CN106591497A - Fluorescent LAMP primer for detecting infectious hematopoietic necrosis virus of fish - Google Patents
Fluorescent LAMP primer for detecting infectious hematopoietic necrosis virus of fish Download PDFInfo
- Publication number
- CN106591497A CN106591497A CN201710100750.XA CN201710100750A CN106591497A CN 106591497 A CN106591497 A CN 106591497A CN 201710100750 A CN201710100750 A CN 201710100750A CN 106591497 A CN106591497 A CN 106591497A
- Authority
- CN
- China
- Prior art keywords
- primer
- hematopoietic necrosis
- infectious hematopoietic
- fish
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a fluorescent LAMP primer for detecting infectious hematopoietic necrosis virus of a fish, sequences of the fluorescent LAMP primer for detecting the infectious hematopoietic necrosis virus of the fish are shown as follows: SEQIDNO:1, SEQIDNO:2, SEQIDNO:3, SEQIDNO:4, SEQIDNO:5 and SEQIDNO:6. A fluorescent LAMP detection technology is established by introduction of a fluorescent dye based on an original LAMP technology, due to the use of instruments for fluorescence collection, the detection sensitivity is further improved, the fluorescent LAMP detection technology is more objective and more convenient to operate, and the fluorescent LAMP detection technology is easy to standardize and easy to popularize and use.
Description
Technical field
It is the invention belongs to fish infectious hematopoietic necrosis poison detection technique field more particularly to a kind of for detecting fish
Infectious hematopoietic necrosis' poison fluorescence LAMP primer.
Background technology
Infectious hematopoietic necrosis' poison (Infectious hematopoietic necrosis virus, IHNV)
It is a kind of important kinds of fish Rhabdovirus for affecting culture fishery.IHNV belongs to the outer Rhabdovirus of grain
(Novirhabddovirus), be cause infectious hematopoietic necrosis cause of disease, main infection salmon, trout class.The virus
It is distributed widely in many areas in Europe, America and Asia, belongs to acute, hemorrhagic, high mortal viral disease, can infects various
Fish, cause light, sea-farming diversified economy fish happening and prevelence venereal disease to do harm to, especially to fry and juvenile fish, can cause compared with
The high death rate, can reach more than 90% when serious.The fish infectious hematopoietic necrosis that the virus causes
(Infectious hematopoietic necrosis, IHN) once break out, it will to bringing on a disaster property of culture fishery
Loss, being classified as by International Animal Health tissue (Office international des epizooties, OIE) must Shen
The epidemic disease of report,《The inward animal quarantine epidemic disease register of the People's Republic of China (PRC)》(joint bulletin the 2013rd) is classified as the infection of two classes
Disease, parasitic disease.Still lack the active drug and method of control virosis at present, transport with the far way of the fry without quarantine, make
Virus host range and geographical distribution are in expansion situation.The strategy generally taken in the world is once find the disease, to carry out rapidly
Sick fish isolation is slaughtered, so as to control the sick large-scale outbreak.IHN is the fish epidemic disease that countries in the world actively carry out anti-system.
At present, conventional method for detecting virus is cell culture isolated viral method, serological method and polymerase chain reaction (PCR).
Cell culture isolated viral method reliable results, but detection cycle is long, is not suitable for rapid differential diagnosis, and often also need to it
He carries out subsequent detection at method, just can determine that viral species.The application of regular-PCR technology, improves the specific and spirit of detection
Sensitivity, shortens detection time, achieves certain effect.Williams etc. also reported and uses multiple RT-PCR for (1999)
The research of detection IPNV, IHNV and VHSV, substantially increases operating efficiency during various Viral diagnosis.But regular-PCR method
Detection virus, needs follow-up processing procedure, and complex steps are time-consuming also longer, especially when detecting several viral, work
Measure still larger.The development of real-time fluorescence RT-PCR technology, makes virus detection techniques obtain further raising, this detection
Technology is also applied in the detection of IHNV, VHSV and SVCV.Real-time fluorescence RT-PCR technology further increases the spy of detection
The opposite sex, sensitivity, reduce workload, improve operating efficiency, but also can carry out quantitative determination to purpose fragment, but glimmering
Light RT-PCR is due to the fluorescence probe for using, and its cost is high compared with regular-PCR.
In sum, current fish infectious hematopoietic necrosis virus detection method long, the complex steps that there is detection cycle,
Workload is larger, relatively costly.
The content of the invention
It is an object of the invention to provide it is a kind of for detecting fish infectious hematopoietic necrosis poison fluorescence LAMP primer,
Long, the complex steps that aim to solve the problem that current fish infectious hematopoietic necrosis poison monitoring method has a detection cycle, workload compared with
Greatly, relatively costly problem.
The present invention is achieved in that one kind for detecting fish infectious hematopoietic necrosis poison fluorescence LAMP primer,
The sequence for detecting fish infectious hematopoietic necrosis poison fluorescence LAMP primer is：SEQ ID NO：1、SEQ ID
NO：2、SEQ ID NO：3、SEQ ID NO：4、SEQ ID NO：5、SEQ ID NO：6.
Fish infectious hematopoietic necrosis poison fluorescence is detected another object of the present invention is to provide and be used for described in one kind
The method for designing of LAMP primer, the method for designing is comprised the following steps：
According to LAMP primer design principle, according to IHNV genome sequences are downloaded in GenBank databases, multisequencing is carried out
Compare, find one section of conservative gene of IHNV as amplification object, then set by molecular biology software LAMP Designer
Meter primer；Using HPLC way of purification；Primer after synthesis DEPC water is diluted to 100 μm of ol/L solution, and -20 DEG C of preservations are standby
With.
Another object of the present invention is to providing one kind utilizes described for detecting fish infectious hematopoietic necrosis poison
The detection method of the fish infectious hematopoietic necrosis poison of fluorescence LAMP primer, the fish infectious hematopoietic necrosis poison
Detection method comprise the following steps：
Step one, the nucleic acid extraction of sample：According to nucleic acid extraction kit Mag-BindViral DNA/RNA Kit200
Specification extracts sample nucleic；
Step 2, into assignment system in reaction tube：LAMP reaction systems cumulative volume is 25 μ L, wherein 2 × Taq reactant liquor RM
The each 1.0 μ L of each 1.0 μ L of 12.5 μ L, inner primer FIP, BIP40 μm ol/L, ring primer LF and LB, outer primer F3, B35 μm ol/L are each
The μ L of 1.0 μ L, Bst DNApolymerase 0.8, the μ L of reverse transcriptase 0.2, the μ L of fluorescent dye 0.5, the μ L of viral nucleic acid 2.0, moisturizing
To 25.0 μ L；Finally plus 20.0 μ L confining liquid with avoid system volatilize and product pollution；
Step 3, instrument detection：Reaction condition is adjusted to 63 DEG C of 30s of holding stage, 1 circulation on fluorescent PCR instrument；Follow
63 DEG C of 15s of loop order section, 63 DEG C of 45s, 60 circulations；Fluorescence signal is collected at 63 DEG C of 45s, fluorescence channel elects FAM as.
Provided by the present invention for detecting fish infectious hematopoietic necrosis poison fluorescence LAMP primer.It is intended to set up a kind of
Quickly, infectious hematopoietic necrosis' virus detection method accurate, simple to operation；Loop-mediated isothermal amplification technique (1oop-
Mediated isothermal amplification, LAMP) it is a kind of new core in report in 2000 such as Japanese Notomi
Sour amplification technique.Compared with traditional amplification technique, it is specific higher that the technology is expanded, and course of reaction only need to be at 60～65 DEG C
Constant temperature under 30～60min can complete, it is not necessary to thermal cycle.Due to test tube cap need not be opened in course of reaction, because
This greatly reduces the possibility of laboratory pollution, and high and easily operated etc. with reproducible, Non-specific strong, susceptibility
Feature.The present invention is to introduce fluorescent dye on the basis of original LAMP technology, fluorescence LAMP detection techniques is established, due to making
Phosphor collection is carried out with instrument, the sensitivity of detection is further improved, more objective, operation is easier, easily by method mark
Standardization, it is easy to promote the use of.
Description of the drawings
Fig. 1 is the detection method flow process for detecting fish infectious hematopoietic necrosis poison provided in an embodiment of the present invention
Figure.
Fig. 2 is that real-time fluorescence LAMP detections IHNV methods provided in an embodiment of the present invention set up schematic diagram；
In figure：P positive controls；N：Negative control.
Fig. 3 is LAMP method specific test schematic diagram provided in an embodiment of the present invention；
In figure：1-10：Fish tissues sample；N：Negative control；P：Positive control.
Fig. 4 is LAMP method sensitivity technique schematic diagram provided in an embodiment of the present invention；
In figure：1-9：Copy number gradient is followed successively by 109、108、107、106、105、104、103、102、101；N：Negative control.
Fig. 5 is the schematic diagram of detection method stability test 1 provided in an embodiment of the present invention.
Fig. 6 is the schematic diagram of detection method stability test 2 provided in an embodiment of the present invention.
Fig. 7 is sample detection result schematic diagram provided in an embodiment of the present invention.
Specific embodiment
In order that the objects, technical solutions and advantages of the present invention become more apparent, with reference to embodiments, to the present invention
It is further elaborated.It should be appreciated that specific embodiment described herein is not used to only to explain the present invention
Limit the present invention.
The application principle of the present invention is explained in detail below in conjunction with the accompanying drawings.
Sequence for detecting fish infectious hematopoietic necrosis poison fluorescence LAMP primer provided in an embodiment of the present invention
For：
SEQ ID NO：1
FIP GCCTCTGCTACGATCCTCATCGCATGAAGTCAGTGGTGG
SEQ ID NO：2
BIP GTACGGTGTCATGATGAGCAGGCTGGCGTTCTCGTTGATC
SEQ ID NO：3
F3GGACTGTTCAACCAAGCC
SEQ ID NO：4
B3ATCGTCATACCTATCGTTGATG
SEQ ID NO：5
LF AGTCTGACAATGCGTCTGG
SEQ ID NO：6
LB GGTACTTCAAGGCCTACGG
As shown in figure 1, the detection side for detecting fish infectious hematopoietic necrosis poison provided in an embodiment of the present invention
Method is comprised the following steps：
S101：The nucleic acid extraction of sample：Say according to nucleic acid extraction kit Mag-BindViral DNA/RNAKit (200)
Bright book extracts sample nucleic；
S102：Into assignment system in reaction tube：LAMP reaction systems cumulative volume is 25 μ L, wherein 2 × Taq reactant liquor RM
The each 1.0 μ L of each 1.0 μ L of 12.5 μ L, inner primer FIP, BIP40 μm ol/L, ring primer LF and LB, outer primer F3, B35 μm ol/L are each
The μ L of 1.0 μ L, Bst DNApolymerase 0.8, the μ L of reverse transcriptase 0.2, the μ L of fluorescent dye 0.5, the μ L of viral nucleic acid 2.0, moisturizing
To 25.0 μ L.Finally plus 20.0 μ L confining liquid with avoid system volatilize and product pollution；
S103：Instrument is detected：Reaction condition is adjusted to 63 DEG C of 30s of holding stage, 1 circulation on fluorescent PCR instrument；Circulation
63 DEG C of 15s of stage, 63 DEG C of 45s, 60 circulations；Fluorescence signal is collected at 63 DEG C of 45s, fluorescence channel elects FAM as.
The application principle of the present invention is further described with reference to experiment.
1 infectious hematopoietic necrosis poison (IHNV) real-time fluorescence LAMP detection method
1.1 test materials and instrument
1.1.1 cause of disease
Infectious hematopoietic necrosis' poison (IHNV) and carp spring virus (SVCV) are inactivation antigen, from OIE with reference to real
Yan Shi Shenzhen Entry-Exit Inspection and Quarantine Bureau aquatic animal Quarantine Lab.
1.1.2 sample
Totally 10 parts of the fish tissues sample that laboratory preserves, purchased from market, protects by this laboratory collection and in -20 DEG C of refrigerators
Hide.
1.1.3 main agents
Nucleic acid constant-temperature amplification kit is purchased from Guangzhou Di Ao Bioisystech Co., Ltd；Nucleic acid extraction kit Mag-
BindViral DNA/RNAKit (200) are purchased from OMEGA companies.
1.1.4 key instrument
ABI 7500Fast Real-Time PCR System, ViiA 7Real-Time PCR System, are the U.S.
Applied Biosystems Products.SIGMA 3-18K miniature high-speeds freeze desk centrifuge, are German Sartorius
Products.NanoDrop ND-1000Spectrophotometer ultraviolet specrophotometers, are U.S. NanoDrop
Technologies Products.Alpha Imager HP Labworks image acquisition and analysis softwares, are Alpha Innotech companies of the U.S.
Product.
1.2 method
1.2.1 LAMP primer design
According to LAMP primer design principle, according to IHNV genome sequences are downloaded in GenBank databases, multisequencing is carried out
Compare, find one section of conservative gene of IHNV as amplification object, then set by molecular biology software LAMP Designer
Meter primer.Primer is synthesized by Shanghai Hui Rui bio tech ltd, using HPLC way of purification.Primer DEPC after synthesis
Water is diluted to 100 μm of ol/L solution, and -20 DEG C save backup.Primer sequence is shown in Table 1.
The infectious hematopoietic necrosis of table 1 poison LAMP primer
1.2.2 the nucleic acid extraction of sample
Sample nucleic is extracted according to nucleic acid extraction kit Mag-BindViral DNA/RNAKit (200) specification.
1.2.3 reaction system
LAMP reaction systems cumulative volume is 25 μ L：The μ L of 2 × Taq reactant liquors RM 12.5,40 μm of ol/L of inner primer FIP, BIP
The each 1.0 μ L of each 1.0 μ L, ring primer LF and LB, each 1.0 μ L of outer primer F3, B35 μm ol/L, the μ of Bst DNApolymerase 0.8
L, the μ L of reverse transcriptase 0.2, the μ L of fluorescent dye 0.5, the μ L of RNA template 2.0, moisturizing to 25.0 μ L.Finally plus 20.0 μ L confining liquid
To avoid system from volatilizing and product pollution.
1.2.4 P reaction condition optimizations
According to the suitable reaction temperature of the Tm values and Bst enzymes of the primer of design, this research is placed in 60 DEG C to 65 DEG C to reaction
Reaction environment in and with 1 DEG C be incremented by be optimized, from be repeated several times test in determine optimal reaction temperature.Finally in fluorescence
Reaction condition is adjusted to 63 DEG C of 30s of holding stage, 1 circulation in PCR instrument；63 DEG C of 15s of cycle stage, 63 DEG C of 45s, 60 are followed
Ring；Fluorescence signal is collected at 63 DEG C of 45s, fluorescence channel elects FAM as.
1.2.5 sensitivity technique
F3/B3 PCR primers are cloned into into carrier, as positive criteria product.It is dense plasmid to be determined with ultraviolet specrophotometer
Degree, according to Avogadro's number the copy number of genes of interest is scaled, and multiple proportions is carried out in units of 10 to positive criteria product dilute
Release, be 10 by the concentration for obtaining99 templates to 10 carry out LAMP amplifications using above-mentioned reaction system and reaction condition, to test
The sensitivity of the designed primer of card and institute's method for building up.
1.2.6 specific detection
With 1 part of carp spring virus, 1 part of RNA extracted added with infectious hematopoietic necrosis' poison as template, using above-mentioned anti-
System and reaction condition is answered to carry out LAMP amplifications, to verify the specificity of designed primer and institute's method for building up.
1.2.7 stability test
Take 105The positive control plasmid of concentration, interval is tested twice for 1 month, and 20 repetitions are done every time.Statistic mixed-state
As a result the difference between.
1.2.8 sample detection
Using 10 parts of fish tissues of purchase, after extracting nucleic acid, detected using the real-time fluorescence LAMP method set up.
1.3 results and analysis
1.3.1 detection method is set up
This experiment utilizes real-time fluorescence method, fluorescent PCR instrument FAM passages to collect fluorescence to carry out Real Time Observation to experiment.Knot
Fruit shows that positive control amplification curve occurs in 13min or so, and fluorescence increases obvious, and negative control fluorescent value is without significantly change
Change.See Fig. 2.
1.3.2 detection method specific test
The RNA of sample extraction is carried out into real-time fluorescence LAMP detections, is as a result shown, SVCV has outside obvious amplification curve,
Without amplification, curve is in smooth shape to IHNV substantially, sees Fig. 3.
1.3.3 detection method sensitivity test
By the plasmid for having diluted according to above-mentioned reaction system and reaction condition, with fluorescent PCR instrument FAM passages fluorescence receipts are carried out
Collection, the minimal detectable concentration of discovery method detection has reached 102The order of magnitude of individual copy, is shown in Fig. 4.
1.3.4 detection method stability test
The time point for fluorescence growth occur in criticizing and between criticizing carries out statistical analysis, and twice variation within batch coefficient is respectively
2.6% and 4.7%, interassay coefficient of variation is 4.8%, batch in and batch between the coefficient of variation be respectively less than 5%, show test stability
Preferably, Fig. 5 and Fig. 6 is seen.
1.3.5 sample detection
As shown in fig. 7, the testing result of 10 parts of samples is feminine gender.
Presently preferred embodiments of the present invention is the foregoing is only, not to limit the present invention, all essences in the present invention
Any modification, equivalent and improvement made within god and principle etc., should be included within the scope of the present invention.
<110>Inspection ＆ Quarantine Technology Center of Zhuhai Entry-Exit Inspection ＆ Quarantine Bureau
<120>For detecting the fluorescence LAMP primer of fish infectious hematopoietic necrosis poison
<160> 6
<210> 1
<211> 39
<212> DNA
<213>Artificial sequence
<400>Nucleotide sequence
GCCTCTGCTACGATCCTCATCGCATGAAGTCAGTGGTGG
<210> 2
<211>40
<212> DNA
<213>Artificial sequence
<400>Nucleotide sequence
GTACGGTGTCATGATGAGCAGGCTGGCGTTCTCGTTGATC
<210> 3
<211>18
<212> DNA
<213>Artificial sequence
<400>Nucleotide sequence
GGACTGTTCAACCAAGCC
<210> 4
<211>22
<212> DNA
<213>Artificial sequence
<400>Nucleotide sequence
ATCGTCATACCTATCGTTGATG
<210> 5
<211>19
<212> DNA
<213>Artificial sequence
<400>Nucleotide sequence
AGTCTGACAATGCGTCTGG
<210> 6
<211>19
<212> DNA
<213>Artificial sequence
<400>Nucleotide sequence
GGTACTTCAAGGCCTACGG
Claims (3)
1. it is a kind of for detect fish infectious hematopoietic necrosis poison fluorescence LAMP primer, it is characterised in that it is described to be used for
The sequence of detection fish infectious hematopoietic necrosis poison fluorescence LAMP primer is：SEQ ID NO：1、SEQ ID NO：2、SEQ
ID NO：3、SEQ ID NO：4、SEQ ID NO：5、SEQ ID NO：6.
2. a kind of synthesis side for being used to detect fish infectious hematopoietic necrosis poison fluorescence LAMP primer as claimed in claim 1
Method, it is characterised in that the synthetic method is comprised the following steps：
According to LAMP primer design principle, according to IHNV genome sequences are downloaded in GenBank databases, multisequencing ratio is carried out
It is right, one section of conservative gene of IHNV is found as amplification object, then by molecular biology software LAMP Designer
1.1.4 primer is designed；Using HPLC way of purification；Primer after synthesis DEPC water is diluted to 100 μm of ol/L solution, -20 DEG C
Save backup.
3. it is a kind of to utilize the fish for being used to detect fish infectious hematopoietic necrosis poison fluorescence LAMP primer described in claim 1 to pass
The detection method of metachromia hematopoietic necrosis virus, it is characterised in that the detection of the fish infectious hematopoietic necrosis poison
Method is comprised the following steps：
Step one, the nucleic acid extraction of sample：According to nucleic acid extraction kit Mag-BindViral DNA/RNA Kit200 explanations
Book extracts sample nucleic；
Step 2, into assignment system in reaction tube：LAMP reaction systems cumulative volume is 25 μ L, wherein the μ of 2 × Taq reactant liquors RM 12.5
The each 1.0 μ L of each 1.0 μ L of 40 μm of ol/L of L, inner primer FIP, BIP, ring primer LF and LB, each 1.0 μ of 5 μm of ol/L of outer primer F3, B3
The μ L of L, Bst DNA polymerase 0.8, the μ L of reverse transcriptase 0.2, the μ L of fluorescent dye 0.5, the μ L of viral nucleic acid 2.0, moisturizing is extremely
25.0μL；Finally plus 20.0 μ L confining liquid with avoid system volatilize and product pollution；
Step 3, instrument detection：Reaction condition is adjusted to 63 DEG C of 30s of holding stage, 1 circulation on fluorescent PCR instrument；Circulation rank
Section 63 DEG C of 15s, 63 DEG C of 45s, 60 circulations；Fluorescence signal is collected at 63 DEG C of 45s, fluorescence channel elects FAM as.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710100750.XA CN106591497A (en) | 2017-02-23 | 2017-02-23 | Fluorescent LAMP primer for detecting infectious hematopoietic necrosis virus of fish |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710100750.XA CN106591497A (en) | 2017-02-23 | 2017-02-23 | Fluorescent LAMP primer for detecting infectious hematopoietic necrosis virus of fish |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106591497A true CN106591497A (en) | 2017-04-26 |
Family
ID=58587842
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710100750.XA Pending CN106591497A (en) | 2017-02-23 | 2017-02-23 | Fluorescent LAMP primer for detecting infectious hematopoietic necrosis virus of fish |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591497A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795705A (en) * | 2021-03-12 | 2021-05-14 | 长沙海关技术中心 | Primer and kit for efficient triple detection of SVCV, IHNV and CEV |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103525951A (en) * | 2013-10-24 | 2014-01-22 | 中国水产科学研究院黑龙江水产研究所 | LAMP (Loop-Mediated Isothermal Amplification) primer used for detecting infectious haematopoietic necrosis virus and application thereof |
| CN105296669A (en) * | 2015-11-02 | 2016-02-03 | 东莞出入境检验检疫局检验检疫综合技术中心 | RT-LAMP detection primer pairs, kit and detection method for infectious haematopoietic necrosis virus (IHNV) |
| CN109487004A (en) * | 2018-12-03 | 2019-03-19 | 梁君妮 | The method for detecting fishes infectious hematopoietic necrosis virus based on RPA |
-
2017
- 2017-02-23 CN CN201710100750.XA patent/CN106591497A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103525951A (en) * | 2013-10-24 | 2014-01-22 | 中国水产科学研究院黑龙江水产研究所 | LAMP (Loop-Mediated Isothermal Amplification) primer used for detecting infectious haematopoietic necrosis virus and application thereof |
| CN105296669A (en) * | 2015-11-02 | 2016-02-03 | 东莞出入境检验检疫局检验检疫综合技术中心 | RT-LAMP detection primer pairs, kit and detection method for infectious haematopoietic necrosis virus (IHNV) |
| CN109487004A (en) * | 2018-12-03 | 2019-03-19 | 梁君妮 | The method for detecting fishes infectious hematopoietic necrosis virus based on RPA |
Non-Patent Citations (2)
| Title |
|---|
| BREMONT,M. ET AL.: "Infectious hematopoietic necrosis virus isolate IHNVN1G2 nucleoprotein, glycoprotein, matrix, and phosphoprotein genes, complete cds", 《GENBANK DATABASE》 * |
| 谭贵良等: "《现代分子生物学及组学技术在食品安全检测中的应用》", 30 June 2014 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112795705A (en) * | 2021-03-12 | 2021-05-14 | 长沙海关技术中心 | Primer and kit for efficient triple detection of SVCV, IHNV and CEV |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108950069A (en) | Ox lumpy skin disease virus street strain TaqMan-MGB real-time fluorescence quantitative PCR detection primer, kit and detection method | |
| WO2016082691A1 (en) | Kit for rt-pcr detection of chikungunya and test method thereof | |
| CN103131798A (en) | Norovirus real-time fluorescent RT-PCR detection kit and application thereof | |
| CN108866244A (en) | Detect RPA primer and probe, kit and its method of prawn irido virus | |
| CN107828914A (en) | Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent | |
| CN105112564A (en) | Method and kit for detecting high-risk HPV (human papillomavirus) E6/E7 mRNA (messenger ribonucleic acid) by ligase | |
| CN106350609A (en) | Reagent and detection method for detecting vesicular stomatitis virus, and applications | |
| CN106755572A (en) | I types DHV and duck plague virus double fluorescent quantitative PCR method | |
| CN113046484B (en) | Primer probe, kit and method for detecting African swine fever virus p72 gene | |
| CN104673936A (en) | RT-qPCR detection method and primers and TaqMan probe for detecting swine transmissible gastroenteritis virus N gene | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| CN106048097A (en) | Specific primers and method for real-time fluorescent quantitative PCR detection of tomato chlorosis virus | |
| CN106119423A (en) | The general PCR primer of detection Avianreovirus and detection kit thereof | |
| CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
| CN101386893B (en) | Single cell real time fluorescent quantitative RT-PCR method for detecting foot-and-mouth disease virus genome RNA | |
| CN106755598A (en) | Fluorescence LAMP primer and its detection method for detecting shrimp cream head disease virus | |
| CN105238880A (en) | Enterovirus real-time fluorescent quantitative detection kit | |
| CN106435020B (en) | For detecting the universal kit of different genotype infectious bronchitis virus | |
| CN110257561B (en) | Reagent for detecting deer epidemic hemorrhagic fever virus, detection method and application | |
| CN107190103A (en) | Multiple PCR primer group, kit and the method for three kinds of fishes virus are detected simultaneously | |
| CN106591497A (en) | Fluorescent LAMP primer for detecting infectious hematopoietic necrosis virus of fish | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN106048080A (en) | Primer and method for rapidly screening HPV (human papillomavirus) sub-types | |
| CN108676922A (en) | Primer and probe for detecting Porcine epidemic diarrhea virus street strain and TaqMan real time fluorescence quantifying PCR methods | |
| CN107267666A (en) | A kind of fluorescent quantitation RT PCR detection kits based on pig atypia pestivirus raq gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170426 |
|
| RJ01 | Rejection of invention patent application after publication |