CN109837332A - One Yeasts bacterium colony rapid PCR amplification kit and the method for utilizing this kit PCR amplification saccharomycete bacterium colony - Google Patents

One Yeasts bacterium colony rapid PCR amplification kit and the method for utilizing this kit PCR amplification saccharomycete bacterium colony Download PDF

Info

Publication number
CN109837332A
CN109837332A CN201910126305.XA CN201910126305A CN109837332A CN 109837332 A CN109837332 A CN 109837332A CN 201910126305 A CN201910126305 A CN 201910126305A CN 109837332 A CN109837332 A CN 109837332A
Authority
CN
China
Prior art keywords
pcr amplification
bacterium colony
pcr
kit
saccharomycete
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910126305.XA
Other languages
Chinese (zh)
Inventor
周辉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Rui Rui Biological Technology Co Ltd
Original Assignee
Guangzhou Rui Rui Biological Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Rui Rui Biological Technology Co Ltd filed Critical Guangzhou Rui Rui Biological Technology Co Ltd
Publication of CN109837332A publication Critical patent/CN109837332A/en
Pending legal-status Critical Current

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a Yeasts bacterium colony rapid PCR amplification kit and utilize the method for this kit PCR amplification saccharomycete bacterium colony.Shown kit includes: 10 × cell pyrolysis liquid, 10 × PCR reaction solution, dNTP, hot start Taq polymerase.Compared with currently available technology, which needs not move through heating and boils, phenol/chloroform extraction genome and etc., reduce the murder by poisoning to experimenter of noxious material;Operation of the present invention is quick, easy, saves a large amount of time;Direct Pyrolysis monoclonal colonies of the present invention reduce cross contamination, non-false positive;By using the cell wall lysate of high PH, yeast cell wall can effectively be cracked in a short time, sufficiently release Yeast genome, its pH value is in the optimum range of PCR amplification, it can be achieved that PCR rapid amplifying after the supernatant after release is mixed with matched PCR reaction solution.

Description

One Yeasts bacterium colony rapid PCR amplification kit and utilize this kit PCR amplification The method of saccharomycete bacterium colony
Technical field
The invention belongs to technical field of bioengineering, and in particular to a Yeasts bacterium colony rapid PCR amplification kit and Utilize the method for this kit PCR amplification saccharomycete bacterium colony.
Background technique
Saccharomycete is a kind of fungi microbe, widely distributed in nature, belongs to typical amphimicrobe, Sugar can be fermented into alcohol and the titanium dioxide pool, be widely used in field of food, secondly the engineering bacteria important as one kind, Molecule field is widely used, such as molecular cloning field is as eucaryote recipient cell.In yeast molecular cloning, to ferment Female bacterium carry out needing to carry out PCR after the conversion of foreign gene with verify foreign gene whether successful conversion.Traditional bacterium carries out When bacterium colony PCR, can the single colonie or bacterium solution of directly picking bacterium carry out, but saccharomycete is different from bacterium, cell wall Broken wall is difficult, deals with the insufficient PCR amplification that will result in of genome release improperly and fails.
When carrying out PCR amplification to saccharomycete gene, traditional method is after extracting to the total genome of saccharomycete PCR amplification is carried out again, the relatively high genome of this available purity of method carries out PCR amplification and expanding effect is ideal, But it is directed to the conversion ratio of saccharomycete, researcher may need to carry out screening and identification to more bacterium colony, extract genome not It can only take a substantial amount of time, increase experimental cost, and during genome extracts, since sample is more, operation is slightly It will result in the cross contamination between sample accidentally, bring puzzlement to subsequent experimental.
Currently, yeast colony PCR technical application is relatively broad, the tedious steps for extracting genome are eliminated, mainly The processing of cell wall, including multigelation broken wall method, collagenase treatment method are carried out to saccharomycete in advance, high-temperature cooking process extends PCR initial denaturation time etc., though treated that saccharomycete can effectively carry out PCR amplification for these methods, when pretreated Between it is also relatively long, it is cumbersome, stability with amplification also need further to be promoted.
Summary of the invention
In order to solve the above technical problems, the present invention provides a Yeasts bacterium colony rapid PCR amplification kit and utilizations The method of this kit PCR amplification saccharomycete bacterium colony.Saccharomycete colony PCR amplification can quickly be carried out by developing one kind, and be grasped Make simply, as a result the good method of stability.
The technical scheme adopted by the invention is as follows:
One Yeasts bacterium colony rapid PCR amplification kit, the kit include: 10 × cell pyrolysis liquid, 10 × PCR reaction solution, dNTP, hot start Taq polymerase.
10 × cell pyrolysis liquid ingredient are as follows: contain in 10 × cell pyrolysis liquid of 1L: 10-50mM KOH, 0.5- The lauryl sodium sulfate of 2.5% (w/v), 20-60% polyethylene glycol 200 (v/v)
Further, the 10X cell pyrolysis liquid ingredient is preferred are as follows: contains in 10 × cell pyrolysis liquid of 1L: 20mM's KOH, 1.5% (w/v) lauryl sodium sulfate, 60% polyethylene glycol 200 (v/v).
10 × PCR reaction solution ingredient are as follows: contain in 10 × PCR reaction solution of 1L:: 100mM Tris-HCl, 500mM KCl, 15mM MgCl2, 0.01% (w/v) gelatin, 0.1% (v/v) Triton X-100;The 10X PCR reaction solution PH be 8.3.
The present invention also provides utilize the saccharomycete bacterium colony rapid PCR amplification kit PCR amplification saccharomycete bacterium colony Method, the described method comprises the following steps:
(1) saccharomycete single colonie culture solution is taken;
(2) yeast cell is cracked;
(3) saccharomycete genomic DNA carries out PCR amplification;
(4) PCR product observes amplification through 1% agarose gel electrophoresis.
Further, in the step (3), pcr amplification reaction system are as follows: 10 × PCR reaction solution 2.5 μ L, 2.5mM DNTP 2.5 μ L, 10 μm of 1 μ L of ol upstream and downstream primer, 2.5 μ L supernatants, 1 μ L hot start Taq polymerase are mended using distilled water to 25 μ L。
Further, in the step (3), PCR reaction condition are as follows:
It is specifically included in the step (4): preparing 1% Ago-Gel, PCR amplification liquid is added in well, connected Electrophoresis apparatus power supply, electrophoretic parameters: then 70V, 30min observe amplification on ultraviolet visualizer.
Compared with currently available technology, which needs not move through heating in use and boils, phenol/chloroform etc. The step of extracting genome reduces murder by poisoning of the noxious material to experimenter;Operation of the present invention is quick, easy, saves a large amount of Time;Direct Pyrolysis monoclonal colonies of the present invention reduce cross contamination, non-false positive;It is split by using the cell wall of high PH Liquid is solved, yeast cell wall effectively can be cracked in a short time, sufficiently release Yeast genome, it is upper after release Its pH value is in the optimum range of PCR amplification, it can be achieved that PCR rapid amplifying after clear liquid is mixed with matched PCR reaction solution.Tool Body is as follows:
(1) operation is quick, easy, saves a large amount of time, easily promotes the use of.
(2) need not move through heating to boil, the genomes extraction step such as phenol/chloroform, reduce noxious material to experiment The murder by poisoning of personnel, the supernatant of extracting solution can be directly used as the template of PCR reaction, simple and quick preparation high-volume PCR inspection The template of survey, it is only necessary to micro sample;
(3) Direct Pyrolysis monoclonal colonies reduce cross contamination, non-false positive;
(4) by using the cell wall lysate of high PH, yeast cell wall can be carried out in a short time effective Cracking, sufficiently release Yeast genome, its pH value is in PCR amplification after the supernatant after release is mixed with matched PCR reaction solution Optimum range in, it can be achieved that PCR rapid amplifying.
Detailed description of the invention
Fig. 1 is the PCR amplification result of Pichia pastoris GS115 bacterium colony GAP gene in embodiment 2;
Fig. 2 is Pichia pastoris GS115 external source pYES2-GFP Vector PCR amplification result in embodiment 3.
Fig. 3 is that the present invention is compared with the heated amplification for boiling processing postgenome progress Standard PCR
Specific embodiment
Embodiment 1
One Yeasts bacterium colony rapid PCR amplification kit, comprising: 10 × lysate, 10 × PCR reaction solution, dNTP, Hot start Taq polymerase;
The ingredient contained in every liter of 10 × lysate are as follows: the KOH of 20mM, the lauryl sodium sulfate of 1.5% (w/v), The polyethylene glycol of 60% (v/v);
The ingredient contained in every liter of 10 × PCR reaction solution are as follows: 100mM Tris-HCl, 500mM KCl, 15 mM MgCl2, 0.01% (w/v) gelatin, 0.1% (v/v) Triton X-100, pH 8.3 at 25 DEG C.
Embodiment 2
Utilize the saccharomycete bacterium colony rapid PCR amplification kit PCR amplification Pichia pastoris GS115 bacterium colony in embodiment 1 The method of GAP gene, comprising the following steps:
(1) the fresh bacterium solution 500ul after taking Pichia pastoris GS115 monoclonal colonies culture, 13000 turns of centrifugation 20s are abandoned 200 μ L cell pyrolysis liquids are added into centrifuge tube for supernatant, keep thallus and lysate sufficiently mixed using micro-whirlpool instrument vortex 15s After even, it is stored at room temperature 3min, 4 DEG C, 13000 turns of centrifugation 30s, supernatant is spare.
(2) preparation PCR reaction system includes: on 10 × PCR reaction solution 2.5 μ L, 2.5mM dNTP, 2.5 μ L, 10umol Downstream primer 1 μ L, 2.5 μ L crack supernatant, and 1 μ L hot start Taq polymerase is mended using distilled water to 25 μ L;
The upstream primer sequence are as follows: TTCAAGCAGCGTCACTCCTC;
The downstream primer TGTTCTGATTGCGCTTGCAC, pcr amplification product clip size are 740bp.
The PCR reaction condition:
(3) PCR after reaction, carries out electrophoresis detection using 1% Ago-Gel, testing result is as shown in Figure 1, expand Increase and stablize, product band is clear, and expanding effect is ideal.
Embodiment 3
Outside using the saccharomycete bacterium colony rapid PCR amplification kit PCR amplification Pichia pastoris GS115 bacterium colony in embodiment 1 The method of source pYES2-GFP carrier, comprising the following steps:
(1) the fresh bacterium solution 500ul after taking Pichia pastoris GS115 monoclonal colonies culture, 13000 turns of centrifugation 20s, in abandoning Clearly, 200 μ L cell pyrolysis liquids are added into centrifuge tube to be stored at room temperature after vortex 15s mixes well thallus and lysate 3min, 4 DEG C, 13000 turns of centrifugation 30s, supernatant are spare.
(2) preparation PCR reaction system includes: the 2.5 μ L of dNTP of 10 × PCR reaction solution 2.5 μ L, 2.5mM, 10umol's Upstream and downstream primer 1 μ L, 2.5 μ L crack supernatant, and the hot start Taq polymerase of 1 μ L is mended using distilled water to 25 μ L;
The segment that the present embodiment is expanded uses pYES2-GFP universal sequencing primer object, upstream primer sequence are as follows: TAATACGACTCACTATAGGG;Downstream primer GTGACATAACTAATTACATGATG, pcr amplification product clip size are 700bp;
The PCR reaction condition:
(3) PCR after reaction, carries out electrophoresis detection using 1% Ago-Gel, testing result is as shown in Fig. 2, expand Increase and stablize, product band is clear, and expanding effect is ideal.
Embodiment 4
Utilize the saccharomycete bacterium colony rapid PCR amplification kit PCR amplification Pichia pastoris GS115 bacterium colony in embodiment 1 GAP gene, the method are identical as method in embodiment 1.Simultaneously using the method processing Yeast genome boiled, routine is used PCR amplification kit is expanded, and the specific method is as follows:
(1) the fresh bacterium solution 500ul after taking Pichia pastoris GS115 monoclonal colonies culture, 13000 turns of centrifugation 20s, in abandoning Clearly, washed once using aqua sterilisa, 13000 turns of centrifugation 20s, precipitating be suspended in 200ul TE (Tris-hcl of 10mmol, The EDTA of 0.5mmol) in buffer, boil 10min in boiling water, ice bath 10min, 13000 turns of centrifugation 5min shift supernatant It is spare into new 1.5ml centrifuge tube.
(2) preparation PCR reaction system includes: dNTP, the 2.5 μ L of 10 × routine PCR reaction liquid 2.5 μ L, 2.5mM, The 1 μ L of upstream and downstream primer of 10umol, supernatant in 2.5 μ L steps 1, the Taq enzyme of 1 μ L are mended using distilled water to 25 μ L.
The upstream primer sequence are as follows: TTCAAGCAGCGTCACTCCTC;
The downstream primer TGTTCTGATTGCGCTTGCAC, pcr amplification product clip size are 740bp.
The PCR reaction condition:
(3) PCR after reaction, carries out electrophoresis detection using 1% Ago-Gel, testing result is as shown in figure 3, originally Invention stable amplification result, product band is clear, and expanding effect is ideal, and uses conventional PCR amplification kit amplification Unstable, band is also darker, and more expends the time.
It is above-mentioned to a Yeasts bacterium colony rapid PCR amplification kit and to utilize this kit PCR amplification referring to embodiment The detailed description that the method for saccharomycete bacterium colony carries out, is illustrative without being restrictive, can enumerate according to limited range Several embodiments out, therefore the change and modification in the case where not departing from present general inventive concept, should belong to protection scope of the present invention Within.

Claims (8)

1. a Yeasts bacterium colony rapid PCR amplification kit, which is characterized in that the kit includes: 10 × cell cracking Liquid, 10 × PCR reaction solution, dNTP, hot start Taq polymerase.
2. saccharomycete bacterium colony rapid PCR amplification kit according to claim 1, which is characterized in that the 10 × cell Lysate ingredient are as follows: contain in 10 × cell pyrolysis liquid of 1L: the lauryl sodium sulfate of 10-50mM KOH, 0.5-2.5%, 20-60% polyethylene glycol 200.
3. saccharomycete bacterium colony rapid PCR amplification kit according to claim 1 or 2, which is characterized in that described 10 × thin Cellular lysate liquid ingredient is preferred are as follows: contains in 10 × cell pyrolysis liquid of 1L: the KOH of 20mM, 1.5% lauryl sodium sulfate, and 60% Polyethylene glycol 200.
4. saccharomycete bacterium colony rapid PCR amplification kit according to claim 1 or 2, which is characterized in that described 10 × PCR reaction solution ingredient are as follows: contain in 10 × PCR reaction solution of 1L: 100mM Tris-HCl, 500mM KCl, 15mM MgCl2, 0.01% gelatin, 0.1% Triton X-100;The pH of the 10 × PCR reaction solution is 8.3.
5. utilizing saccharomycete bacterium colony rapid PCR amplification kit PCR amplification saccharomycete bacterium described in claim 1-4 any one The method fallen, which is characterized in that the described method comprises the following steps:
(1) saccharomycete single colonie culture solution is taken;
(2) yeast cell is cracked;
(3) saccharomycete genomic DNA carries out PCR amplification;
(4) PCR product observes amplification through 1% agarose gel electrophoresis.
6. the method for PCR amplification saccharomycete bacterium colony according to claim 5, which is characterized in that in the step (3), PCR Amplification reaction system are as follows: 10 × PCR reaction solution, 2.5 μ L, 2.5mM dNTP 2.5 μ L, 10 μm of ol upstream and downstream primers 1 μ L, 2.5 μ L Supernatant, 1 μ L hot start Taq polymerase are mended using distilled water to 25 μ L.
7. the method for PCR amplification saccharomycete bacterium colony according to claim 5, which is characterized in that in the step (3), PCR Reaction condition are as follows:
8. the method for PCR amplification saccharomycete bacterium colony according to claim 5, which is characterized in that specific in the step (4) Include: to prepare 1% Ago-Gel, PCR amplification liquid is added in well, connects electrophoresis apparatus power supply, electrophoretic parameters: 70V, Then 30min observes amplification on ultraviolet visualizer.
CN201910126305.XA 2018-12-22 2019-02-20 One Yeasts bacterium colony rapid PCR amplification kit and the method for utilizing this kit PCR amplification saccharomycete bacterium colony Pending CN109837332A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2018115759696 2018-12-22
CN201811575969 2018-12-22

Publications (1)

Publication Number Publication Date
CN109837332A true CN109837332A (en) 2019-06-04

Family

ID=66884646

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910126305.XA Pending CN109837332A (en) 2018-12-22 2019-02-20 One Yeasts bacterium colony rapid PCR amplification kit and the method for utilizing this kit PCR amplification saccharomycete bacterium colony

Country Status (1)

Country Link
CN (1) CN109837332A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5652102A (en) * 1994-12-05 1997-07-29 The United States Of America As Represented By The Secretary Of Agriculture Assay for enterohemorrhagic Escherichia coli 0157:H7 by the polymerase chain reaction
WO2006073497A1 (en) * 2005-01-04 2006-07-13 Molecular Research Center, Inc. Reagents and methods for storage and processing of biological samples for dna analysis
CN102321618A (en) * 2011-09-30 2012-01-18 生工生物工程(上海)有限公司 Method and kit for directly amplifying DNA (deoxyribonucleic acid) segment from biological material
US20140256558A1 (en) * 2013-03-11 2014-09-11 Kailos Genetics, Inc. Capture Methodologies for Circulating Cell Free DNA

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5652102A (en) * 1994-12-05 1997-07-29 The United States Of America As Represented By The Secretary Of Agriculture Assay for enterohemorrhagic Escherichia coli 0157:H7 by the polymerase chain reaction
WO2006073497A1 (en) * 2005-01-04 2006-07-13 Molecular Research Center, Inc. Reagents and methods for storage and processing of biological samples for dna analysis
CN102321618A (en) * 2011-09-30 2012-01-18 生工生物工程(上海)有限公司 Method and kit for directly amplifying DNA (deoxyribonucleic acid) segment from biological material
US20140256558A1 (en) * 2013-03-11 2014-09-11 Kailos Genetics, Inc. Capture Methodologies for Circulating Cell Free DNA

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
LAURIE VINGATARAMIN & ERIC H FROST: "A single protocol for extraction of gDNA from bacteria and yeast", 《BIOTECHNIQUES》 *
PIOTR CHOMCZYNSKI ET AL.: "Alkaline polyethylene glycol-based method for direct PCR from bacteria, eukaryotic tissue samples, and whole blood", 《BIOTECHNIQUES》 *
崔春编著: "《食物蛋白质控制酶解技术》", 30 June 2018, 中国轻工业出版社 *
王会文 等: "SDS一步法制备PCR模板", 《河北大学学报(自然科学版)》 *
陈源源: "基于分子标识的工业微生物资源快捷分类与鉴定", 《中国博士学位论文全文数据库 基础科学辑》 *

Similar Documents

Publication Publication Date Title
Zhou et al. Influenza A virus molecular virology techniques
CN103255227A (en) Primer-mediated cyclized constant-temperature nucleic acid rolling circle amplification method and kit
CN107557450A (en) A kind of reagent and method and its application of rapid build high-throughput sequencing library
CN107475252B (en) Nucleic acid releasing agent, method for rapidly releasing nucleic acid and application thereof
CN101712973B (en) Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof
CN108913811A (en) The rapid amplifying method of hepatitis B virus nucleic acid
CN104480202B (en) A kind of Fructus Luffae reference gene and application thereof
CN103966311A (en) Method for detecting lncRNA (long noncoding RNA) in plasma
CN105441421A (en) Cell lysis method
CN107034212A (en) A kind of plasmid extraction kit and extracting method
CN107287320A (en) The LAMP detections of GAPDH genes are combined and kit with primer
CN104611424B (en) The PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product
CN106591287A (en) Polymerase chain reaction enhancing method
CN101381755B (en) Method for enhancing high GC content DNA fragment amplification efficiency by organic solvent
CN107177684B (en) Constant temperature nucleic acid amplification reaction reagent
CN109837332A (en) One Yeasts bacterium colony rapid PCR amplification kit and the method for utilizing this kit PCR amplification saccharomycete bacterium colony
CN105525036B (en) A kind of hepatitis b virus hbv real-time fluorescence nucleic acid isothermal amplification detection kit
AU2009315891B2 (en) Method for the specific detection of low abundance RNA species in a biological sample
CN102634509B (en) Method for quickly and efficiently extracting deoxyribonucleic acid (DNA) of wheat stripe rust directly from infected wheat leaf blades
CN108866156A (en) The preparation method and applications of single mass system enzymatic amplification composition for POCT fluorescence RT-PCR system
CN108486269A (en) A method of homokaryon bacterial strain in identification hair keyhole bacterium S0301
CN107557374A (en) The construction of recombinant plasmid method of humam papillomavirus genotype L1 genes
CN104004748A (en) Lysis solution used for plant parasitic nematode genome DNA micro-extraction and application thereof
CN110093405A (en) Vagina secretion Candida albicans detection primer sets and detection method
CN106701961B (en) Reverse transcription loop-mediated isothermal amplification primer, kit and detection method for visually detecting Hobi-like pestivirus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20190604

RJ01 Rejection of invention patent application after publication