 is that kit detects Ebola virus, Xinjiang bleeding virus and bacillus anthracis simultaneously in experimental example 7 of the present invention
Specific outcome figure.
Figure 11 is that kit detects Ebola virus, xinjiang hemorrhagic fever virus, brucella simultaneously in experimental example 8 of the present invention
With the result figure of bacillus anthracis.
Specific embodiment
Below in conjunction with specific embodiment, the present invention is further described.It should be understood that these embodiments be only used for the present invention and
It is not used in and limits the scope of the invention.Unless otherwise defined or described herein, scientific term of the present invention and the common skill in this field
Art personnel, which understand, to be had the same meaning.
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Embodiment 1
Pass through the conservative of the genome sequence to Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis
Property and specificity analyzed, by largely detecting the screening of target gene and specific primer and probe, obtain have it is higher
The primer and probe of specificity and amplification efficiency.
The present embodiment provides be used for while detecting Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis
Primer combination of probe, it is specific as follows:
For detecting the specific primer sequence of Ebola virus as shown in SEQ ID NO.5 and SEQ ID NO.6, probe
Sequence is as shown in SEQ ID NO.13:
SEQ ID NO.5:GTGCGAATAACTATGAGGAAG；
SEQ ID NO.6:TGATGCCCTTGCCCCCT；
SEQ ID NO.13:GGTTTGTTTCAGAGCCATATCACCAAGA.
For detecting the specific primer sequence such as SEQ ID NO.7 and SEQ ID NO.8 of xinjiang hemorrhagic fever virus, probe
Sequence is as shown in SEQ ID NO.14:
SEQ ID NO.7:GTTCAAGAAAGGAAATGGACT；
SEQ ID NO.8:CTTTTGTGCATCATCAGTGGCA；
SEQ ID NO.14:AACTCCTACTCCTTTTGTGAGAGTGTTCCA.
For detecting the specific primer sequence such as SEQ ID NO.9 and SEQ ID NO.10 of brucella, probe sequence
As shown in SEQ ID NO.15:
SEQ ID NO.9:GGCAAGACCGCAGTTAC；
SEQ ID NO.10:TACCGCCCCAGGCATTGT；
SEQ ID NO.15:GCGAGTGGAAAGACACCGTTGCTG.
For detecting the specific primer sequence such as SEQ ID NO.11 and SEQ ID NO.12 of bacillus anthracis, probe sequence
As shown in SEQ ID NO.15:
SEQ ID NO.11:TGGTTGTTCTTTCGTTGC；
SEQ ID NO.12:GACTATGTGGGTGCTGGTGAAAAT；
SEQ ID NO.16:GCAACCCTAACACCATTTACATTTTGATACAC.
Above-mentioned Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis the downstream of specific primer draw
The end of object 5 ' is all made of fluorophor FAM label.
Embodiment 2
Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis are detected simultaneously the present embodiment provides a kind of
Kit, concrete composition is as shown in table 1:
The composition (24T) of 1 kit of table
Wherein, the composition of PCR reaction solution is as follows: 50mM Tris-HCl, 75mM KCl, 3mM MgCl2, 10mM DTT,
2.5mM dUTP；
Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis specific primer mixed liquor concentration
It is 50 μM；
The composition of enzyme system is as follows: 0.1U/ μ l Hitaq thermal starting archaeal dna polymerase, 0.2U/ μ l UNG enzyme, 2.4U/ μ l
Super M-MLV reverse transcriptase, 0.32U/ μ l IRNasin RNase inhibitor.
In mentioned reagent box, what it is as positive quality control product includes Ebola virus NP gene, xinjiang hemorrhagic fever virus S gene
Virus-like particle the preparation method is as follows:
(1) from the genome sequence of ncbi database downloading Ebola virus and xinjiang hemorrhagic fever virus, pass through MEGA6 ratio
To analytical sequence, pair of primers (such as SEQ ID NO.1~SEQ is designed between 5 ' UTR the and NP gene conserved sequences of Ebola
Shown in ID NO.2)；Pair of primers (such as SEQ ID NO.3~SEQ is designed in the S gene conserved sequence of xinjiang hemorrhagic fever virus
Shown in ID NO.4), primer sequence is specific as follows:
SEQ ID NO:1: upstream primer GAAGATCTCGGACACACAAAAAGAAAGAA；
SEQ ID NO:2: downstream primer CCGCTCGAGAGTGATGCCCTTGCCCC；
SEQ ID NO:3: upstream primer GAAGATCTAGGTGAATAACAAAGATGAGATG；
SEQ ID NO:4: downstream primer CCGCTCGAGCCATCTGAAATACAAATCTATCCA.
(2) use the primer of NO.1~4 above-mentioned SEQ ID respectively with the nucleic acid of Ebola virus and xinjiang hemorrhagic fever virus
RT-PCR is carried out for template, target fragment is recycled with plastic recovery kit after agarose gel electrophoresis, by the target fragment of recycling
Even T- carrier converts in bacillus coli DH 5 alpha, after PCR identification, serves the raw work sequencing in sea.
(3) it is extracted with plasmid extraction kit and correct plasmid is sequenced, by the plasmid of extraction and pDON-5 retrovirus
Carrier is connected after using XhoI and Bgl II double digestion, glue to recycle two target fragments simultaneously with T4DNA ligase, is transformed into large intestine
In bacillus DH5 α, after PCR identification, the raw work sequencing in sea is served, recombinant retroviral vector pDON5-Ebola and pDON5- are obtained
CCHFV。
(4) it is inoculated with 293T cell
1. being inoculated with 2~3 × 10 in the coated 6cm culture dish of Gelatin or Collagen6(293 is thin for a incasing cells
Born of the same parents or 293T cell)
2. recovery carries the bacterium of pDON5-Ebola and pDON5-CCHFV carrier, pDON5-Ebola and pDON5- is extracted
CCHFV plasmid is prepared for transfection.
(5) cell transfecting
Transfection reagent and sterile distilled water are taken out before experiment, and its temperature is made to be restored to room temperature.Carry out following experimental implementation
When it is noted that sterile working avoids pollution.
1. by following components in sterile 5ml round bottom test tube (polystyrene) preparating mixture: recombinant retrovirus matter
Grain 10 μ g, pGP Vector (1 μ g/ μ l) 5 μ l, pE-ampho Vector (1 μ g/ μ l) 5 μ l, 2M CaCl262 μ l, addition nothing
Bacterium distilled water is to 500 μ l.
2. taking out the 293T cell of the previous day inoculation, culture medium is sucked, then add the fresh DMEM culture medium (10% of 3ml
FBS, 25 μM of chloroquine).
3. preparing DNA calcium phosphate mixture and transfecting cell, transfection cellular processes are as follows:
A. 500 μ l Transfection Buffer are drawn with electronic liquid-transfering gun；
B. Transfection Buffer is slowly dropped in the above-mentioned 1. middle DNA mixture prepared, vibration examination on one side
Pipe is added dropwise on one side；
After C.Transfection Buffer is dripped, piping and druming is bubbled and continues 10-20 seconds in the solution at once, purpose
It is the formation in order to accelerate calcium phosphate precipitation object；
D. in 1-2 minutes, mixed liquor is uniformly added drop-wise in the above-mentioned 2. middle Tissue Culture Dish prepared, and front and back is left
Right shake culture dish makes it be evenly distributed；
E. cell is placed into incubator (5%CO2, 37 DEG C) and middle culture 7-11 hours, it is able to observe that under the microscope
The snowy granular sludge of cell surface generates；
F. cell changes liquid, sucks 3ml culture medium, then adds the fresh DMEM culture medium (10%FBS) of 4ml (if by thin
Culture medium in born of the same parents' culture dish, which all sucks, can reduce transfection efficiency, it is proposed that the residue 1ml culture medium in Tissue Culture Dish).
(6) cell changes liquid (third day)
After transfection 24 hours, liquid is changed to cell using 4ml fresh DMEM medium (10%FBS).
(7) cell culture fluid (the 4th day) is collected
After transfection 48 hours, collects cell supernatant and be filtered using 0.45 μm of aseptic filter membrane, using nickel column
After affinitive layer purification, extra plasmid is removed to cell culture fluid digestion with DNA enzymatic, respectively obtain comprising Ebola virus and
The virus-like particle of the nucleic acid specific fragment of xinjiang hemorrhagic fever virus is saved in -20 DEG C of refrigerators.
Embodiment 3
The present embodiment provides it is a kind of using embodiment 2 provide kit carry out Ebola virus, xinjiang hemorrhagic fever virus,
The method of brucella detection synchronous with bacillus anthracis, includes the following steps:
(1) sample acquisition and processing
Blood sample is acquired with EDTA heparin tube, is mixed well.Sample can be immediately available for detecting；If do not detected immediately, sample
Product are saved at 4 DEG C to be no more than 24 hours, -20 DEG C of preservations no more than 3 moons, -70 DEG C can long-term preservation, multigelation is no more than 5
It is secondary.
(2) extraction of sample nucleic
Using commercially available nucleic acid extraction kit, such as the QIAampMinElute Virus Spin Kit of QIAGEN company
(article No.: 57704), Tiangeng biochemical technology Co., Ltd virus genom DNA/RNA extracts kit (article No.: DP315) or
TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 (article No.: 9766), specific extraction step
Please refer to corresponding extracts kit specification.
(3) preparation of RT-PCR reaction system
RT-PCR reaction system (20 μ L) includes: 16 μ L of PCR reaction solution, 2 μ L of enzyme system, 2 μ L of primer mixed liquor.PCR reaction
The composition of liquid, enzyme system and primer mixed liquor is as described in Example 2.
Each component concentration is as follows in reaction system: 1 × PCR buffer, 3.0mM Mg2+, 200 μM of dUTPs, 2.5U DNA
Polymerase, 5U UNG enzyme, 120U reverse transcriptase, Ebola virus, xinjiang hemorrhagic fever virus, brucella, bacillus anthracis spy
Specific primer 400nM.
(4) it is loaded
By processed sample nucleic, negative control, positive quality control product (103Copies/ μ l) each 5 μ L is added separately to fill
Have in the PCR reaction tube of reaction system, after mixing centrifugation, the reaction solution in PCR reaction tube is added to micro-fluidic Solid phase PCR core
In piece.
(5) RT-PCR is expanded
Micro-fluidic Solid phase PCR chip is put into micro-fluidic PCR analyzer and is expanded, response procedures are as follows: 42 DEG C,
5min；95 DEG C, 5min；95 DEG C, 15s, 55 DEG C, 30s, 72 DEG C, 40s, 25 circulations；95 DEG C, 15s, 62 DEG C, 30s, 72 DEG C,
40s, 20 circulations.
PCR reaction solution is sucked out after reaction and is used 0.1 × SSC and 0.1%SDS mixed liquor rinse 2 times, is put into glimmering
Optical detection system analyzes result.
(6) result interpretation
Negative findings determine: not having fluorescence in immobilized primer region；
Positive findings determine: having fluorescence in immobilized primer region.
The fluorescent PCR of 1 virus-like particle of experimental example is identified
For the function of virus-like particle of being prepared in analysis embodiment 2, with embodiment 2 prepare comprising Ebola virus and
The virus-like particle of the specific nucleic acid of xinjiang hemorrhagic fever virus is sample, extracts viral RNA using nucleic acid extraction kit, puts down
Two parts are divided into, a RNA carries out reverse transcription, another RNA is without reverse transcription, then carries out quantitative fluorescent PCR respectively.
Shown in experimental result such as Fig. 2 (Ebola virus) and Fig. 3 (xinjiang hemorrhagic fever virus), the results showed that, it does not carry out inverse
The RNA of responsive transcription, is not detected amplification curve；The RNA for carrying out reverse transcription amplification, can detect amplification curve, show reality
The virus-like particle that example 2 is successfully prepared the nucleic acid specific fragment comprising Ebola virus and xinjiang hemorrhagic fever virus is applied, and
Without DNA pollution.
The Electronic Speculum of the virus-like particle of 2 Ebola virus of experimental example and xinjiang hemorrhagic fever virus is identified
Each 5 μ l drop of virus-like particle concentrating sample of Ebola virus and xinjiang hemorrhagic fever virus prepared by Example 2
It on copper mesh, is drawn after 1 minute using filter paper and supports residual liquid on film, using 5 μ L uranium acetate dyeing liquors to support film
It is dyed, after infrared baking lamp dries copper mesh, Electronic Speculum sight is carried out to sample using Tecnai transmitting cryogenic freezing transmission electron microscope
It examines to identify the presence or absence of virus-like particle, as a result as shown in Fig. 4 (Ebola virus) and Fig. 5 (xinjiang hemorrhagic fever virus), Electronic Speculum
The visible virus-like particle irregular, not of uniform size similar to morphology of virus in result is detected, shows that embodiment 2 is successfully prepared
The virus-like particle of nucleic acid specific fragment comprising Ebola virus and xinjiang hemorrhagic fever virus.
3 Ebola virus of experimental example, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis specific amplification
The virus-like particle of the Ebola virus and xinjiang hemorrhagic fever virus in the kit that embodiment 2 provides is extracted respectively
And the nucleic acid of the thallus of the plasmid comprising carrying brucella and bacillus anthracis specific gene segment, and with the nucleic acid of extraction
Carry out RT-PCR and PCR amplification respectively for template, using amplimer as shown in NO.5~12 SEQ ID, by amplified production into
Row agarose gel electrophoresis, electrophoresis result are as shown in Figure 6, the results showed that, the specific primer as shown in NO.5~12 SEQ ID
It efficiently can specifically expand the specific nucleic acid piece of Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis
Section.
The detection sensitivity of 4 kit of experimental example is analyzed
Respectively with Ebola virus, xinjiang hemorrhagic fever virus, brucella and anthrax bar in the kit of the offer of embodiment 2
The positive quality control product of bacterium is test sample, analyzes kit sensitivity of the invention.By positive quality control product with 10 times of gradient dilutions,
Detection range is 106-101Copies/ μ l, detection method are as described in Example 3.As a result as shown in Figure 7, the results showed that, Ebola
Virus, the concentration of the positive quality control product of xinjiang hemorrhagic fever virus, brucella and bacillus anthracis are 106-101Copies/ μ l may be used
To realize detection, i.e. the detection sensitivity of kit that provides of the embodiment of the present invention 2 is up to 101copies/μl。
5 kit of experimental example detects the specificity analysis of Ebola virus
With concentration in kit for 103The Ebola virus positive quality control product of copies/ μ l is test sample, using implementation
Detection method described in example 3 analyzes the specificity of kit detection Ebola virus, and testing result is as shown in figure 8, knot
Fruit shows that the reflecting point display that the specific probe of Ebola virus is fixed on micro-fluidic Solid phase PCR chip is positive, other are anti-
Display feminine gender should be put, the specificity that the kit that the embodiment of the present invention 2 provides detects Ebola virus is higher.
6 kit of experimental example detects the specificity analysis of Ebola virus and brucella simultaneously
With concentration in kit for 103The Ebola virus of copies/ μ l and the positive quality control product of brucella are test
Sample is divided using the specificity that detection method described in embodiment 3 detects Ebola virus and brucella to kit
Analysis, testing result are as shown in Figure 9, the results showed that, it is fixed with Ebola virus on micro-fluidic Solid phase PCR chip and brucella is special
The reflecting point of specific probes shows the positive, and the display of other reflecting points is negative, and the kit that the embodiment of the present invention 2 provides detects simultaneously
The specificity of Ebola virus and brucella is higher.
7 kit of experimental example detects the specificity analysis of Ebola virus, xinjiang hemorrhagic fever virus and bacillus anthracis simultaneously
With concentration in kit for 103The Ebola virus of copies/ μ l, xinjiang hemorrhagic fever virus and bacillus anthracis sun
Property quality-control product be test sample, using detection method described in embodiment 3 to kit detect Ebola virus, xinjiang hemorrhagic fever
Virus and the specificity of bacillus anthracis are analyzed, and testing result is as shown in Figure 10, the results showed that, micro-fluidic Solid phase PCR chip
On be fixed with Ebola virus, xinjiang hemorrhagic fever virus and bacillus anthracis specific probe reflecting point display it is positive, other are anti-
Display feminine gender should be put, the kit that the embodiment of the present invention 2 provides detects Ebola virus, xinjiang hemorrhagic fever virus and anthrax simultaneously
The specificity of bacillus is higher.
8 kit of experimental example detects the spy of Ebola virus, brucella, xinjiang hemorrhagic fever virus and bacillus anthracis simultaneously
Specific analysis
With concentration in kit for 103Ebola virus, brucella, xinjiang hemorrhagic fever virus and the charcoal of copiea/ μ l
The positive quality control product of subcutaneous ulcer bacillus is test sample, detects Ebola simultaneously to kit using detection method described in embodiment 3
Virus, brucella, xinjiang hemorrhagic fever virus and bacillus anthracis performance analyzed, testing result is as shown in figure 11, as a result
Show to be fixed with Ebola virus, brucella, xinjiang hemorrhagic fever virus and bacillus anthracis spy on micro-fluidic Solid phase PCR chip
The reflecting point of specific probes shows the positive, and the kit that the embodiment of the present invention 2 provides can detect Ebola virus, Xinjiang simultaneously
Hemorrhagic fever viruse, brucella and bacillus anthracis.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, without departing from the technical principles of the invention, several improvements and modifications can also be made, these improvements and modifications
Also it should be regarded as protection scope of the present invention.
Sequence table
<110>Hefei Institutes of Physical Science, Chinese Academy of Sciences
<120>a kind of kit and detection method for detecting potent virus and bacterium simultaneously
<160> 16
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gaagatctcg gacacacaaa aagaaagaa 29
<210> 2
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ccgctcgaga gtgatgccct tgcccc 26
<210> 3
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gaagatctag gtgaataaca aagatgagat g 31
<210> 4
<211> 33
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ccgctcgagc catctgaaat acaaatctat cca 33
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gtgcgaataa ctatgaggaa g 21
<210> 6
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
tgatgccctt gccccct 17
<210> 7
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gttcaagaaa ggaaatggac t 21
<210> 8
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cttttgtgca tcatcagtgg ca 22
<210> 9
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
ggcaagaccg cagttac 17
<210> 10
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
taccgcccca ggcattgt 18
<210> 11
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
tggttgttct ttcgttgc 18
<210> 12
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gactatgtgg gtgctggtga aaat 24
<210> 13
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
ggtttgtttc agagccatat caccaaga 28
<210> 14
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
aactcctact ccttttgtga gagtgttcca 30
<210> 15
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
gcgagtggaa agacaccgtt gctg 24
<210> 16
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
gcaaccctaa caccatttac attttgatac ac 32
Claims (10)
1. a kind of primer combination of probe for detecting Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis simultaneously,
It is characterised in that it includes 4 pairs of specific primers and 4 specific probes；Wherein, the sequence of the specific primer pair of Ebola virus
Column are as shown in SEQ ID NO.5-6, and specific probe sequence is as shown in SEQ ID NO.13；The specificity of xinjiang hemorrhagic fever virus
The sequence of primer pair is as shown in SEQ ID NO.7-8, and specific probe sequence is as shown in SEQ ID NO.14；The spy of brucella
The sequence of specific primer pair is as shown in SEQ ID NO.9-10, and specific probe sequence is as shown in SEQ ID NO.15；Anthrax bar
The sequence of the specific primer pair of bacterium is as shown in SEQ ID NO.11-12, and specific probe sequence is as shown in SEQ ID NO.16.
2. primer combination of probe described in claim 1 is in preparation while detecting Ebola virus, xinjiang hemorrhagic fever virus, Bu Lu
Application in the kit of Salmonella and bacillus anthracis.
3. a kind of kit for detecting Ebola virus, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis simultaneously, feature
It is, includes primer combination of probe described in claim 1.
4. kit according to claim 3, which is characterized in that the kit further includes micro-fluidic Solid phase PCR chip,
It fixes on the micro-fluidic Solid phase PCR chip just like the Ebola virus, xinjiang hemorrhagic fever shown in SEQ ID NO.13-16
Viral, brucella and bacillus anthracis specific probe；
Preferably, the concentration of the specific probe is 100 μM.
5. kit according to claim 3 or 4, which is characterized in that the kit further include positive quality control product and
Selected from dUTP, MgCl2, archaeal dna polymerase, UNG enzyme, reverse transcriptase, RNase inhibitor, PCR reaction solution, one in negative control
Kind is a variety of.
6. kit according to claim 5, which is characterized in that the positive quality control product includes Ebola virus, Xinjiang
Hemorrhagic fever viruse, brucella and bacillus anthracis positive quality control product；Wherein, the sun of Ebola virus and xinjiang hemorrhagic fever virus
Property quality-control product be resistance to RNase the virus-like particle comprising viral specific nucleic acids.
7. kit according to claim 6, which is characterized in that the viral specific nucleic acids are the NP of Ebola virus
The S gene of gene and xinjiang hemorrhagic fever virus.
8. kit according to claim 6 or 7, which is characterized in that the virus-like comprising viral specific nucleic acids
The preparation method of particle includes the following steps:
(1) the NP gene and xinjiang hemorrhagic fever of Ebola virus the acquisition of viral specific nucleic acids: are obtained respectively by PCR amplification
The S gene of virus；
(2) building of retroviral vector: the viral specific nucleic acids are connect with retroviral vector, building difference
The recombinant retroviral vector of the S gene of NP gene and xinjiang hemorrhagic fever virus containing Ebola virus；
(3) cell transfecting: by the recombinant retroviral vector transfection host cell；
(4) extraction and purifying of the virus-like particle comprising viral specific nucleic acids: culture Positive transfections host cell is simultaneously collected
Supernatant, it is purified to obtain the virus-like particle.
9. according to the described in any item kits of claim 3~8, which is characterized in that the kit is carrying out ebola disease
20 μ L reaction systems when detecting while poison, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis include following component: 1
× PCR buffer, 3.0mM Mg2+, 200 μM of dUTPs, 2.5U archaeal dna polymerase, 5U UNG enzyme, 120U reverse transcriptase, Ai Bo
Draw virus, xinjiang hemorrhagic fever virus, brucella, bacillus anthracis specific primer 400nM and be selected from sample to be tested nucleic acid,
One of positive quality control product and negative control.
10. according to the described in any item kits of claim 3~9, which is characterized in that the kit is carrying out ebola disease
Response procedures when detecting while poison, xinjiang hemorrhagic fever virus, brucella and bacillus anthracis are as follows: 42 DEG C, 5min；95 DEG C,
5min；95 DEG C, 15s, 55 DEG C, 30s, 72 DEG C, 40s, 25 circulations；95 DEG C, 15s, 62 DEG C, 30s, 72 DEG C, 40s, 20 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910233229.2A CN109852730A (en) | 2019-03-26 | 2019-03-26 | Kit and detection method a kind of while that detect potent virus and bacterium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910233229.2A CN109852730A (en) | 2019-03-26 | 2019-03-26 | Kit and detection method a kind of while that detect potent virus and bacterium |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109852730A true CN109852730A (en) | 2019-06-07 |
Family
ID=66901942
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910233229.2A Pending CN109852730A (en) | 2019-03-26 | 2019-03-26 | Kit and detection method a kind of while that detect potent virus and bacterium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109852730A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111394510A (en) * | 2020-02-28 | 2020-07-10 | 天罗诊断科技江苏有限公司 | High-speed and high-sensitivity nucleic acid detection box and method suitable for swab sample |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070048735A1 (en) * | 2001-03-02 | 2007-03-01 | Ecker David J | Methods for rapid detection and identification of biogents in epidemiological and forensic investigations |
| CN102424866A (en) * | 2012-01-10 | 2012-04-25 | 中华人民共和国江苏出入境检验检疫局 | Fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) kit for rapidly detecting XHF (Xinjiang hemorrhagic fever) viruses |
| CN105087824A (en) * | 2015-03-04 | 2015-11-25 | 浙江省疾病预防控制中心 | Preparation and application of hemorrhagic fever associated pathogen identifying gene chip |
-
2019
- 2019-03-26 CN CN201910233229.2A patent/CN109852730A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070048735A1 (en) * | 2001-03-02 | 2007-03-01 | Ecker David J | Methods for rapid detection and identification of biogents in epidemiological and forensic investigations |
| CN102424866A (en) * | 2012-01-10 | 2012-04-25 | 中华人民共和国江苏出入境检验检疫局 | Fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) kit for rapidly detecting XHF (Xinjiang hemorrhagic fever) viruses |
| CN105087824A (en) * | 2015-03-04 | 2015-11-25 | 浙江省疾病预防控制中心 | Preparation and application of hemorrhagic fever associated pathogen identifying gene chip |
Non-Patent Citations (3)
| Title |
|---|
| SATOSHI ISHII等: "Microfluidic Quantitative PCR for Simultaneous Quantification of Multiple Viruses in Environmental Water Samples", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 * |
| 朱灿灿等: "多重巢式固相PCR-Array 芯片用于高致病性病原微生物并行检测", 《分析化学（FENXI HUAXUE） 研究报告》 * |
| 豆玲等: "布鲁氏茵病与炭疽病多重PCR方法的建立", 《JOURNAL OF ANIMAL SCIENCE AND VETERINARY MEDICINE》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111394510A (en) * | 2020-02-28 | 2020-07-10 | 天罗诊断科技江苏有限公司 | High-speed and high-sensitivity nucleic acid detection box and method suitable for swab sample |
| CN111394510B (en) * | 2020-02-28 | 2023-04-18 | 天罗诊断科技江苏有限公司 | High-speed and high-sensitivity nucleic acid detection box and method suitable for swab sample |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN111235313A (en) | CRISPR-Cas13 method for rapidly detecting novel coronavirus | |
| WO2016082691A1 (en) | Kit for rt-pcr detection of chikungunya and test method thereof | |
| RU2270254C2 (en) | Identification of transgenic dna sequences in plant material and products made of the same, oligonucleotide kit and bioarray therefor | |
| CN101333568B (en) | Quantitative determination process for enterovirus in environment water body | |
| CN104232800A (en) | Gene chip and kit for detecting porcine japanese encephalitis virus, swine fever virus and porcine reproductive and respiratory syndrome virus | |
| CN109852730A (en) | Kit and detection method a kind of while that detect potent virus and bacterium | |
| CN106676200A (en) | RT-LAMP nucleic acid test strip kit and application | |
| CN104293981A (en) | Gene chip and kit for detecting swine epidemic encephalitis B viruses (SEEBVs) and/or swine fever viruses (SFVs) | |
| CN104293976A (en) | Gene chip and kit for detecting pig epidemic type B encephalitis virus and/or pig porcine reproductive and respiratory syndrome virus | |
| CN103993102A (en) | Multiple fluorescent PCR method and kit for simultaneous detection of human adenovirus, human mycoplasma pneumonia and bocavirus | |
| CN116356079A (en) | RPA-CRISPR-Cas12a based visual detection kit for detecting Gaota virus and application | |
| CN107988345A (en) | The method of HLA-A*02 subtype typings | |
| CN116121408A (en) | Site visualization kit for detecting listeria monocytogenes based on CRISPR/Cas12a and application | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| CN111378724B (en) | RNA amplification detection method and detection kit | |
| Can-Can et al. | Multiplex Nested Solid Phase PCR-Array Chip for Simultaneous Detection of Highly Pathogenic Microorganisms | |
| CN106868217A (en) | A kind of detection primer of zika virus and application | |
| CN105886666A (en) | Duck circovirus real-time fluorescent quantitative PCR (polymerase chain reaction) detection method | |
| CN112391444A (en) | Application of mesenchymal stem cells with different functional characteristics in treating different diseases | |
| CN104962561A (en) | RNA aptamer and detection method for enzymatic cGAMP generation amount detection | |
| CN110760596A (en) | Clonorchis sinensis liquid drop type digital PCR detection kit and application | |
| CN116516069B (en) | RPA kit for rapidly detecting Epstein-Barr virus in cells | |
| CN109439776A (en) | Detect the kit of M.tuberculosis complex and mycobacterium avium-intracellular complex | |
| CN106591497A (en) | Fluorescent LAMP primer for detecting infectious hematopoietic necrosis virus of fish |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |