CN109439776A - Detect the kit of M.tuberculosis complex and mycobacterium avium-intracellular complex - Google Patents

Detect the kit of M.tuberculosis complex and mycobacterium avium-intracellular complex Download PDF

Info

Publication number
CN109439776A
CN109439776A CN201811112222.7A CN201811112222A CN109439776A CN 109439776 A CN109439776 A CN 109439776A CN 201811112222 A CN201811112222 A CN 201811112222A CN 109439776 A CN109439776 A CN 109439776A
Authority
CN
China
Prior art keywords
seq
sequence
mtbc
mac
label
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
CN201811112222.7A
Other languages
Chinese (zh)
Inventor
杨祥胜
肖慧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Bao Bao Biotechnology Co Ltd
Original Assignee
Guangzhou Bao Bao Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Bao Bao Biotechnology Co Ltd filed Critical Guangzhou Bao Bao Biotechnology Co Ltd
Priority to CN201811112222.7A priority Critical patent/CN109439776A/en
Publication of CN109439776A publication Critical patent/CN109439776A/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses the kits of detection M.tuberculosis complex and mycobacterium avium-intracellular complex, belong to technical field of biomedical detection, kit includes detection amplimer to, hybond membrane item and hybridization developing solution, probe is attached on hybond membrane item, hybridization developing solution includes the microballoon for being connected with the second chromogenic label, is developed the color after microballoon enrichment.The detection of single microorganism may be implemented in kit of the present invention, it is more able to achieve while detecting and distinguishing the infection of two class pathogenic microorganisms, provides a simple, quick, cheap selection for the screening of mycobacterium tuberculosis complex and mycobacterium avium-intracellular complex.

Description

Detect the kit of M.tuberculosis complex and mycobacterium avium-intracellular complex
Technical field
The invention belongs to technical field of biomedical detection, more particularly to detection M.tuberculosis complex and intracellular point of bird- The kit of the branch compound group of bacillus.
Background technique
Tuberculosis is to endanger the serious infectious diseases of national health, and China is one of main Tuberculosis big country.Due to The particularity of mycobacterium tuberculosis complex (Mycobacterium tuberculosis complex, MTBC), detection and Treatment is always to restrict the mankind to capture bottleneck lungy.Traditional diagnosis method lungy is the general training based on culture technique It supports and 3~4 Zhou Caineng is needed to obtain result;Even state-of-the-art Liquid Culture technology, it is also desirable to can just be examined within 10 days or so Come to an end fruit;This gives screening lungy, makes a definite diagnosis and bring severe challenge.
As the appearance of molecular detection technology is screening lungy because of its brilliant sensitivity and specificity performance Advantageous tool is provided with diagnosis.In recent years, although the incidence of tuberculosis in more and more report displays China obtains Certain control, but diagnosis and treatment lungy burden is very serious always.In addition, the recall rate of atylosis mycobacteria is in year by year Incremental situation, mycobacterium avium-intracellular complex (Mycobacterium avium-intracellulare complex, It MAC) is the main compound group of atylosis mycobacteria, especially HIV combined infection, mycobacterium avium positive rate It is in the first place of anonymous mycobacteria.
Mycobacterium tuberculosis complex is endangered because of its high infection risk and serious infection, it is desirable that we develop a kind of letter Just effectively and can be to avoid the detection system of operational risk;And atypia mycobacterium tuberculosis, especially bird-branch bar intracellular The recall rate of the compound group of bacterium rises year by year, and clinical symptoms are similar to mycobacterium tuberculosis complex infection, and to a knot Nuclear pharmaceuticals is in drug resistance, can detecte therefore it is required that we develop one kind and distinguishes mycobacterium tuberculosis complex and atypia The detection reagent of mycobacterium tuberculosis pathogenic infection.
Based on the above important realistic problem, we develop a kind of easy, detection reagent safely, effectively and inexpensively.
Summary of the invention
Present invention aims to overcome that the prior art is insufficient, and provide the detection tuberculosis point based on single-stranded hybridization technique The hybond membrane item and kit of branch bacillus compound group and mycobacterium avium-intracellular complex, the hybond membrane item and kit can letters Just, mycobacterium tuberculosis complex and/or mycobacterium avium-intracellular complex are detected safely and effectively.
To achieve the above object, the technical scheme adopted by the invention is as follows: one kind is for detecting mycobacterium tuberculosis complex MTBC amplimer pair, the sequence of MTBC amplimer pair as shown in SEQ ID NO.1 and SEQ ID NO.2, MTBC amplification The end of forward primer 5 ' of primer pair is also connected with the sequence label as shown in SEQ ID NO.3, MTBC amplimer pair it is reversed The end of primer 5 ' is also connected with the first chromogenic label, and the first chromogenic label can be with the second chromogenic label phase for being combined with microballoon Connection develops the color after microballoon enrichment.
Preferably, the forward primer of MTBC amplimer pair and reverse primer are opposite, if one of them draws for forward direction Object, another is then reverse primer.
As an improvement of the above technical solution, the first chromogenic label is biotin, and the second chromogenic label is strepto- parent And element, microballoon are the latex beads being displayed in blue after being enriched with.
In addition, the second detection amplimer that the present invention also provides a kind of for detecting mycobacterium avium-intracellular complex Right, the sequence of MAC amplimer pair is as shown in SEQ ID NO.4 and SEQ ID NO.5, the forward primer of MAC amplimer pair 5 ' ends are also connected with the sequence label as shown in SEQ ID NO.6, and the end of reverse primer 5 ' of MAC amplimer pair is also connected with the One chromogenic label, the first chromogenic label can be connected with the second chromogenic label for being combined with microballoon, show after microballoon enrichment Color.
Preferably, the forward primer of MAC amplimer pair and reverse primer are opposite, if one of them draws for forward direction Object, another is then reverse primer.
As an improvement of the above technical solution, the first chromogenic label is biotin, and the second display marker is strepto- parent And element, microballoon are the latex beads being displayed in blue after being enriched with.
In addition, the present invention also provides for detecting mycobacterium tuberculosis complex and/or mycobacterium avium-intracellular complex Hybond membrane item, hybond membrane item includes polyvinyl chloride panel, be fixed with nitrocellulose membrane on polyvinyl chloride panel, nitrocellulose membrane up to Be attached with a kind of following probe less: the sequence of MTBC detection probe is as shown in SEQ ID NO.10, and the sequence of MAC detection probe is such as Shown in SEQ ID NO.11.
Preferably, hybond membrane item is attached with two probes: the sequence of MTBC detection probe as shown in SEQ ID NO.10, The sequence of MAC detection probe can be used for detecting mycobacterium tuberculosis complex simultaneously and bird-be intracellular as shown in SEQ ID NO.11 The compound group of mycobacteria.
As an improvement of the above technical solution, Quality Control probe is also attached on nitrocellulose membrane, the sequence of Quality Control probe is such as Shown in SEQ ID NO.12.
As a further improvement of the above technical scheme, nitrocellulose membrane is successively attached with MTBC detection from the bottom up and visits The spacing of needle, MAC detection probe and Quality Control probe, MTBC detection probe and MAC detection probe is 1cm, MAC detection probe and matter The spacing for controlling probe is 2cm.
In addition, the present invention also provides one kind for detecting mycobacterium tuberculosis complex and/or bird-Mycobacterium intracellulare is multiple Gregarious kit, kit include detection amplimer to, hybond membrane item and hybridization developing solution, the hybridization developing solution packet The microballoon for being connected with the second chromogenic label is included, is developed the color after microballoon enrichment;
Amplimer is detected to including at least following pair of primers: the sequence of MTBC amplimer pair such as SEQ ID NO.1 With shown in SEQ ID NO.2, the end of forward primer 5 ' of MTBC amplimer pair is also connected with the label as shown in SEQ ID NO.3 The end of reverse primer 5 ' of sequence, MTBC amplimer pair is also connected with the first chromogenic label;The sequence of MAC amplimer pair is such as Shown in SEQ ID NO.4 and SEQ ID NO.5, the end of forward primer 5 ' of MAC amplimer pair is also connected with such as SEQ ID NO.6 Shown in sequence label, MAC amplimer pair reverse primer 5 ' end is also connected with the first chromogenic label;First revealing label Object can be connected with the second chromogenic label for being combined with microballoon;
Hybond membrane item includes polyvinyl chloride panel, is fixed with nitrocellulose membrane on polyvinyl chloride panel, on nitrocellulose membrane at least Be attached with a kind of following probe: the sequence of MTBC detection probe is as shown in SEQ ID NO.10, and the sequence of MAC detection probe is such as Shown in SEQ ID NO.11.
Detect sequence label and corresponding probe sequence complementary pairing, the i.e. SEQ of the forward primer connection of amplimer pair Sequence label shown in ID NO.3 and MTBC detection probe sequence complementary pairing shown in SEQ ID NO.10, SEQ ID NO.6 Shown in MAC detection probe sequence complementary pairing shown in sequence label and SEQ ID NO.11.
Preferably, there are two types of probes for the attachment of hybond membrane item: MTBC detection probe and MAC detection probe;It can be used for examining simultaneously Survey mycobacterium tuberculosis complex and mycobacterium avium-intracellular complex.
As an improvement of the above technical solution, kit also packet Quality Control amplimer pair, the Quality Control amplimer pair As shown in SEQ ID NO.7 and SEQ ID NO.8, the end of forward primer 5 ' of Quality Control amplimer pair is also connected with such as SEQ sequence The end of reverse primer 5 ' of sequence label shown in ID NO.9, Quality Control amplimer pair is also connected with the first chromogenic label;Nitric acid Quality Control probe is also attached on tunica fibrosa, the sequence of Quality Control probe is as shown in SEQ ID NO.12.It is marked shown in SEQ ID NO.9 Sign Quality Control probe sequence complementary pairing shown in sequence and SEQ ID NO.12.
Preferably, the forward primer of Quality Control amplimer pair and reverse primer are opposite, if one of them draws for forward direction Object, another is then reverse primer.
As a further improvement of the above technical scheme, the first chromogenic label is biotin, and the second chromogenic label is Streptavidin, microballoon are the latex beads being displayed in blue after being enriched with.
The beneficial effects of the present invention are: the present invention provides detection M.tuberculosis complex and bird-Mycobacterium intracellulare is multiple Gregarious kit, kit include hybond membrane item, and hybond membrane item and kit are carried out based on single-stranded hybridization technique platform Exploitation, has the advantage that
1) the kit of the present invention genetic fragment special by selection, realizes the detection of single pathogenic microorganism, and It detects simultaneously and distinguishes 2 kinds of monoid pathogenic microorganisms (mycobacterium tuberculosis complex and mycobacterium avium-intracellular complex) Infection, provides a simple, quick, cheap selection for screening;
2) excellent detection amplimer makes kit have very high spy, probe in conjunction with the hybond membrane item of optimization Anisotropic and sensitivity;
3) special single-stranded hybridization technique does not need that hybridization reaction can be completed at room temperature using hybridization instrument;Phase For the crossing scheme being commonly used, time and equipment cost are saved;
4) testing result can with the naked eye interpretation, greatly reduce use cost.
Detailed description of the invention
Fig. 1 shows the testing process of kit of the present invention;
Fig. 2 shows the PCR amplification result of mycobacterium tuberculosis complex, mycobacterium avium and Mycobacterium intracellulare;
Fig. 3 shows the position of probe on hybond membrane item;
Fig. 4 shows the testing result of MTBC sample in embodiment 1;In figure, left side is first sample, and right side is second batch Sample;Wherein, MTBC-p1, MTBC-p2, MTBC-p3, MTBC-p4, MTBC-p5 are positive sample, and MTBC-N1 is negative sample Product;
Fig. 5 shows the testing result of MTBC sample in embodiment 2;In figure, left side is first sample, and right side is second batch Sample;Wherein, MTBC-N1 is negative sample, and MTBC-p1, MTBC-p2, MTBC-p3, MTBC-p4, MTBC-p5 are positive sample Product;
Fig. 6 shows the testing result of MAC sample in embodiment 3;In figure, left side is first sample, and right side is second batch Sample;Wherein, MAC-p1, MAC-p2, MAC-p3, MAC-p4, MAC-p5 are positive sample, and MAC-N1 is negative sample;
Fig. 7 shows the testing result of reference sample in embodiment 4;
Fig. 8 shows that the testing result after interfering substance is added in MTBC sample and MAC sample in embodiment 5;Wherein, Fig. 8 A Sample is MAC positive sample, and the sample of Fig. 8 B is MTBC positive sample.
Specific embodiment
Purposes, technical schemes and advantages in order to better illustrate the present invention, below in conjunction with specific experiment and attached drawing to this Invention is described further.
Unless otherwise defined, all technical and scientific terms used herein and belong to technical field of the invention The normally understood meaning of technical staff is identical.Term as used herein in the specification of the present invention is intended merely to description tool The purpose of the embodiment of body, it is not intended that in the limitation present invention.Term as used herein "and/or" includes one or more phases Any and all combinations of the listed item of pass.
Detect the design of amplimer, Quality Control amplimer, probe, sequence label
A kind of multiple PCR technique expands the guarantor of mycobacterium tuberculosis complex and mycobacterium avium-intracellular complex simultaneously It keeps sequence: being analyzed by sequence, choose mycobacterium tuberculosis complex respectively by many experiments and bird-Mycobacterium intracellulare is multiple Suitable detection amplimer and probe are designed as target amplification region in gregarious specific conservative region, and detection is expanded It is as shown in table 1 to increase primer, Quality Control amplimer, probe, the sequence of label.
Table 1
The preparation and detection of hybond membrane item, kit
Kit of the present invention is the method using PCR amplification combination film chromatography developing while carrying out two kinds of micro- lifes of cause of disease The qualitative detection of object (mycobacterium tuberculosis complex and mycobacterium avium-intracellular complex).Contain nucleosides respectively by a pair Forward and reverse primer of acidity scale label (Tag) and biotin labeling (Biotin) carries out PCR amplification.It is fixed with and marks on C-PAS film item The probe of sequence complete complementary is signed, pcr amplification product can be hybridized by the effect of solution chromatography with the probe on film item at normal temperature And fix, then developed the color by biotin-Streptavidin affinity interaction, show the perceived blue bands of naked eyes, reagent Box testing process is as shown in Figure 1:
1) at 5 ' ends of designed forward primer plus the nucleotide label (MTBC:CGAAGTTCCGA of specificity GATGGCC, MAC:GCAGATTCATTGGTCAGAGAACA), Biotin label (first is used on designed reverse primer Chromogenic label);
2) nucleic acid extraction: using Guangzhou Bao Chuan Bioisystech Co., Ltd produce nucleic acid extraction kit (number of putting on record: Guangdong fringe tool is for No. 20150224), require to operate according to specification, carry out sample nucleic acid extraction: A) the clinical sample being collected into is (such as Sputum sample), by nucleic acid extraction kit, extract the nucleic acid of sample;B) using the nucleic acid of extraction as template, this reagent is utilized Box carries out PCR amplification and detection, and it is as follows to be suitable for PCR instruments, the systems and program of amplification such as ABI:
Reaction system are as follows: (buffer is prewired reagent to 2 × PCR buffer, 10 μ l, and the inside includes the DNA for PCR reaction Polymerase, magnesium ion and buffer), MTBC-MAC primer 5 μ l of 5 μ l, template DNA is uniformly mixed;Tube amplification: 95 DEG C, 2min;95 DEG C, 5s, 60 DEG C, 10s, 35 circulations;It 4 DEG C, saves;
3) gel electrophoresis: configure 1.5% Ago-Gel (weigh 1.5g agarose, the TAE buffer of 100ml be added, It heats in micro-wave oven, until all agaroses all dissolve, when it is cooled to 50~60 DEG C, adds according to 0.01% ratio Enter EB dyestuff, after mixing, pours into cooled and solidified 30min in the plastic plate for being inserted with loading comb, removal loading comb puts gel Enter in TAE buffer and prepare electrophoresis), PCR product is uniformly mixed with sample-loading buffer, 10 μ l of loading;Under conditions of 120V Electrophoresis 30min, gel electrophoresis are taken pictures under ultraviolet light;
4) experimental result is as shown in Figure 2: being expanded using reference material, PCR reaction is normally carried out, and amplified band is obvious, does not have Non-specific amplification generates;
5) prepared by hybond membrane item: nitrocellulose filter (4cm × 20cm) is attached on PVC (polyvinyl chloride) plate (6cm × 20cm), and by blotting paper (2.1cm × 20cm) it is attached in PVC board, has 0.1cm overlapping with nitrocellulose filter;By 3 probes, It is sprayed on nitrocellulose filter with the concentration of 20ng/ μ l and (sprays 200ng probe on each centimetre of film), sprayed between each probe Red locations line (red pad-ink) is to distinguish;Fixed probe is from the bottom up successively on nitrocellulose filter are as follows: for knot The compound group of core mycobacteria, mycobacterium avium-intracellular complex probe and Quality Control probe, the PVC board made is dry at 37 DEG C It is dry overnight, and it is spare to be cut into hybond membrane item (2mm × 6cm);The position of the fixed probe of nitrocellulose filter is as shown in Figure 3: matter Control 0.5mm on probe position line by distance 1, the lower 0.5mm of MAC detection probe position line by distance 2, on the MTBC detection probe position line 3 The spacing of 0.5mm, MTBC detection probe and MAC detection probe is 1cm, and the spacing of MAC detection probe and Quality Control probe is 2cm;
5) hybridize the configuration of developing solution: hybridizing the final concentration of of developing solution contained substance: 100mM HEPPS-Hcl buffer (HEPPS, 4- hydroxyethyl piperazine propane sulfonic acid), pH 8.0;1M sodium chloride, 0.4mM EDTA solution, pH 8.0,1%latex is micro- Ball is connected with Streptavidin on microballoon;
6) hybridization developing solution is mixed with PCR product by 1:1, takes out hybond membrane item and be inserted into corresponding PCR pipe, stands 5 After~15min, latex microballoon will show itself blue when being enriched on hybridizing line;Hybond membrane item is taken out, knot is read Fruit, and take pictures;As shown in figure 3, occurring blue bands above the position line 3 represents the MTBC positive;2 lower section of the position line is close to the position line There are blue bands and represents the MAC positive in 2 position;When test object is negative, only there are blue bands above the position line 1.
Embodiment 1
Experiment sample: taking 12 sputum samples in total to clinical trial unit in two batches, first takes 5 MTBC positive samples This, 1 MTBC negative sample;Second batch equally takes 5 MTBC positive samples, 1 MTBC negative sample.
It is as follows to detect detailed process:
1) nucleic acid extraction: sputum sample sufficiently dissolves washing with the sputum liquefaction agent of 1000 μ l, and sample is placed in 5000rpm In the centrifuge of revolving speed, it is centrifuged 15min, removes supernatant, (Guangdong fringe tool is for 20150224 with nucleic acid extraction kit for gained precipitating Number) sample lysate processing, then according to reagent specification carry out nucleic acid extraction;Finally with 50 μ l distilled water, nucleic acid is eluted, It is spare;
2) PCR amplification, reaction system are as follows: (buffer is prewired reagent to 2 × PCR buffer, 10 μ l, and the inside, which contains, to be used for The archaeal dna polymerase of PCR reaction, magnesium ion and buffer), MTBC-MAC primer 5 μ l of 5 μ l, template DNA is uniformly mixed;With pipe Amplification: 95 DEG C, 2min;95 DEG C, 5s, 60 DEG C, 10s, 35 circulations;It 4 DEG C, saves;
3) hybridization reaction: hybridization developing solution is mixed with PCR product by 1:1, hybond membrane item is taken out and is inserted into corresponding PCR pipe In;After standing 5~15min, takes out hybond membrane item and read as a result, and taking pictures.
As shown in figure 4, MTBC has reached 100% to the detection specificity of clinical sample, it is seen that this kit is for detecting The specificity of mycobacterium tuberculosis complex is very high.
Embodiment 2
Experiment sample: taking 8 sputum samples in total to clinical trial unit in two batches, first takes 1 MTBC feminine gender sample This, 3 MTBC positive samples;Second batch equally takes 1 MTBC negative sample, 3 MTBC positive samples.
It is as follows to detect detailed process:
1) nucleic acid extraction: sputum sample sufficiently dissolves washing with the sputum liquefaction agent of 1000 μ l, and sample is placed in 5000rpm In the centrifuge of revolving speed, it is centrifuged 15min, removes supernatant, (Guangdong fringe tool is for 20150224 with nucleic acid extraction kit for gained precipitating Number) sample lysate processing, then according to reagent specification carry out nucleic acid extraction;Finally with 50 μ l distilled water, nucleic acid is eluted, It is spare;
2) PCR amplification, reaction system are as follows: (buffer is prewired reagent to 2 × PCR buffer, 10 μ l, and the inside, which contains, to be used for The archaeal dna polymerase of PCR reaction, magnesium ion and buffer), MTBC-MAC primer 5 μ l of 5 μ l, template DNA is uniformly mixed;With pipe Amplification: 95 DEG C, 2min;95 DEG C, 5s, 60 DEG C, 10s, 35 circulations;It 4 DEG C, saves;
3) hybridization reaction: hybridization developing solution is mixed with PCR product by 1:1, hybond membrane item is taken out and is inserted into corresponding PCR pipe In;After standing 5~15min, takes out hybond membrane item and read as a result, and taking pictures.
As shown in figure 5, MTBC has reached 100% to the detection specificity of clinical sample, it is seen that this kit is for detecting The specificity of mycobacterium tuberculosis complex is very high.
Embodiment 3
Experiment sample: taking 12 sputum samples in total to clinical trial unit in two batches, first takes 5 MAC positive samples This, 1 MAC negative sample;Second batch equally takes 5 MAC positive samples, 1 MAC negative sample.
It is as follows to detect detailed process:
1) nucleic acid extraction: sputum sample sufficiently dissolves washing with the sputum liquefaction agent of 1000 μ l, and sample is placed in 5000rpm In the centrifuge of revolving speed, it is centrifuged 15min, removes supernatant, (Guangdong fringe tool is for 20150224 with nucleic acid extraction kit for gained precipitating Number) sample lysate processing, then according to reagent specification carry out nucleic acid extraction;Finally with 50 μ l distilled water, nucleic acid is eluted, It is spare;
2) PCR amplification, reaction system are as follows: (buffer is prewired reagent to 2 × PCR buffer, 10 μ l, and the inside, which contains, to be used for The archaeal dna polymerase of PCR reaction, magnesium ion and buffer), MTBC-MAC primer 5 μ l of 5 μ l, template DNA is uniformly mixed;With pipe Amplification: 95 DEG C, 2min;95 DEG C, 5s, 60 DEG C, 10s, 35 circulations;It 4 DEG C, saves;
3) hybridization reaction: hybridization developing solution is mixed with PCR product by 1:1, hybond membrane item is taken out and is inserted into corresponding PCR pipe In;After standing 5~15min, takes out hybond membrane item and read as a result, and taking pictures.
As shown in fig. 6, MAC has reached 100% to the detection specificity of clinical sample, it is seen that this kit is for detecting The specificity of mycobacterium avium-intracellular complex is very high.
Embodiment 4
The configuration of enterprise's reference material: MTBC and MAC National reference is bought at Xiang Guojia reference material center, and uses Guangzhou The nucleic acid extraction kit (Guangdong fringe tool is for No. 20150224) of Bao Chuan Bioisystech Co., Ltd production, step to specifications, Carry out nucleic acid extraction.The nucleic acid of extraction carries out the measurement of nucleic acid concentration using UV detector (NanoDrop-2000), Further according to the concentration of measurement, it is 160ng/ μ l that nucleic acid, which is diluted to concentration, and nucleic acid copies at this time are 1.0 × 105copies/ Ml, then 10 are diluted to distilled water4, 103, 102copies/ml.The reference culture of MTBC and MAC is purchased from Chinese microorganism strain Preservation center carries out nucleic acid extraction and concentration calibration using same method, be respectively configured 5 MAC (be named as A: 105Copies/ml, B:104Copies/ml, C:103Copies/ml, D:102Copies/ml, E:100) and 4 copies/ml MTBC (is named as K:104Copies/ml, L:103Copies/ml, M:102Copies/ml, N:100Copies/ml enterprise) Reference material.
Specific testing process is as follows:
1) nucleic acid extraction: sputum sample sufficiently dissolves washing with the sputum liquefaction agent of 1000 μ l, and sample is placed in 5000rpm In the centrifuge of revolving speed, it is centrifuged 15min, removes supernatant, (Guangdong fringe tool is for 20150224 with nucleic acid extraction kit for gained precipitating Number) sample lysate processing, then according to reagent specification carry out nucleic acid extraction;Finally with 50 μ l distilled water, nucleic acid is eluted, It is spare;
2) PCR amplification, reaction system are as follows: (buffer is prewired reagent to 2 × PCR buffer, 10 μ l, and the inside, which contains, to be used for The archaeal dna polymerase of PCR reaction, magnesium ion and buffer), MTBC-MAC primer 5 μ l of 5 μ l, template DNA is uniformly mixed;With pipe Amplification: 95 DEG C, 2min;95 DEG C, 5s, 60 DEG C, 10s, 35 circulations;It 4 DEG C, saves;
3) hybridization reaction: hybridization developing solution is mixed with PCR product by 1:1, hybond membrane item is taken out and is inserted into corresponding PCR pipe In;After standing 5~15min, takes out hybond membrane item and read as a result, and taking pictures.
As shown in fig. 7, the minimum detectability of MTBC-MAC can achieve 103Copies/ml, it is seen that kit of the present invention Sensitivity for detecting mycobacterium tuberculosis complex and mycobacterium avium-intracellular complex is very high.
Embodiment 5
The interfering substance of use: 1) mouth cleaning solution 10% addition sputum sample sheet, 2) the addition sputum sample sheet of acetum 10%, 3) Sputum sample sheet containing blood, 4) used the sputum sample sheet of antifungal drug, 5) tried out the sputum sample sheet of antibiotic, 6) 1%SDS adds Enter DNA sample, 7) 1% ethyl alcohol is added DNA sample, 8) DNA sample is added in 10%NaCl;Sample includes MTBC sample and MAC sample This.
Above 1~No. 5 sample is the positive sample of clinical confirmation, standby after carrying out DNA extraction using nucleic acid extracting reagent With;6-8 sample is the positive clinical sample of noiseless substance, after extracting DNA, then adds corresponding substance, preparation interference sample This, it is spare.
It is as follows to detect detailed process:
1) nucleic acid extraction: sputum sample sufficiently dissolves washing with the sputum liquefaction agent of 1000 μ l, and sample is placed in 5000rpm In the centrifuge of revolving speed, it is centrifuged 15min, removes supernatant, (Guangdong fringe tool is for 20150224 with nucleic acid extraction kit for gained precipitating Number) sample lysate processing, then according to reagent specification carry out nucleic acid extraction;Finally with 50 μ l distilled water, nucleic acid is eluted, It is spare;
2) PCR reaction system and program are as follows: (buffer is prewired reagent to 2 × PCR buffer, 10 μ l, and the inside contains use In the archaeal dna polymerase of PCR reaction, magnesium ion and buffer), MTBC-MAC primer 5 μ l of 5 μ l, template DNA is uniformly mixed;Together Pipe amplification: 95 DEG C, 2min;95 DEG C, 5s, 60 DEG C, 10s, 35 circulations;It 4 DEG C, saves;
3) hybridization reaction: hybridization developing solution is mixed with PCR product by 1:1, hybond membrane item is taken out and is inserted into corresponding PCR pipe In;After standing 5~15min, takes out hybond membrane item and read as a result, and taking pictures.
As shown in figure 8, the disturbed condition investigated above, does not influence PCR amplification and film hybridization reaction, testing result It is consistent with clinical appraisal result;When detecting mycobacterium tuberculosis complex and mycobacterium avium-intracellular complex, present invention examination Agent box has extremely strong anti-interference ability.
Finally, it should be noted that above embodiments protect the present invention to illustrate technical solution of the present invention The limitation of range, although the invention is described in detail with reference to the preferred embodiments, those skilled in the art should be managed Solution, can modify to technical solution of the present invention or replace on an equal basis, without departing from technical solution of the present invention essence and Range.
SEQUENCE LISTING
<110>Guangzhou Bao Chuan Bioisystech Co., Ltd
<120>kit of M.tuberculosis complex and mycobacterium avium-intracellular complex is detected
<130> 2018.8.13
<160> 15
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>artificial synthesized sequence
<400> 1
tcctctgatg ccagtcctga 20
<210> 2
<211> 20
<212> DNA
<213>artificial synthesized sequence
<400> 2
ggcctccacg aaatccaact 20
<210> 3
<211> 18
<212> DNA
<213>artificial synthesized sequence
<400> 3
cgaagttccg agatggcc 18
<210> 4
<211> 20
<212> DNA
<213>artificial synthesized sequence
<400> 4
tcccgaagag atcaaacgcg 20
<210> 5
<211> 20
<212> DNA
<213>artificial synthesized sequence
<400> 5
acgaaatcca gctgggtctc 20
<210> 6
<211> 23
<212> DNA
<213>artificial synthesized sequence
<400> 6
gcagattcat tggtcagaga aca 23
<210> 7
<211> 20
<212> DNA
<213>artificial synthesized sequence
<400> 7
cagagcacag agacaccact 20
<210> 8
<211> 20
<212> DNA
<213>artificial synthesized sequence
<400> 8
ggcgctcatc ttcattcagg 20
<210> 9
<211> 23
<212> DNA
<213>artificial synthesized sequence
<400> 9
ttagattcat tggtggctag agc 23
<210> 10
<211> 18
<212> DNA
<213>artificial synthesized sequence
<400> 10
ggccatctcg gaacttcg 18
<210> 11
<211> 23
<212> DNA
<213>artificial synthesized sequence
<400> 11
tgttctctga ccaatgaatc tgc 23
<210> 12
<211> 23
<212> DNA
<213>artificial synthesized sequence
<400> 12
gctctagcca ccaatgaatc taa 23
<210> 13
<211> 510
<212> DNA
<213> Mycobacterium tuberculosis
<400> 13
atggcccaaa gggaatgggt cgaaaaagac ttctaccagg agctgggcgt ctcctctgat 60
gccagtcctg aagagatcaa acgtgcctat cggaagttgg cgcgcgacct gcatccggac 120
gcgaacccgg gcaacccggc cgccggcgaa cggttcaagg cggtttcgga ggcgcataac 180
gtgctgtcgg atccggccaa gcgcaaggag tacgacgaaa cccgccgcct gttcgccggc 240
ggcgggttcg gcggccgtcg gttcgacagc ggctttgggg gcgggttcgg cggtttcggg 300
gtcggtggag acggcgccga gttcaacctc aacgacttgt tcgacgccgc cagccgaacc 360
ggcggtacca ccatcggtga cttgttcggt ggcttgttcg gacgcggtgg cagcgcccgt 420
cccagccgcc cgcgacgcgg caacgacctg gagaccgaga ccgagttgga tttcgtggag 480
gccgccaagg gcgtggcgat gccgctgcga 510
<210> 14
<211> 519
<212> DNA
<213> Mycobacterium avium
<400> 14
atggcccagc gtgaatgggt cgaaaaagac ttctacaagg agctgggcgt ctcctctgac 60
gccagtcccg aagagatcaa acgcgcctac cgcaagctgg cgcgcgatct acacccggat 120
gccaatcccg acaatcccgc tgccggcgaa cgattcaagg cggtctccga ggcgcacaac 180
gtgttgtcgg acccggccaa gcgcaaggaa tacgacgaaa cccgaaggct tttcgccggg 240
ggcggtttcg gcgggcgccg gttcgacacc ggtgggttcg gcggcttcaa cgtcggcggg 300
gacggggcgg agttcaacct caacgatttg ttcgacgccg ccggccgcag cggcggcacc 360
aacatcggcg acctgttcgg cggcctgttc gggcgggctt cgggcggccg gcccagccgg 420
ccgcgccgcg gcaacgacct cgagaccgag acccagctgg atttcgtcga ggccgccaag 480
ggcgtggcga tgccgctgcg gctgaccagc ccggcgccg 519
<210> 15
<211> 153
<212> DNA
<213>artificial synthesized sequence
<400> 15
cagagcacag agacaccact gacgtgcctg agatgcctca ctccaagggc cagggagaga 60
gcgatcctct ggaccatgag cctgccgtgt ctccattgct ccctcgaaaa gagcgaggtc 120
ccccggaggg cggcctgaat gaagatgagc gcc 153

Claims (10)

1. a kind of for detecting the MTBC amplimer pair of mycobacterium tuberculosis complex, which is characterized in that MTBC amplimer Pair sequence as shown in SEQ ID NO.1 and SEQ ID NO.2, the forward primer 5 ' of MTBC amplimer pair end be also connected with as The end of reverse primer 5 ' of sequence label shown in SEQ ID NO.3, MTBC amplimer pair is also connected with the first chromogenic label, First chromogenic label can be connected with the second chromogenic label for being combined with microballoon, develop the color after microballoon enrichment.
2. MTBC amplimer pair as described in claim 1, which is characterized in that the first chromogenic label be biotin, second Chromogenic label is Streptavidin, and microballoon is the latex beads that enrichment is displayed in blue.
3. a kind of for detecting the MAC amplimer pair of mycobacterium avium-intracellular complex, which is characterized in that MAC amplification is drawn As shown in SEQ ID NO.4 and SEQ ID NO.5, the end of forward primer 5 ' of MAC amplimer pair is also connected with the sequence of object pair The end of reverse primer 5 ' of the sequence label as shown in SEQ ID NO.6, MAC amplimer pair is also connected with the first revealing label Object, the first chromogenic label can be connected with the second chromogenic label for being combined with microballoon, develop the color after microballoon enrichment.
4. MAC amplimer pair as claimed in claim 3, which is characterized in that the first chromogenic label is biotin, and second is aobvious Color marker object is Streptavidin, and microballoon is the latex beads being displayed in blue after being enriched with.
5. the hybond membrane item for detecting mycobacterium tuberculosis complex and/or mycobacterium avium-intracellular complex, feature exist In being fixed with nitrocellulose membrane on, including polyvinyl chloride panel, polyvinyl chloride panel, following one kind is at least attached on nitrocellulose membrane Probe: the sequence of MTBC detection probe is as shown in SEQ ID NO.10, the sequence of MAC detection probe such as SEQ ID NO.11 institute Show.
6. hybond membrane item as claimed in claim 5, which is characterized in that be also attached with Quality Control probe, Quality Control on nitrocellulose membrane The sequence of probe is as shown in SEQ ID NO.12.
7. hybond membrane item as claimed in claim 6, which is characterized in that nitrocellulose membrane is successively attached with MTBC inspection from the bottom up The spacing of probing needle, MAC detection probe and Quality Control probe, MTBC detection probe and MAC detection probe is 1cm, MAC detection probe Spacing with Quality Control probe is 2cm.
8. a kind of for detecting the kit of mycobacterium tuberculosis complex and/or mycobacterium avium-intracellular complex, feature It is, includes detection amplimer to, hybond membrane item and hybridization developing solution, the hybridization developing solution includes being connected with second to show The microballoon of color marker object develops the color after microballoon enrichment;
Amplimer is detected to including at least following pair of primers: the sequence of MTBC amplimer pair such as SEQ ID NO.1 and SEQ Shown in ID NO.2, the end of forward primer 5 ' of MTBC amplimer pair is also connected with the sequence label as shown in SEQ ID NO.3, The end of reverse primer 5 ' of MTBC amplimer pair is also connected with the first chromogenic label;The sequence of MAC amplimer pair such as SEQ Shown in ID NO.4 and SEQ ID NO.5, the end of forward primer 5 ' of MAC amplimer pair is also connected with as shown in SEQ ID NO.6 Sequence label, MAC amplimer pair reverse primer 5 ' end is also connected with the first chromogenic label;First chromogenic label energy It is connected with the second chromogenic label for being combined with microballoon;
Hybond membrane item includes polyvinyl chloride panel, and nitrocellulose membrane is fixed on polyvinyl chloride panel, is at least adhered on nitrocellulose membrane Have a kind of following probe: the sequence of MTBC detection probe is as shown in SEQ ID NO.10, the sequence of MAC detection probe such as SEQ ID Shown in NO.11.
9. kit as claimed in claim 8, which is characterized in that also packet Quality Control amplimer pair, the Quality Control amplimer Pair sequence as shown in SEQ ID NO.7 and SEQ ID NO.8, the forward primer 5 ' of Quality Control amplimer pair end be also connected with as The end of reverse primer 5 ' of sequence label shown in SEQ ID NO.9, Quality Control amplimer pair is also connected with the first chromogenic label; Quality Control probe is also attached on nitrocellulose membrane, the sequence of Quality Control probe is as shown in SEQ ID NO.12.
10. kit as claimed in claim 8 or 9, which is characterized in that the first chromogenic label is biotin, the second colour developing Marker is Streptavidin, and microballoon is the latex beads being displayed in blue after being enriched with.
CN201811112222.7A 2018-09-21 2018-09-21 Detect the kit of M.tuberculosis complex and mycobacterium avium-intracellular complex Withdrawn CN109439776A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811112222.7A CN109439776A (en) 2018-09-21 2018-09-21 Detect the kit of M.tuberculosis complex and mycobacterium avium-intracellular complex

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811112222.7A CN109439776A (en) 2018-09-21 2018-09-21 Detect the kit of M.tuberculosis complex and mycobacterium avium-intracellular complex

Publications (1)

Publication Number Publication Date
CN109439776A true CN109439776A (en) 2019-03-08

Family

ID=65530688

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811112222.7A Withdrawn CN109439776A (en) 2018-09-21 2018-09-21 Detect the kit of M.tuberculosis complex and mycobacterium avium-intracellular complex

Country Status (1)

Country Link
CN (1) CN109439776A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108531622A (en) * 2017-03-06 2018-09-14 广州市宝创生物技术有限公司 The hybond membrane item and detection kit of mycobacterium tuberculosis complex and the compound group of the extracellular mycobacteria of bird-

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108531622A (en) * 2017-03-06 2018-09-14 广州市宝创生物技术有限公司 The hybond membrane item and detection kit of mycobacterium tuberculosis complex and the compound group of the extracellular mycobacteria of bird-

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108531622A (en) * 2017-03-06 2018-09-14 广州市宝创生物技术有限公司 The hybond membrane item and detection kit of mycobacterium tuberculosis complex and the compound group of the extracellular mycobacteria of bird-

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
郝民忠: "《动物微生物》", 31 August 2007 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108531622A (en) * 2017-03-06 2018-09-14 广州市宝创生物技术有限公司 The hybond membrane item and detection kit of mycobacterium tuberculosis complex and the compound group of the extracellular mycobacteria of bird-
CN108531622B (en) * 2017-03-06 2021-07-20 广州市宝创生物技术有限公司 Hybrid membrane strip and detection kit for mycobacterium tuberculosis complex and avian-intracellular mycobacterium tuberculosis complex

Similar Documents

Publication Publication Date Title
CN109680084A (en) A kind of primed probe and method for the compound group of Fluorescence quantitative PCR detection mycobacterium tuberculosis
CN104212901B (en) Compositions for drug resistance of Staphylococcus aureus detection
CN108048584A (en) The brucellar probe of RAA Fluorometric assays and kit
CN109468395A (en) A kind of primer, kit, detection method and application detecting mycoplasma
Sun et al. The application of IS6110-baced loop-mediated isothermal amplification (LAMP) in the early diagnosis of tuberculous meningitis
CN109957622A (en) It is a kind of detect duck infectious serositis RPA-LFD visualizing agent box and its application
CN104232783B (en) Quick detection method for cow brucella attenuated vaccine strain A19
CN103194536A (en) Nucleic acid chromatography detection kit of Candida albicans, detection method and application thereof
CN101768636B (en) Composition and kit for detecting vibrio cholerae and detection method
CN109337995B (en) PCR detection method and kit for eubacterium terrae and subspecies thereof
CN102776283A (en) Visualized loop-mediated isothermal amplification kit for detecting Haemophilus parasuis
CN102424862B (en) Genotyping chip for legionella pneumophila, and kit for detection of legionella pneumophila
CN109371148A (en) Identify the fluorescent PCR kit and quantitative detecting method of three kinds of porcine respiratory bacteriums
CN109439776A (en) Detect the kit of M.tuberculosis complex and mycobacterium avium-intracellular complex
CN106701983B (en) Gonococcus, microspironema pallidum, chlamydia trachomatis, the hybond membrane bar of ureaplasma urealyticum and detection kit
CN108707697A (en) The LAMP detection primer pair and detection method of Sai Nika paddy viruses
CN108823324A (en) Mycoplasma ovine pneumoniae and Mycoplasma mycoides subsp.capri double fluorescent quantitative method
CN103160587B (en) Genetic typing chip of 10 common pathogenic legionella and detection kit
CN102876774A (en) Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid and detection method of streptococcus pneumonia nucleic acid
CN105219847B (en) A kind of Legionella quick detection and parting kit and its detection method
CN106967826A (en) A kind of people&#39;s umbilical cord, placenta protection liquid detection of mycoplasma primer pair, kit and its detection method
Kamusoko et al. Purification and Amplification of DNA from cellulolytic Bacteria: Application for Biogas production from crop residues
CN100449005C (en) Multiple fluorescence PCR detection reagent for detecting pathogenicity of streptococcus suis serotype 2 and method
CN104846067A (en) Duplex PCR detection kit and detection method for Listeria monocytogenes and Enterococcus faecium
CN108531622B (en) Hybrid membrane strip and detection kit for mycobacterium tuberculosis complex and avian-intracellular mycobacterium tuberculosis complex

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WW01 Invention patent application withdrawn after publication

Application publication date: 20190308

WW01 Invention patent application withdrawn after publication