CN103255227A - Primer-mediated cyclized constant-temperature nucleic acid rolling circle amplification method and kit - Google Patents

Abstract

The invention discloses a primer-mediated cyclized constant-temperature nucleic acid rolling circle amplification method and a kit. The method comprises the following steps of: 1) designing an oligonucleotide sequence; 2) amplifying a single-stranded DNA (deoxyribonucleic acid) target template from target nucleic acid; 3) cyclizing the DNA target template through a DNA ligase; and 4) performing rolling circle amplification on the cyclized DNA target template. According to the method disclosed by the invention, a long padlock probe with high cost does not need to be synthesized, the length of the sequence of the target nucleic acid can be allowed to be longer, the rolling circle amplification can be performed on any sequence of the target nucleic acid, a solution can be provided for preventing a sample from being polluted by an amplified product, and a new era that gene detection enters applications in basic level units is opened.

Description

Constant temperature nucleic acid rolling circle amplification method and the test kit of primer mediation cyclisation

Technical field

The present invention relates to a kind of constant-temperature amplification method and test kit of nucleotide sequence, more particularly, the constant temperature nucleic acid rolling circle amplification method that relates to primer mediation cyclisation, be a kind of two primer correlated series ends that prepare the single stranded DNA chain connect into ring and can be at least with these two primers start the method for constant temperature rolling circle amplifications and test kit (Primer mediated Rolling Circle Amplification, PRCA).

Background technology

Polymerase chain reaction (the Polymerase Chain Reaction of U.S. Cetus company in 1985, PCR) technology has realized the amplification in vitro of nucleic acid for the first time, important effect is played in this development to modern molecular biology, we can say that round pcr is revolutionary invention and the milestone in the biomedical sector.But PCR method still have weak point as: need in the amplification procedure double-stranded DNA is carried out sex change, but need the PCR instrument of special rapid temperature rise and drop, non-specific amplification and produce false positive results etc.Therefore, some new nucleic acid amplification technologies that grown up in recent ten years to be remedying the deficiency of round pcr, even the trend that replaces round pcr is arranged.Therefore, the amplification method of gene fragment is rich and varied now, becomes the basic fundamental of modern molecular biology.

In recent years, multiple isothermal amplification technology had appearred successively, they can be respectively under some or a plurality of specific temperature condition (as 64 ℃, 42 ℃ etc.) realize the amplification of nucleic acid (DNA or RNA).Existing isothermal amplification technology is as follows in the world:

Strand displacement amplification (SDA)

Rely on the amplification technique (NASBA) of nucleotide sequence

Transcriptive intermediate amplification technique (TMA)

Rolling circle amplification technology (RCA)

Ligase chain reaction (LCR) (LCR)

Rely on the amplification technique (HDA) of helicase

Loop-mediated isothermal amplification (LAMP).

Wherein, NASBA transcribes with the working cycle of reverse transcription to come to avoid high-temperature denatured effect by a series of, and SDA then uses the template of restriction enzyme and modified to come cyclic amplification.Though their susceptibility is all very high, can increase is lower than the sample of nucleic acid of 10 number of copies, and they need the shortcoming that overcomes in addition separately.Aspects such as technical requirements, the requirement of material instrument, the specific defects of technology own have seriously fettered applying of these technology.

Walker equals to propose first in 1991 DNA strand displacement amplification (SDA) method.This method produces the base breach by certain technique means (as restriction enzyme) at the chain of DNA, archaeal dna polymerase is then from base indentation, there 3 ' end beginning extension, simultaneously the old chain in downstream is peeled off, the base breach that has been closed because of chain extension can repeat to produce, and makes the process of cutting extended chain displacement repeat.1992, people such as Walker simplified the SDA design, used the target DNA annealing after 4 primers (B1, B2, S1, S2) and the heat denatured, and wherein primer S1 and S2 are the primers that really carries out the SDA amplification; B1, B2 lay respectively at the upstream and downstream of S1, S2, and effect is that the product that S1, S2 first and second takes turns after the extension is peeled off.

Japanese scholar Notomi disclosed loop-mediated isothermal amplification LAMP technology at Nucleic Acids Res magazine in 2000, it overcomes the deficiency of gene amplification method in the past, under isothermal condition, can carry out the amplification of nucleic acid special, efficiently, rapidly, have a lot of superiority.But the nucleic acid target sequence length general recommendations of LAMP is preferably in the 300bp at 120-180bp, greater than then difficult amplification of 500bp.So can not carry out the amplification of long-chain DNA.In addition, the LAMP technology all is being inferior to traditional PCR method aspect the recovery evaluation of nucleic acid amplification product, clone, the strand separation.

Rolling circle amplification technology (RCA) is a kind of constant temperature nucleic acid amplification method that newly-developed gets up, rely on the characteristics of its high specific, highly sensitive and ease for operation in recent years, to attract much attention gradually, and be used for fundamental research and actual detected more and more.People have developed the amplification method of the various RCA of utilization, and pertinent literature can be with reference to U.S. Patent No. 60/506,218,5871921A, 5648377A, 5854033A, 6287824B1,6323009B1.

Rolling circle amplification is to use for reference the copy mode of rolling loop type of occurring in nature ring-type pathogenic microorganism DNA molecule and a kind of nucleic acid amplification technologies of setting up.How people's research carries out cyclisation with nucleic acid fragment if concentrating on, and how to design primer and cause rolling circle amplification.The connection that the RCA reaction of existing most of document introduction is divided into padlock probe (Padlock probe) with is connected the back two portions that increase.5 ends of padlock probe and 3 terminal specific sequences connect into ring by with the complementary region combination on the target sequence under the effect of ligase enzyme.The padlock probe of Cheng Huanhou carries out rolling circle amplification under the constant temperature of a primer and the existence of suitable archaeal dna polymerase.Lizardi in 1998 etc. have invented using hyper-branched rolling circle amplification technology (HRCA/CRCA/RAM) on the basis of linear rolling circle amplification technology.HRCA be the basis of RCA increased a sequence with padlock probe in the identical primer of partial sequence, the high sequence-specific and the simple and easy maneuverability that not only have RCA, and product efficiently increases with the oversubscription form of propping up in the presence of two primers, and sensitivity is high.

Introduced in the U.S. Patent No. 60/506,218 and multiplely carried out the multiple technologies of rolling circle amplification with RNA or dna profiling, they have utilized the nucleic acid linker fragment to come linking objective nucleotide sequence Cheng Huan.

The novel method that replaces synthetic small pieces segment DNA introduced in the article that Li Yan etc. deliver " a kind of foundation of efficient amplification small pieces segment DNA method " (Capital University of Medical Sciences's journal 01 phase in 2011), directly connect into ring by the single stranded DNA ligase enzyme, add special forward and reverse primer then and copy with rolling the amplification of ring method, cut the small segment that obtains a large amount of same sequences by enzyme at last.

Existing RCA and HRCA often need double-stranded sex change, enzyme to be connected and polystep reaction such as rolling circle amplification, need different temperature respectively, also need repeatedly to add reaction reagent, and the primer that needs to add particular design starts rolling circle amplification, is not suitable for grass-roots unit and uses.

2012 the bright master thesis of delivering of Wang Xiao " technical study of normal temperature SC-RCA DNA cloning " (Chinese Marine University) introduced a kind of improved rolling circle amplification technology--from cyclisation rolling circle amplification technology (Self circularization-RCA, SC-RCA), this technology utilizes a kind of restriction enzyme with special restriction enzyme site that the target dna enzyme is cut, and by ligase enzyme the joint of endonuclease bamhi and the special design of process is connected into the rolling-circle replication of ring back realization target dna again.Save the expensive synthetic of long padlock probe, can guarantee to connect into the specificity of ring again.The SC-RCA technology has avoided the LAMP technology to be difficult to distinguish the deficiency of non-specific amplification, becomes ring easy than Padlock-RCA again.In the SC-RCA technology, have the target nucleotide sequences of restriction endonuclease sites after specific enzymes is cut, by dna ligase the digested fragment that obtains and the nucleic acid joint that passes through special design are connected into annulus.Though this article can be by replacing the target nucleic acid partial sequence by enzyme butt formula the direct Cheng Huan of joint of composition sequence and special design, saved the expensive synthetic of long padlock probe, but require the target nucleic acid sequence position of amplification that restriction enzyme site is arranged, to add special designed joint during cyclisation, the primer that will add particular design during rolling circle amplification, the experiment of article need carry out enzyme respectively to be cut, and connects, rolling circle amplification can't once be finished these operations in a solution system.

Summary of the invention

The technical problem to be solved in the present invention is to provide a kind of constant temperature nucleic acid rolling circle amplification method and test kit of primer mediation cyclisation, and namely a kind of two primer correlated series ends that prepare the single stranded DNA chain connect into method and the test kit that encircles and can directly start the constant temperature rolling circle amplification at least with these two primers.Constant temperature keeps certain hour just can finish nucleic acid amplification method of the present invention can once have been added whole reagent in a kind of solution system after, the present invention also applies to the UNG enzyme in the rolling circle amplification method of constant temperature, before beginning to increase sample is carried out possible amplified production and pollutes and do thorough elimination.In addition, amplified production of the present invention can also detect product by immune chromatography test paper.Therefore the present invention can become simple operations with amplification and the detection of gene, can open the epoch that gene diagnosis technological direction grass-roots unit uses.

The present invention is provided with four sections primer: F3, FIP, BIP, B3 successively according to target nucleic acid 3 '-5 ' sequence direction.Wherein FIP is the front end inner primer, BIP is the rear end inner primer, F3, B3 are a pair of outer primers, lay respectively at the upstream and downstream of FIP, BIP, under the archaeal dna polymerase that has the strand displacement function, increasable reversed transcriptive enzyme, the effect of suitable amplification promotor in case of necessity, four primers are template amplification with the target nucleic acid and separate a strand To Template.DNA To Template head and the tail two ends are connected to form closed cyclisation To Template by suitable dna ligase in constant temperature.Can start the DNA rolling circle amplification along the cyclisation To Template from 3 ' end with the initial primers of cyclisation To Template complementation, carry out copying of cyclisation To Template again and again, amplified production is to be that thousands of times of series connection to target masterplate monocycle length of starting point repeat copy with the initial primers, sequence with other primer complementations is arranged in each monocycle sequence, these primer hybridizations and to start reverse DNA chain synthetic, reproducible to go out to end at the amplified production end that series connection repeats to copy be the complementary strand of initial primers 5 ' tail end.This ends at the To Template that comprises single or multiple length in the complementary strand of initial primers 5 ' tail end, initial primers will with each To Template in complementary sequence hybridization and start new copying.The complementary strand that has comprised a plurality of length To Templates will be at the To Template that alternately copies and peel off the single length of back generation of inner primer; This single length To Template that newly copies will be constantly by the ligase enzyme cyclisation and start the rolling circle amplification of a new round.So go round and begin again, amplification is copied the nucleic acid product (as Fig. 2) of flood tide.

One of content of the present invention is when being of convenient length of strand To Template, and can directly by the single stranded DNA ligase enzyme its two ends butt joint be closed into ring; After this two inner primers that being used for increases copies the strand To Template have started the rolling circle amplification of alternating permutation successively; And in the rolling circle amplification, will constantly copy the To Template that makes new advances, it will be constantly by the ligase enzyme cyclisation and start the rolling circle amplification of a new round.

Two of content of the present invention has been to design the inner primer of two tail ends and target nucleic acid sequence complementation, makes the duplicated To Template two ends all to form hairpin structure, does not have the base breach between them and partial sequence hybridization adjacent and target nucleic acid; The To Template two ends are connected and are closed into ring under the effect of suitable dna ligase; Two inner primers that copy the strand To Template that are used for increasing have started the rolling circle amplification of alternating permutation successively.And will constantly copy the To Template that makes new advances in the rolling circle amplification, it will be constantly by the ligase enzyme cyclisation and start the rolling circle amplification of a new round.

Three of content of the present invention be to design at least one tail end not with inner primer and a bridge-type primer of target nucleic acid sequence complementation.Copying To Template 3 ' the end afterbody sequence of peeling off does not hybridize and all or part of and bridge-type primer hybridization with target nucleic acid sequence; All or part of and the bridge-type primer hybridization of 5 ' end tail portion sequence of To Template; There is not the base breach between the two ends of To Template and adjacent and bridge-type primer hybridization; The To Template two ends are connected and are closed into ring under the effect of suitable dna ligase; Two inner primers that copy the strand To Template that are used for increasing have started the rolling circle amplification of alternating permutation successively; And in the rolling circle amplification, will constantly copy the strand To Template that makes new advances, it will be constantly by the ligase enzyme cyclisation and start the rolling circle amplification of a new round.More than explanation please refer to Fig. 1.

In particular, a kind of two primer correlated series ends that prepare the single stranded DNA chain of the present invention connect into ring and can start the method for constant temperature rolling circle amplification at least with these two primers, comprise step:

1) oligonucleotide sequence design

Oligonucleotide sequence has four sections primers that design by target nucleic acid 3 ' → 5 ' direction at least: F3, FIP, BIP, B3;

Wherein, FIP is the front end inner primer;

BIP is the rear end inner primer;

F3, B3 are a pair of outer primers, lay respectively at the upstream of FIP and the downstream of BIP;

2) from target nucleic acid, amplify the single stranded DNA To Template

Target nucleic acid is DNA chain or when in the reaction soln that contains reversed transcriptive enzyme at least RNA chain target nucleic acid reverse transcription being the DNA chain, in containing the nucleic acid amplification reaction solution of the archaeal dna polymerase that has the strand displacement function at least, utilize primers F 3, FIP, BIP, B3, amplification synthesizes the single stranded DNA To Template according to target nucleic acid sequence;

3) dna ligase cyclized DNA To Template

In the reaction soln that contains dna ligase at least, the head and the tail two ends of DNA To Template are connected to form closed cyclized DNA chain;

4) cyclized DNA To Template rolling circle amplification

In the reaction soln that contains dna ligase and the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chains at least with two inner primers in the step 1), the nucleic acid product that obtains increasing.

The oligonucleotide sequence of described step 1) also comprises: bridge-type primer BP, hybridization probe, auxiliary primer; Described bridge-type primer BP, its all or part of sequence and the complementation of an inner primer afterbody sequence, and its all or part of and afterbody sequence complementation another inner primer complementary sequence makes it as bridge the adjacent no base breach of the two terminal sequences ground of these two inner primers to be hybridized together; Described hybridization probe, itself and the sequence hybridization of target nucleic acid among two inner primer correlated series positions; Described auxiliary primer derives from the partial sequence that does not influence itself and target nucleic acid or bridge-type primer stable bond in BIP or the FIP primer, maybe should auxiliary primer also derives from sequence between BIP primer and the B3 primer or the sequence between this FIP primer and the F3 primer.

The oligonucleotide sequence of described step 1) can also carry out similar and different modification mark respectively, and this modification mark comprises: digoxin, fluorescence dye FAM, fluorescein isothiocyanate, vitamin H, fluorescent quenching group or nano particle.

In the described step 1), FIP only comprises the F2 sequence, F2 and target nucleic acid sequence F2c complementation; Described BIP only comprises the B2 sequence, and B2 is identical with the target nucleic acid partial sequence; Step 2) in, utilize primers F 3, FIP, BIP, B3 to amplify the single stranded DNA To Template from target nucleic acid after, its two ends are respectively correlated series F2c, the B2 of two inner primers, its complementary strand two ends are respectively F2, B2c; Wherein, B2c is the complementary sequence of B2; In the step 3), DNA To Template and complementary strand thereof can be connected to form the cyclized DNA chain of a closure by dna ligase; In the step 4), in the reaction soln that contains the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chain at least with FIP and these two primers of BIP.

In the described step 1), oligonucleotide sequence has also designed auxiliary primer; Described auxiliary primer is several: this auxiliary primer derives from the 5 ' terminal sequence that do not influence B2 and target nucleic acid sequence stable bond in the BIP primer or the sequence between BIP primer and the B3 primer, maybe should auxiliary primer also derives from the 3 ' terminal sequence that do not influence F2 and target nucleic acid sequence stable bond in the FIP primer or the sequence between FIP primer and the F3 primer simultaneously.

In the described step 1), front end inner primer FIP comprises 2 sections sequence F1c, F2 at least by 5 ' → 3 ' sequence direction, wherein, F2 and F2c complementation, F2c is that target nucleic acid sequence F3c is in the partial sequence of target nucleic acid 5 ' direction; F1c in the FIP primer is the complementary sequence of F1, and F1c is identical with the partial sequence of the 5 ' direction that is in target nucleic acid sequence F2c, and F3c is the complementary sequence of F3; Described rear end inner primer BIP comprises 2 sections sequence B 2, B1c at least by 3 ' → 5 ' sequence direction, and wherein, the B2 in the BIP primer is identical with the target nucleic acid partial sequence, and B1c is the partial sequence B1 complementation with the 3 ' direction that is in target nucleic acid B2 sequence; Described F1c and B1 are adjacent no base two sections sequences in front and back at interval at target nucleic acid sequence; Step 2) in, utilize primers F 3, FIP, BIP, B3 to amplify the single stranded DNA To Template from target nucleic acid after, DNA To Template and complementary strand two ends thereof form hairpin structure respectively; Wherein, formed between F1, the B1c or between F1c, the B1 and do not had the hybridization of base breach slit; In the step 3), the gap between DNA To Template and the complementary strand two ends thereof can be connected closed by dna ligase, forms the cyclized DNA chain; In the step 4), in the reaction soln that contains the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chain at least with FIP and two inner primers of BIP.

In the described step 1), oligonucleotide sequence has also designed auxiliary primer; Described auxiliary primer is several; Should auxiliary primer derive from the intermediate sequence that do not influence B2 and B1c and target nucleic acid sequence stable bond in the BIP primer or the sequence between BIP primer and the B3 primer, maybe this auxiliary primer also derives from the intermediate sequence that do not influence F2 and F1c and target nucleic acid sequence stable bond in the FIP primer or the sequence between FIP primer and the F3 primer simultaneously.

In the described step 1), front end inner primer FIP comprises 2 sections sequence F4, F2 at least by 5 ' → 3 ' sequence direction, wherein, and the complementary hybridization of F2 and target nucleic acid sequence F2c; The F4 sequence is the dna sequence dna inequality and not complementary with the single stranded DNA To Template; Described rear end inner primer BIP comprises 2 sections sequence B 2, B4 at least by 3 ' → 5 ' sequence direction, and wherein, B2 is identical with the target nucleic acid partial sequence; The B4 sequence is the dna sequence dna inequality and not complementary with the single stranded DNA To Template; In the step 1), also be provided with bridge-type primer BP, it by 5 ' → 3 ' sequence direction respectively with FIP among the complementary sequence F4c of F4 and the BIP all or part of base hybridization of two sequences of B4 complementary, perhaps by 5 ' → 3 ' sequence direction respectively with BIP among the complementary sequence B4c of B4 and the FIP all or part of base hybridization of two sequences of F4 complementary; Have at most among FIP and the BIP have in the inner primer partial sequence not with the complementation of bridge-type primer, and identical with the target nucleic acid partial sequence or complementary, its position is at inner primer F2 or B2 is identical with target nucleic acid or 3 ' extreme direction of complimentary positions; Step 2) in, utilize primers F 3, FIP, BIP, B3 to amplify the single stranded DNA To Template from target nucleic acid after, the two ends of DNA To Template or its complementary strand are that complementary strand has formed and do not have the hybridization of base breach slit with the bridge-type primer; In the step 3), the two ends of DNA To Template or its complementary strand can be connected to the cyclized DNA chain by dna ligase; In the step 4), in the reaction soln that contains the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chain at least with FIP and two inner primers of BIP.

Described bridge-type primer BP, amplification peels off out in the sequence that can have nothing to do fully with single stranded DNA To Template sequence from target nucleic acid sequence by four primer sequences of other design; Wherein, described four primer sequences, for: each 2 sequence of the inner primer that is different from F3, FIP, BIP, B3 of redesign and outer primer.

Oligonucleotide sequence has also designed auxiliary primer in the described step 1); Described auxiliary primer derives from the intermediate sequence that do not influence B2 and target nucleic acid sequence stable bond, B4 and bridge-type primer stable bond in the BIP primer or the sequence between BIP primer and the B3 primer, maybe should auxiliary primer also derives from the intermediate sequence that do not influence F2 and target nucleic acid sequence stable bond, F4c and bridge-type primer stable bond in the FIP primer or the sequence between FIP primer and the F3 primer simultaneously.

Described step 2) in, reversed transcriptive enzyme comprises: AMV or M-MLV; The archaeal dna polymerase that has the strand displacement function comprises: Bst archaeal dna polymerase or Phi29DNA polysaccharase; Step 2) in, contain the nucleic acid amplification reaction solution of the archaeal dna polymerase that has the strand displacement function at least, its component also comprises at least: amplification promotor and nucleic acid dye; Wherein, amplification promotor comprises the combination of following one or more compositions: trimethyl-glycine, trehalose, proline(Pro), dimethyl sulfoxide (DMSO), Trimethylamine 99-N-oxide compound, Tetramethylammonium chloride, methane amide, BSA, single strand binding protein, T4Gene32Protein, homoectoine, Zn ²⁺-cyclen(cyclen is 1,4,7,10-tetraazacyclododecane); Described nucleic acid dye comprises: SYBR Green I, fluorexon, GELGREEN and GELRED.

Described step 2) in, before amplifying the single stranded DNA To Template according to target nucleic acid, can also carry out the target nucleic acid amplified production abatement of pollution of sample handles: after sample is finished nucleic acid extraction, add uridylic-N-glycosylase, may cause the uridylic in the target nucleic acid amplified production that pollutes to carry out the glycosidic link hydrolysis to sample, after this, solution temperature is elevated to 55-98 ℃ and kept maximum 10 minutes, the uridylic in the solution-N-glycosylase will be inactivated.

In described abatement of pollution processing, amplification strand To Template, dna ligase cyclisation To Template, four steps of cyclisation To Template rolling circle amplification, each step can arrange different temperature condition, or some steps are wherein arranged same temperature; Related reagent composition in these four steps can repeatedly add respectively or once add and finish.

Described step 3), 4) in, described dna ligase comprises: T4DNA ligase, Taq DNA Ligase, Ampligase and ssDNAligase.

In the described step 4), the archaeal dna polymerase that has the strand displacement function comprises: Bst archaeal dna polymerase or Phi29DNA polysaccharase; The described reaction soln that contains dna ligase and have the archaeal dna polymerase of strand displacement function, its component also comprises at least: amplification promotor or nucleic acid dye; Wherein, amplification promotor comprises the combination of following one or more compositions: trimethyl-glycine, trehalose, proline(Pro), dimethyl sulfoxide (DMSO), Trimethylamine 99-N-oxide compound, Tetramethylammonium chloride, methane amide, BSA, single strand binding protein, T4Gene32Protein, homoectoine, Zn ²⁺-cyclen; Described nucleic acid dye comprises: SYBR Green I, fluorexon, GELGREEN and GELRED.

Nucleic acid product in the single stranded DNA To Template of amplification described step 2), the cyclized DNA chain of step 3) and the step 4) can detect by immune chromatography test paper or fluorescent signal.As step 2) cyclized DNA chain and the nucleic acid product in the step 4) of single stranded DNA To Template, step 3) of amplification can have or combine the oligonucleotide sequence of modifying tagged molecule; Wherein, this is modified tagged molecule and can be identified by corresponding part, and can detect product by immune chromatography test paper; Nucleic acid product in the single stranded DNA To Template of amplification step 2), the cyclized DNA chain of step 3) and the step 4) can also cause rising or the decline of fluorescent signal, and can detect product by fluorescent signal.

In addition, according to aforesaid method, the invention also discloses a kind of test kit that is applied to described method, comprise above-mentioned oligonucleotide sequence at least.

Described test kit also comprises at least a in the following component:

(1) the above-mentioned strand displacement function DNA polysaccharase that has;

(2) above-mentioned dna ligase;

(3) above-mentioned amplification promotor;

(4) above-mentioned nucleic acid dye;

(5) uridylic-N-glycosylase;

(6) above-mentioned reversed transcriptive enzyme.

The present invention can be connected to form the cyclisation To Template of a closure by suitable dna ligase under conditions suitable from target nucleic acid constant-temperature amplification and the dna single chain To Template two ends that separate by inside and outside each 2 primer.Having the archaeal dna polymerase of strand displacement function under constant temperature, is that template starts rolling circle amplification with closed hoop DNA.New dna single chain To Template constantly appears in the rolling circle amplification product, it will be constantly by the dna ligase cyclisation and start new round rolling circle amplification.Constant temperature keeps finishing amplification behind the certain hour the present invention can once add whole reagent in a kind of solution system after.

Compared with prior art, beneficial effect of the present invention is:

1) compare existing padlock probe rolling circle amplification technology, the present invention is without the expensive long padlock probe of resynthesis, and the length of the sequence of target nucleic acid can allow bigger;

2) compare existing enzyme cut rolling circle amplification technology, the present invention can carry out rolling circle amplification to the target nucleic acid arbitrary sequence by primer design;

3) compare existing rolling circle amplification technology and other isothermal amplification technology (except the LAMP) and all need substep differing temps operation in the different solutions system, constant temperature keeps certain hour just can finish amplification the present invention can once add whole reagent in a kind of solution system after, this is the sealing amplification of amplified production, and to preventing that sample is amplified product pollution solution is provided;

4) compare the present LAMP technology that can in a kind of solution system, once add whole reagent and constant-temperature amplification, the present invention can provide still less simpler design of primers of quantity, need only four primers relevant with target nucleic acid in the method that has, need 5 primers relevant with target nucleic acid in the method that has.In view of RNA viruses is easy to genovariation, even also there is point mutation on conserved sequence, the primer that quantity is few just can be more convenient for carrying out the specificity design of kind scope;

5) compare existing isothermal amplification technology, the present invention applies to the UNG enzyme in the rolling circle amplification method of constant temperature, and the amplified production that sample is possible pollutes and thoroughly eliminates before beginning to increase.This can't accomplish the sense partitions operation and can't use the problem that has nucleic acid reagent now with regard to having solved grass-roots unit technically, really open gene test and stepped into the New Times that grass-roots unit uses.

Description of drawings

Fig. 1 is constant temperature rolling circle amplification synoptic diagram of the present invention;

Among Fig. 1, be provided with four sections primer: F3, FIP, BIP, B3 successively according to target nucleic acid 3 '-5 ' sequence direction.Wherein FIP is the front end inner primer, BIP is the rear end inner primer, F3, B3 are a pair of outer primers, lay respectively at the upstream and downstream of FIP, BIP, under the archaeal dna polymerase that has the strand displacement function, increasable reversed transcriptive enzyme, the effect of suitable amplification promotor in case of necessity, four primers are template amplification with the target nucleic acid and separate a strand To Template.

Difference according to two inner primer designs derives three kinds of amplification modes respectively:

First kind of mode is from connecing primer rolling circle amplification (SP-RCA): FIP front end inner primer FIP only comprises the F2 sequence; Has only the B2 sequence in the inner primer BIP of rear end; After the single stranded DNA To Template was replicated and synthesizes, its two ends were respectively F2c, B2, can be connected to form the cyclized DNA chain of a closure by dna ligase; Described cyclized DNA chain will carry out rolling circle amplification under the startup of FIP primer.

The second way is hair clip primer rolling circle amplification (HP-RCA): front end inner primer FIP comprises F1c, F2 by 5 ' → 3 ' sequence direction; Rear end inner primer BIP comprises B2, B1c by 3 ' → 5 ' sequence direction.F1c and B1 are adjacent no base two sections sequences in front and back at interval at target nucleic acid sequence simultaneously; After To Template was replicated and synthesizes, its two ends were respectively correlated series F1, the B1c of two inner primers, and F1 and F1c complementation, B1 and B1c complementation, the To Template two ends form hairpin structure respectively, have wherein formed the slit that does not have the base breach between F1, the B1c; Gap between the To Template two ends is connected closed by dna ligase, and complementary strand has become the cyclized DNA chain.Started rolling circle amplification with the FIP inner primer of cyclized DNA chain complementation

The third mode is bridge-type hair clip primer rolling circle amplification (BH-RCA): front end inner primer FIP comprises F4, F2 by 5 ' → 3 ' sequence direction.Rear end inner primer BIP comprises B2, B4 by 3 ' → 5 ' sequence direction.Bridge-type primer BP is all hybridized complementation with complementary sequence F4c and two sequences of B4 of F4 respectively by 5 ' → 3 ' sequence direction.After To Template was replicated and synthesizes, its two ends were respectively F4c, B4; 5 ' end parts sequence and the B4 of bridge-type primer are all hybridized, and its 3 ' end parts sequence and F4c are all hybridized; The two ends F4c of To Template and B4 are that complementary strand has formed and do not have the hybridization of base breach slit with the bridge-type primer, are connected to the cyclisation To Template by suitable dna ligase; The middle part sequence of FIP inner primer not with the complementation of bridge-type primer, and identical with the target nucleic acid partial sequence.The complementary sequence of this middle part sequence of FIP inner primer can be hybridized with target nucleic acid in the To Template that copies, so the To Template after the cyclisation is the dumbbell shaped structure.Start rolling circle amplification as initial primers simultaneously with inner primer and the BP of the complementation of cyclisation To Template.

Fig. 2 is amplification method synoptic diagram of the present invention.

Among Fig. 2, illustrate meeting of primer rolling circle amplification (SP-RCA) certainly: be provided with four sections primer: F3, FIP, BIP, B3 successively according to target nucleic acid 3 '-5 ' sequence direction.Wherein FIP is the front end inner primer, BIP is the rear end inner primer, F3, B3 are a pair of outer primers, lay respectively at the upstream and downstream of FIP, BIP, under the archaeal dna polymerase that has the strand displacement function, increasable reversed transcriptive enzyme, the effect of suitable amplification promotor in case of necessity, four primers are template amplification with the target nucleic acid and separate a strand To Template.DNA To Template head and the tail two ends are connected to form closed cyclisation To Template by suitable dna ligase in constant temperature.

Can start the DNA rolling circle amplification along the cyclisation To Template from 3 ' end with the initial primers FIP of cyclisation To Template complementation, carry out copying of cyclisation To Template again and again, amplified production is to be that thousands of times of series connection to target masterplate monocycle length of starting point repeat copy with the initial primers, sequence with the complementation of BIP primer is arranged in each monocycle sequence, BIP primer hybridization and to start reverse DNA chain synthetic, reproducible to go out to end at the amplified production end that series connection repeats to copy be the complementary strand of FIP primer 5 ' tail end.This ends at the To Template that comprises single or multiple length in the complementary strand of FIP primer 5 ' tail end, the FIP primer will with each To Template in complementary sequence hybridization and start new copying.The complementary strand that has comprised a plurality of length To Templates will be at the To Template that alternately copies and peel off the single length of back generation of FIP and BIP inner primer; This single length To Template that newly copies will be constantly by the ligase enzyme cyclisation and start the rolling circle amplification of a new round.So go round and begin again, amplification is copied the nucleic acid product of flood tide

Embodiment

Be described in further detail below by the present invention of embodiment.

The chemical reagent that relates in following examples then is to adopt commercially available commercially produced product as not specifying.

Embodiment 1: bridge-type hair clip primer BHP-RCA detects double-stranded DNA

This embodiment adopts and singly increases Liszt (Listeria monocytogenes) bacterium bacterial cultures as sample.Bacterial classification is available from ATCC(ATCC19116), get 1 μ L original seed bacterium liquid in the 3mlTSBYE substratum, in 35 ℃ of shaking culture 24 hours, get 200 μ L bacterial suspensions, centrifugal 2 minutes of 5000rpm collects thalline and is used as follow-up DNA extracting.According to the sequence information that NCBI announces, the hemolysin encoding gene hlyA conservative with Listeria monocytogenes is target sequence, partial sequence following (GenBank NO.AB566375):

CAGATTTTTCGGCAAAGCTGTTACTAAAGAGCAGTTGCAAGCGCTTGGAGTGAATG CAGAAAATCCTCCTGCATATATCTCAAGTGT GGCATATGGCCGTCAAGTTTATTTGAAATTATCAACTAATTCCCATAGTACTAAAG TAAAAGCTGCTTTTGACGCTGCCGTAAGTGGGAAA TCTGTCTCAGGTGATGTAGAACTGACAAATATCAT(is shown in SEQ ID NO.1)

1, according to above-mentioned sequence, five kinds of primers of design, and finish via primer Synesis Company, primer sequence is as follows:

Outer primer F3:CGGCAAAGCTGTTACTA(is shown in SEQ ID NO.2)

Outer primer B3:GTCAGTTCTACATCACC(is shown in SEQ ID NO.3)

Inner primer FIP:TGAATCCGTTAGTTTTTATATGCAGGAGGGCAGTTGCAAGCGCTTGG(is shown in SEQ ID NO.4)

Inner primer BIP:AATAAGGAGGCGGCTGCTGG GACAGATTTCCCACTTACG(is shown in SEQ ID NO.5)

Bridge-type primer BP:CTAACGGATTCAAATAAGGAGG(is shown in SEQ ID NO.6)

2, sample preparation:

Adopt commercial bacterial nucleic acid to extract test kit and carry out the DNA extracting, obtain the dna profiling of Listeria monocytogenes, concentration is 320ng/ μ L.

3, isothermal amplification reactions and detection:

System is formulated as follows:

10 * BST Buffer(NEB company) 1 μ L

10 * Taqe ligase Buffer(Thermo company) 1 μ L

DNTP(25mM, Takara company) 1 μ L

Outer primer F3(100 μ M) 0.1 μ L

Outer primer B3(100 μ M) 0.1 μ L

Inner primer FIP(100 μ M) 0.2 μ L

Inner primer BIP(100 μ M) 0.2 μ L

Bridge-type primer BP(100 μ M) 0.2 μ L

Dna profiling 1 μ L

Bst enzyme (NEB company is diluted to 8U/ μ l) 1 μ L

Taqe ligase(Thermo company, 40U/ μ L) 0.5 μ L

ddH ₂O 13.7μL

After above-mentioned reaction system prepared, mix centrifugal 30 seconds of 3000rpm, 64 ℃ of constant-temperature amplifications 1 hour.Amplified production is through 2%(2g/100mL) agarose gel electrophoresis, present the trapezoid-shaped strips of bright Marker shape.The result shows, uses the method for the invention, can detect To Template well through 1 hour isothermal amplification reactions.

In addition, component according to above-mentioned isothermal amplification reactions system also can be prepared into corresponding detection kit, in order to be extensive use of, i.e. this detection kit (not containing dna profiling), its component contains: outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, bridge-type primer BP; In addition, the component of this detection kit also can contain 10 * BST Buffer, 10 * Taqe ligase Buffer, dNTP, Bst enzyme, Taqe ligase and ddH ₂O.

4, the amplified reaction time is to result's influence:

In the described reaction system of step 3, under the constant situation of other condition, only change the isothermal amplification reactions time, carry out 64 ℃ of amplified reactions at 20min, 30min, 50min respectively, test-results shows, use the method for the invention, through 30 minutes isothermal amplification reactions, can detect To Template well.

5, the amplified reaction temperature is to result's influence:

In the described reaction system of step 3, under the constant situation of other condition, only change temperature of reaction, under 45 ℃, 48 ℃, 50 ℃, 52 ℃, 55 ℃, 58 ℃, 60 ℃, 62 ℃, 65 ℃, 70 ℃ temperature condition, constant-temperature amplification 1 hour, test-results shows: optimal reactive temperature of the present invention is: 62-64 ℃.

Embodiment 2: bridge-type hair clip primer BHP-RCA detects single stranded DNA

The implementation case adopts pig circular ring virus, and (Porcine Circovirus, PCV) inactivated vaccine is as sample.Vaccine is available from biotechnology development company of Harbin dimension section, and toxic amount is not less than 105.5TCID50 before this vaccine inactivation.PCV is strand closed hoop dna virus, the about 1.76kb of genome total length.PCV2 has higher pathogenic, is the main pathogen of multisystemic wasting syndrome behind the weaned piglet.According to the sequence information that NCBI announces, be target sequence with PCV2 than conservative replication genes involved Rep, partial sequence following (GenBank NO. AF207700):

CTAGATCTCAAGGACAACGGAGTGACCTGTCTACTGCTGTGAGTACCTTGTTGGAG AGCGGGAGTCTGGTGGCCGTTGCAGAGCAGC ACCCTGTAACGTTTGTCAGAAATTTCCGCGGGCTGGCTGAACTTTTGAAAGTGAGC GGGAAAATGCAGAAGCGTGATTGGAAGACGAATGT ACACGTCATTGTGGGGCCACCTGGGTGTG(is shown in SEQ ID NO.7)

1, according to above-mentioned sequence, five kinds of primers of design, and finish via primer Synesis Company, primer sequence is as follows:

Outer primer F3:AGATCTCAAGGACAACG(is shown in SEQ ID NO.8)

Outer primer B3:GTCATTGTGGGGCCACCT(is shown in SEQ ID NO.9)

Inner primer FIP:TGAATCCGTTAGTTTTTCTCCCGCTCTCCGACCTGTCTACTGCTGTGAG (shown in SEQ ID NO.10)

Inner primer BIP:AATAAGGAGGCGGCTGCTGG-CATTCGTCTTCCAATCACG (shown in SEQ ID NO.11)

Bridge-type primer BP:CTAACGGATTCAAATAAGGAGG(is shown in SEQ ID NO.12)

2, sample preparation:

Adopt commercial viral nucleic acid to extract test kit and carry out the nucleic acid extracting, obtain the dna profiling of PCV2, concentration is 130ng/ μ L.

3, isothermal amplification reactions and detection:

System is formulated as follows:

10 * BST Buffer(NEB company) 1 μ L

10 * Taqe ligase Buffer(Thermo company) 1 μ L

DNTP(25mM, Takara company) 1 μ L

Outer primer F3(100 μ M) 0.1 μ L

Outer primer B3(100 μ M) 0.1 μ L

Inner primer FIP(100 μ M) 0.2 μ L

Inner primer BIP(100 μ M) 0.2 μ L

Bridge-type primer BP(100 μ M) 0.2 μ L

Dna profiling 1 μ L

Bst enzyme (NEB company is diluted to 8U/ μ l) 1 μ L

Taq ligase(Thermo company, 40U/ μ L) 0.5 μ L

ddH ₂O 13.7μL

Mix centrifugal 30 seconds of 3000rpm, 64 ℃ of constant-temperature amplifications 1 hour after above-mentioned reaction system prepared.Amplified production is through 2%(2g/100ml) agarose gel electrophoresis, present the trapezoid-shaped strips of bright Marker shape.The result shows, uses the method for the invention, can detect PRV (Pseudorabies virus) DNA well through 1 hour isothermal amplification reactions.

Embodiment 3: bridge-type hair clip primer BHP-RCA detects RNA

Present embodiment adopts human immunodeficiency virus, and (Human Immunodeficiency Virus HIV) is detected object.The viral RNA sample is so kind as to give by Xiamen ten thousand safe the deep blue sea bio tech ltd doctors Xu Feihai.HIV is the single stranded RNA retrovirus, and most acquired immune deficiency syndrome (AIDS) are caused by the HIV-1 type.According to the sequence information that NCBI announces, the structural protein gag gene relatively more conservative with HIV-1 is target sequence, and partial sequence is as follows

（GenBank NO.：AF128998）：

TCGACGGAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGAC TGGTGAGTACGCCAAAATTTTTTACTAGCGGAGGC TAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATA AATGGGAGAAAATTCGGTTAAGGCCAGGAGGAAAG AAAACATATCAGTTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAA(is shown in SEQ ID NO.13)

1, according to top sequence, designed five kinds of required primers, primer sequence is as follows:

Outer primer F3:CGACGGAGGACTCGGCTTG(is shown in SEQ ID NO.14)

Outer primer B3:GCTTGCCCATACTATATG(is shown in SEQ ID NO.15)

Inner primer FIP:TGAATCCGTTAGTTTTTCGTACTCACCAGAAGCGCGCACGGCAAG (shown in SEQ ID NO.16)

Inner primer BIP:AATAAGGAGGCGGCTGCTGGCTGATATGTTTTCTTTCCTCC (shown in SEQ ID NO.17)

Bridge-type primer BP:CTAACGGATTCAAATAAGGAGG(is shown in SEQ ID NO.18)

2, sample preparation:

Adopt commercial viral nucleic acid to extract test kit and carry out the RNA template that the nucleic acid extracting obtains HIV, concentration is 210ng/ μ L.

3, isothermal amplification reactions and detection:

System is formulated as follows:

10 * BST Buffer(NEB company) 1 μ L

10 * Taqe ligase Buffer(Thermo company) 1 μ L

DNTP(25mM, Takara company) 1 μ L

Outer primer F3(100 μ M) 0.1 μ L

Outer primer B3(100 μ M) 0.1 μ L

Inner primer FIP(100 μ M) 0.2 μ L

Inner primer BIP(100 μ M) 0.2 μ L

Bridge-type primer BP(100 μ M) 0.2 μ L

RNA template 1 μ L

Bst enzyme (NEB is diluted to 8U/ μ l) 1 μ L

AMV enzyme (30U/ μ L, Takara) 1 μ L

Taq ligase（40U/μL，Thermo） 0.5μL

ddH ₂O 12.7μL

Mix centrifugal 30 seconds of 3000rpm, 64 ℃ of constant-temperature amplifications 1 hour after above-mentioned reaction system prepared.Amplified production presents the trapezoid-shaped strips of bright Marker shape through the agarose gel electrophoresis of 2% (2g/100ml).The result shows, uses the method for the invention, can detect HIV-1 well through 1 hour isothermal amplification reactions.

Embodiment 4: bridge-type hair clip primer BHP-RCA detects the dog Paul Ehrlich in conjunction with UNG enzyme anti-pollution system

The inventive method is highly sensitive, is very easy to cause aerosol to pollute and causes false positive results.The inventive method can be avoided the generation of false positive results in conjunction with UNG enzyme (uridylic-N-glycosylase) anti-pollution system.Paul Ehrlich is the special sexual cell endoparasite, causes dog hypoimmunity, skeletonize, and the dog ehrlichioses is also referred to as the acquired immune deficiency syndrome (AIDS) of dog.Dog Paul Ehrlich genome size is about 1000kbp, according to the sequence information that NCBI announces, is that target sequence detects with the conservative 16S rDNA gene of dog Paul Ehrlich, partial sequence following (GenBank NO.:AF162860)

GAGGGGGAAAGATTTATCGCTATTAGATGAGCCTACGTTAGATTAGCTAGTTGGTG AGGTAATGGCTTACCAAGGCTATGATCTATAGCTG GTCTGAGAGGACGATCAGCCACACTGGAACTGAGATACGGTCCAGACTCCTACGGG AGGCAGCAGTGGGGAATATTGGACAATGGGCGAAA GCCTGATCCAGCTATGCCGCGTGAGTGAAGAAGGCCTTCGGGTTGTAAAACTC(is shown in SEQ ID NO.19)

1, according to top sequence, designed five kinds of required primers, primer sequence is as follows:

Outer primer F3:GAAAGATTTATCGCTAT(is shown in SEQ ID NO.20)

Outer primer B3:CGAAGGCCTTCTTCACT(is shown in SEQ ID NO.21)

Inner primer FIP:TGAATCCGTTAGTTTTTGCCTTGGTAAGCATGAGCCTACGTTAGAT (shown in SEQ ID NO.22)

Inner primer BIP:AATAAGGAGGGCATAGCTGGATCAGGCT(is shown in SEQ ID NO.23)

Bridge-type primer BP:CTAACGGATTCAAATAAGGAGG(is shown in SEQ ID NO.24)

2, sample preparation:

Clinical definite is the sick dog of dog Ai Lixi disease, gets whole blood sample, adopts commercial whole blood genome to extract test kit and carries out the nucleic acid extracting, obtains dna profiling, and concentration is 600ng/ μ L.

3, the processing of UNG enzyme, isothermal amplification reactions and detection:

System is formulated as follows:

10 * BST Buffer(NEB company) 1 μ L

10 * Taqe ligase Buffer(NEB company) 1 μ L

DUNTP(25mM, Takara company) 1 μ L

Outer primer F3(100 μ M) 0.1 μ L

Outer primer B3(100 μ M) 0.1 μ L

Inner primer FIP(100 μ M) 0.2 μ L

Inner primer BIP(100 μ M) 0.2 μ L

Bridge-type primer BP(100 μ M) 0.2 μ L

Dna profiling 1 μ L

Bst enzyme (NEB is diluted to 8U/ μ l) 1 μ L

Taq ligase（40U/μL，Thermo） 0.5μL

ddH ₂O 12.7μL

Mix centrifugal 30 seconds of 3000rpm, 64 ℃ of constant-temperature amplifications 1 hour after above-mentioned reaction system prepared.Amplified production is through 2%(2g/100ml) agarose gel electrophoresis, present the trapezoid-shaped strips of bright Marker shape.

Get above-mentioned amplification reaction solution 0.1 μ L as template, in conjunction with the UNG enzyme system, verify its effect of depolluting.Reaction system and method are as follows:

Reaction system:

10 * BST Buffer(NEB company) 1 μ L

10 * Taqe ligase Buffer(Thermo company) 1 μ L

DUNTP(25mM, Takara company) 1 μ L

Outer primer F3(100 μ M) 0.1 μ L

Outer primer B3(100 μ M) 0.1 μ L

Inner primer FIP(100 μ M) 0.2 μ L

Inner primer BIP(100 μ M) 0.2 μ L

Bridge-type primer BP(100 μ M) 0.2 μ L

UNG enzyme (2U/ μ L) 0.5 μ L

Above-mentioned amplification reaction solution 0.1 μ L

ddH ₂O 14.1μL

Above-mentioned reaction system was 25 ℃ of incubations 10 minutes, and 95 ℃ of effects made the UNG enzyme deactivation in 2 minutes.In reaction system, mend 1 μ L Bst enzyme (NEB is diluted to 8U/ μ l), 0.5 μ L Taq ligase(Thermo, 40U/ μ L) mix centrifugal 30 seconds of 3000rpm, 64 ℃ of constant-temperature amplifications 1 hour.Do the contrast that a pipe is handled without the UNG enzyme simultaneously.Reaction product is through 2%(2g/100ml) agarose gel electrophoresis, the result shows: without the reaction system of UNG enzyme processing, final amplified production presents the trapezoid-shaped strips of bright Marker shape, reaction system through the processing of UNG enzyme, amplified production does not produce any band, has avoided the generation of false positive results effectively.Can effectively avoid the generation of false positive results in conjunction with the anti-pollution system of UNG enzyme with the method for the invention.

Embodiment 5: connect primer SP-RCA certainly and detect double-stranded DNA

The inventive method can not need the bridge-type primer, makes the direct Cheng Huan of first round amplified production under the effect of single stranded DNA polysaccharase, and obtains the template sequence of RCA amplification.Singly increasing Liszt (Listeria monocytogenes) bacterium with detection is that example is described as follows:

Adopt the Listeria monocytogenes bacterial cultures as sample.Bacterial classification is available from ATCC(ATCC19116), get 1 μ L original seed bacterium liquid in the 3mlTSBYE substratum, in 35 ℃ of shaking culture 24 hours, get 200 μ L bacterial suspensions, centrifugal 2 minutes of 5000rpm collects thalline and is used as follow-up DNA extracting.According to the sequence information that NCBI announces, the hemolysin encoding gene hlyA conservative with Listeria monocytogenes is target sequence, partial sequence following (GenBank NO. AB566375):

CAGATTTTTCGGCAAAGCTGTTACTAAAGAGCAGTTGCAAGCGCTTGGAGTGAATG CAGAAAATCCTCCTGCATATATCTCAAGTGTGGCA TATGGCCGTCAAGTTTATTTGAAATTATCAACTAATTCCCATAGTACTAAAGTAAA AGCTGCTTTTGACGCTGCCGTAAGTGGGAAATCTG TCTCAGGTGATGTAGAACTGACAAATATCAT(is shown in SEQ ID NO.1)

1, according to above-mentioned sequence, four kinds of primers of design, and finish via primer Synesis Company, primer sequence is as follows:

Outer primer F3:CGGCAAAGCTGTTACTA(is shown in SEQ ID NO.2)

Outer primer B3:GTCAGTTCTACATCACC(is shown in SEQ ID NO.3)

Inner primer FIP:GCAGTTGCAAGCGCTTGG(is shown in SEQ ID NO.25)

Inner primer BIP:GACAGATTTCCCACTTACG(is shown in SEQ ID NO.26)

2, sample preparation:

Adopt commercial bacterial nucleic acid to extract test kit and carry out the DNA extracting, obtain the dna profiling of Listeria monocytogenes, concentration is 320ng/ μ L.

3, isothermal amplification reactions and detection:

20 μ L systems are formulated as follows:

10 * BST Buffer(NEB company) 1 μ L

10 * ssDNA Ligase Buffer(Epicentre company) 1 μ L

DNTP(25mM, Takara company) 1 μ L

ATP(1mM, Epicentre company) 1 μ L

MnCl ₂(50mM) 1μL

Outer primer F3(100 μ M) 0.1 μ L

Outer primer B3(100 μ M) 0.1 μ L

Inner primer FIP(100 μ M) 0.2 μ L

Inner primer BIP(100 μ M) 0.2 μ L

Dna profiling 1 μ L

Bst enzyme (NEB company is diluted to 8U/ μ l) 1 μ L

SsDNA Ligase(100U/ μ L, Epicentre company) 1 μ L

ddH ₂O 11.4μL

Mix centrifugal 30 seconds of 3000rpm, 64 ℃ of constant-temperature amplifications 1 hour after above-mentioned reaction system prepared.Amplified production is through 2%(2g/100ml) agarose gel electrophoresis, present the trapezoid-shaped strips of bright Marker shape.The result shows, connects primer HP-RCA amplification method certainly, in conjunction with the single stranded DNA ligase enzyme, under the situation that does not have the bridge-type primer, can detect To Template well through 1 hour isothermal amplification reactions.

Embodiment 6: hair clip primer HP-RCA detects double-stranded DNA

The inventive method can not need the bridge-type primer, utilize FIP and the BIP of particular design, form hairpin structure after amplification, the two ends of amplified production directly closely link to each other, under the effect of ligase enzyme, form a closed hoop structure, carry out follow-up RCA amplification as template.Method accordingly, singly to increase Liszt (Listeria monocytogenes) bacterium be that example is described as follows to detect:

Adopt the Listeria monocytogenes bacterial cultures as sample.Bacterial classification is available from ATCC(ATCC 19116), get 1 μ L original seed bacterium liquid in the 3mlTSBYE substratum, in 35 ℃ of shaking culture 24 hours, get 200 μ L bacterial suspensions, centrifugal 2 minutes of 5000rpm collects thalline and is used as follow-up DNA extracting.According to the sequence information that NCBI announces, the hemolysin encoding gene hlyA conservative with Listeria monocytogenes is target sequence, partial sequence following (GenBank NO. AB566375):

CAGATTTTTCGGCAAAGCTGTTACTAAAGAGCAGTTGCAAGCGCTTGGAGTGAATG CAGAAAATCCTCCTGCATATATCTCAAGTGTGGCA TATGGCCGTCAAGTTTATTTGAAATTATCAACTAATTCCCATAGTACTAAAGTAAA AGCTGCTTTTGACGCTGCCGTAAGTGGGAAATCTG TCTCAGGTGATGTAG(is shown in SEQ ID NO.27)

1, according to above-mentioned sequence, four kinds of primers of design, and finish via primer Synesis Company, primer sequence is as follows:

Outer primer F3:CGGCAAAGCTGTTACTA(is shown in SEQ ID NO.2)

Outer primer B3:CTTTTACTTTAGTACTATGG(is shown in SEQ ID NO.28)

Inner primer FIP:ATATGCAGGAGG GCAGTTGCAAGCGCTTGG(is shown in SEQ ID NO.29)

Inner primer BIP:ATCTCAAGTGTGGTTGATAATTTCAAATAAACTTG(is shown in SEQ ID NO.30)

2, sample preparation:

Adopt commercial bacterial nucleic acid to extract test kit and carry out the DNA extracting, obtain the dna profiling of Listeria monocytogenes, concentration is 320ng/ μ L.

3, isothermal amplification reactions and detection:

20 μ L systems are formulated as follows:

10 * BST Buffer (NEB company), 1 μ L

10 * Taq DNA Ligase Buffer(Thermo company) 1 μ L

DNTP(25mM, Takara company) 1 μ L

Outer primer F3(100 μ M) 0.1 μ L

Outer primer B3(100 μ M) 0.1 μ L

Inner primer FIP(100 μ M) 0.2 μ L

Inner primer BIP(100 μ M) 0.2 μ L

Dna profiling 1 μ L

Bst enzyme (NEB company is diluted to 8U/ μ l) 1 μ L

Taq DNA ligase(Thermo company, 40U/ μ L) 0.5 μ L

ddH ₂O 13.9μL

Mix centrifugal 30 seconds of 3000rpm, 64 ℃ of constant-temperature amplifications 1 hour after above-mentioned reaction system prepared.Amplified production is through 2%(2g/100ml) agarose gel electrophoresis, present the trapezoid-shaped strips of bright Marker shape.The result shows, utilizes the HP-RCA amplification method, through 1 hour isothermal amplification reactions, can detect the target nucleic acid template well.

Embodiment 7: bridge-type hair clip primer BHP-RCA binding molecule beacon detects To Template in real time

The inventive method can be passed through molecular beacon, realizes the real-time monitoring to amplified production.(Human Immunodeficiency Virus HIV) is the example explanation to present embodiment with human immunodeficiency virus.HIV is the single stranded RNA retrovirus, and most acquired immune deficiency syndrome (AIDS) are caused by the HIV-1 type.According to the sequence information that NCBI announces, the structural protein gag gene relatively more conservative with HIV-1 is target sequence, partial sequence following (GenBank NO.:AF128998):

TCGACGGAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGAC TGGTGAGTACGCCAAAATTTTTTACTAGCGGAGGC TAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATA AATGGGAGAAAATTCGGTTAAGGCCAGGAGGAAAG AAAACATATCAGTTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAA(is shown in SEQ ID NO.13)

1, according to top sequence, designed required four kinds of primers and a detection probe, primer sequence is as follows:

Outer primer F3:CGACGGAGGACTCGGCTTG(is shown in SEQ ID NO.14)

Outer primer B3:GCTTGCCCATACTATATG(is shown in SEQ ID NO.15)

Inner primer FIP:TGAATCCGTTAGTTTTTCGTACTCACCAGAAGCGCGCACGGCAAG (shown in SEQ ID NO.16)

Inner primer BIP:AATAAGGAGGCGGCTGCTGGCTGATATGTTTTCTTTCCTCC (shown in SEQ ID NO.17)

Bridge-type primer BP:CTAACGGATTCAAATAAGGAGG(is shown in SEQ ID NO.18)

Molecular beacon (detect and use probe): FAM-cacctcGATGGGTGCGAGAGCGTCAGgaggtg-DABCYL(is shown in SEQ ID NO.31); Wherein, FAM, DABCYL Chinese are respectively Fluoresceincarboxylic acid, 4-(4-oxane amino-benzene azo) phenylformic acid, they are respectively fluorophor and fluorescent quenching group, are the most frequently used a pair of combinations of molecular beacon.

2, sample preparation:

HIV viral RNA sample is so kind as to give by Xiamen ten thousand safe the deep blue sea bio tech ltd doctors Xu Feihai.Adopt commercial viral nucleic acid to extract test kit and carry out the RNA template that the nucleic acid extracting obtains HIV, concentration is 210ng/ μ L.

3, isothermal amplification reactions and detection:

20 μ L systems are formulated as follows:

10 * BST Buffer (NEB company), 1 μ L

10 * Taqe ligase Buffer (NEB company), 1 μ L

DNTP(25mM, Takara company) 1 μ L

Outer primer F3(100 μ M) 0.1 μ L

Outer primer B3(100 μ M) 0.1 μ L

Inner primer FIP(100 μ M) 0.2 μ L

Inner primer BIP(100 μ M) 0.2 μ L

Bridge-type primer BP(100 μ M) 0.2 μ L

Above-mentioned molecular beacon (10 μ M) 0.2 μ L

ROX Dye（150μM） 0.2μL

Dna profiling 1 μ L

Bst enzyme (NEB is diluted to 8U/ μ l) 1 μ L

AMV enzyme (30U/ μ L, Takara company) 1 μ L

Taq ligase(40U/ μ L, Thermo company) 0.5 μ L

ddH ₂O 12.3μL

After above-mentioned reaction system prepared, mix, centrifugal 30 seconds of 3000rpm, 64 ℃ of constant-temperature amplifications 1 hour carry out phosphor collection with the ABI7500 quantitative fluorescent PCR, collect the first order fluorescence signal in per 30 seconds.Fluorescence curve shows, enters the index amplification phase about 25 minutes.The result shows, can pass through molecular beacon with the method for the invention, realizes the real-time monitoring to amplified production.

In addition, component according to the isothermal amplification reactions system of embodiment 2-7, according to the preparation detection reagent cassette method among the embodiment 1, also the component (removing the outer component of dna profiling) of the isothermal amplification reactions system of embodiment 2-7 can be prepared into the detection kit that two primer correlated series ends that are applied to prepare the single stranded DNA chain accordingly connect into ring and can start the method for constant temperature rolling circle amplifications at least with these two primers, and detect according to the reaction conditions among each embodiment and detection method.

Claims (18)

1. two primer correlated series ends that prepare the single stranded DNA chain connect into the method for encircling and starting the constant temperature rolling circle amplifications at least with these two primers, it is characterized in that, comprise step:

1) oligonucleotide sequence design

Oligonucleotide sequence has four sections primers that design by target nucleic acid 3 ' → 5 ' direction at least: F3, FIP, BIP, B3;

Wherein, FIP is the front end inner primer;

BIP is the rear end inner primer;

F3, B3 are a pair of outer primers, lay respectively at the upstream of FIP and the downstream of BIP;

2) from target nucleic acid, amplify the single stranded DNA To Template

Target nucleic acid is DNA chain or when in the reaction soln that contains reversed transcriptive enzyme at least RNA chain target nucleic acid reverse transcription being the DNA chain, in containing the nucleic acid amplification reaction solution of the archaeal dna polymerase that has the strand displacement function at least, utilize primers F 3, FIP, BIP, B3, amplification synthesizes the single stranded DNA To Template according to target nucleic acid sequence;

3) dna ligase cyclized DNA To Template

In the reaction soln that contains dna ligase at least, the head and the tail two ends of DNA To Template are connected to form closed cyclized DNA chain;

4) cyclized DNA To Template rolling circle amplification

In the reaction soln that contains dna ligase and the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chains at least with two inner primers in the step 1), the nucleic acid product that obtains increasing.

2. the method for claim 1, it is characterized in that: the oligonucleotide sequence of described step 1) also comprises: bridge-type primer BP, hybridization probe, auxiliary primer;

Described bridge-type primer BP, its all or part of sequence and the complementation of an inner primer afterbody sequence, and its all or part of and afterbody sequence complementation another inner primer complementary sequence makes it as bridge the adjacent no base breach of the two terminal sequences ground of these two inner primers to be hybridized together;

Described hybridization probe, itself and the sequence hybridization of target nucleic acid among two inner primer correlated series positions;

Described auxiliary primer derives from the partial sequence that does not influence itself and target nucleic acid or bridge-type primer stable bond in BIP or the FIP primer, maybe should auxiliary primer also derives from sequence between BIP primer and the B3 primer or the sequence between this FIP primer and the F3 primer.

3. the method for claim 1, it is characterized in that: the oligonucleotide sequence of described step 1) can also carry out similar and different modification mark respectively, and this modification mark comprises: digoxin, fluorescence dye FAM, fluorescein isothiocyanate, vitamin H, fluorescent quenching group or nano particle.

4. the method for claim 1, it is characterized in that: in the described step 1), FIP only comprises the F2 sequence, F2 and target nucleic acid sequence F2c complementation; Described BIP only comprises the B2 sequence, and B2 is identical with the target nucleic acid partial sequence;

Step 2) in, utilize primers F 3, FIP, BIP, B3 to amplify the single stranded DNA To Template from target nucleic acid after, its two ends are respectively correlated series F2c, the B2 of two inner primers, its complementary strand two ends are respectively F2, B2c; Wherein, B2c is the complementary sequence of B2;

In the step 3), DNA To Template and complementary strand thereof can be connected to form the cyclized DNA chain of a closure by dna ligase;

In the step 4), in the reaction soln that contains the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chain at least with FIP and these two primers of BIP.

5. method as claimed in claim 4, it is characterized in that: in the described step 1), oligonucleotide sequence has also designed auxiliary primer;

Described auxiliary primer is several: this auxiliary primer derives from the 5 ' terminal sequence that do not influence B2 and target nucleic acid sequence stable bond in the BIP primer or the sequence between BIP primer and the B3 primer, maybe should auxiliary primer also derives from the 3 ' terminal sequence that do not influence F2 and target nucleic acid sequence stable bond in the FIP primer or the sequence between FIP primer and the F3 primer simultaneously.

6. the method for claim 1, it is characterized in that: in the described step 1), front end inner primer FIP comprises 2 sections sequence F1c, F2 at least by 5 ' → 3 ' sequence direction, wherein, F2 and F2c complementation, F2c is that target nucleic acid sequence F3c is in the partial sequence of target nucleic acid 5 ' direction; F1c in the FIP primer is the complementary sequence of F1, and F1c is identical with the partial sequence of the 5 ' direction that is in target nucleic acid sequence F2c, and F3c is the complementary sequence of F3;

Described rear end inner primer BIP comprises 2 sections sequence B 2, B1c at least by 3 ' → 5 ' sequence direction, and wherein, the B2 in the BIP primer is identical with the target nucleic acid partial sequence, and B1c is the partial sequence B1 complementation with the 3 ' direction that is in target nucleic acid B2 sequence;

Described F1c and B1 are adjacent no base two sections sequences in front and back at interval at target nucleic acid sequence;

Step 2) in, utilize primers F 3, FIP, BIP, B3 to amplify the single stranded DNA To Template from target nucleic acid after, DNA To Template and complementary strand two ends thereof form hairpin structure respectively; Wherein, formed between F1, the B1c or between F1c, the B1 and do not had the hybridization of base breach slit;

In the step 3), the gap between DNA To Template and the complementary strand two ends thereof can be connected closed by dna ligase, forms the cyclized DNA chain;

In the step 4), in the reaction soln that contains the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chain at least with FIP and two inner primers of BIP.

7. method as claimed in claim 6, it is characterized in that: in the described step 1), oligonucleotide sequence has also designed auxiliary primer;

Described auxiliary primer is several; Should auxiliary primer derive from the intermediate sequence that do not influence B2 and B1c and target nucleic acid sequence stable bond in the BIP primer or the sequence between BIP primer and the B3 primer, maybe this auxiliary primer also derives from the intermediate sequence that do not influence F2 and F1c and target nucleic acid sequence stable bond in the FIP primer or the sequence between FIP primer and the F3 primer simultaneously.

8. the method for claim 1, it is characterized in that: in the described step 1), front end inner primer FIP comprises 2 sections sequence F4, F2 at least by 5 ' → 3 ' sequence direction, wherein, the complementary hybridization of F2 and target nucleic acid sequence F2c; The F4 sequence is the dna sequence dna inequality and not complementary with the single stranded DNA To Template;

Described rear end inner primer BIP comprises 2 sections sequence B 2, B4 at least by 3 ' → 5 ' sequence direction, and wherein, B2 is identical with the target nucleic acid partial sequence; The B4 sequence is the dna sequence dna inequality and not complementary with the single stranded DNA To Template;

In the step 1), also be provided with bridge-type primer BP, it by 5 ' → 3 ' sequence direction respectively with FIP among the complementary sequence F4c of F4 and the BIP all or part of base hybridization of two sequences of B4 complementary, perhaps by 5 ' → 3 ' sequence direction respectively with BIP among the complementary sequence B4c of B4 and the FIP all or part of base hybridization of two sequences of F4 complementary;

Have at most among FIP and the BIP have in the inner primer partial sequence not with the complementation of bridge-type primer, and identical with the target nucleic acid partial sequence or complementary, its position is at inner primer F2 or B2 is identical with target nucleic acid or 3 ' extreme direction of complimentary positions;

Step 2) in, utilize primers F 3, FIP, BIP, B3 to amplify the single stranded DNA To Template from target nucleic acid after, the two ends of DNA To Template or its complementary strand are that complementary strand has formed and do not have the hybridization of base breach slit with the bridge-type primer;

In the step 3), the two ends of DNA To Template or its complementary strand can be connected to the cyclized DNA chain by dna ligase;

In the step 4), in the reaction soln that contains the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chain at least with FIP and two inner primers of BIP.

9. method as claimed in claim 8 is characterized in that: described bridge-type primer BP, four primer sequences that can be by other design from target nucleic acid sequence with the irrelevant fully sequence of single stranded DNA To Template sequence in amplification peel off out; Wherein, described four primer sequences, for: each 2 sequence of the inner primer that is different from F3, FIP, BIP, B3 of redesign and outer primer.

10. method as claimed in claim 8, it is characterized in that: oligonucleotide sequence has also designed auxiliary primer in the described step 1);

Described auxiliary primer derives from the intermediate sequence that do not influence B2 and target nucleic acid sequence stable bond, B4 and bridge-type primer stable bond in the BIP primer or the sequence between BIP primer and the B3 primer, maybe should auxiliary primer also derives from the intermediate sequence that do not influence F2 and target nucleic acid sequence stable bond, F4c and bridge-type primer stable bond in the FIP primer or the sequence between FIP primer and the F3 primer simultaneously.

11. the method for claim 1 is characterized in that: described step 2), reversed transcriptive enzyme comprises: AMV or M-MLV; The archaeal dna polymerase that has the strand displacement function comprises: Bst archaeal dna polymerase or Phi29DNA polysaccharase;

Step 2) in, contain the nucleic acid amplification reaction solution of the archaeal dna polymerase that has the strand displacement function at least, its component also comprises at least: amplification promotor and nucleic acid dye;

Wherein, amplification promotor comprises the combination of following one or more compositions: trimethyl-glycine, trehalose, proline(Pro), dimethyl sulfoxide (DMSO), Trimethylamine 99-N-oxide compound, Tetramethylammonium chloride, methane amide, BSA, single strand binding protein, T4Gene32Protein, homoectoine, Zn ²⁺-cyclen;

Described nucleic acid dye comprises: SYBR Green I, fluorexon, GELGREEN and GELRED.

12. the method for claim 1 is characterized in that: described step 2), before amplifying the single stranded DNA To Template according to target nucleic acid, can also carry out the target nucleic acid amplified production abatement of pollution of sample and handle:

After sample is finished nucleic acid extraction, add uridylic-N-glycosylase, may cause the uridylic in the target nucleic acid amplified production that pollutes to carry out the glycosidic link hydrolysis to sample, after this, solution temperature is elevated to 55-98 ℃ and kept maximum 10 minutes, and the uridylic in the solution-N-glycosylase will be inactivated.

13. method as claimed in claim 12, it is characterized in that: described abatement of pollution is handled, is increased in strand To Template, dna ligase cyclisation To Template, four steps of cyclisation To Template rolling circle amplification, each step can arrange different temperature condition, or some steps are wherein arranged same temperature; Related reagent composition in these four steps can repeatedly add respectively or once add and finish.

14. the method for claim 1 is characterized in that: described step 3), 4), described dna ligase comprises: T4DNA ligase, Taq DNA Ligase, Ampligase and ssDNA ligase.

15. method as claimed in claim 2 is characterized in that: in the described step 4), the archaeal dna polymerase that has the strand displacement function comprises: Bst archaeal dna polymerase or Phi29DNA polysaccharase;

The described reaction soln that contains dna ligase and have the archaeal dna polymerase of strand displacement function, its component also comprises at least: amplification promotor or nucleic acid dye;

Wherein, amplification promotor comprises the combination of following one or more compositions: trimethyl-glycine, trehalose, proline(Pro), dimethyl sulfoxide (DMSO), Trimethylamine 99-N-oxide compound, Tetramethylammonium chloride, methane amide, BSA, single strand binding protein, T4Gene32Protein, homoectoine, Zn ²⁺-cyclen;

Described nucleic acid dye comprises: SYBR Green I, fluorexon, GELGREEN and GELRED.

16. the method for claim 1 is characterized in that: the nucleic acid product in the single stranded DNA To Template of amplification described step 2), the cyclized DNA chain of step 3) and the step 4), can detect by immune chromatography test paper or fluorescent signal.

17. one kind is applied to the test kit of method according to claim 1, it is characterized in that: comprise oligonucleotide sequence as claimed in claim 1 at least.

18. test kit as claimed in claim 17 is characterized in that: described test kit also comprises at least a in the following component:

(1) the strand displacement function DNA polysaccharase that has as claimed in claim 11;

(2) dna ligase as claimed in claim 14;

(3) amplification promotor as claimed in claim 11;

(4) nucleic acid dye as claimed in claim 11;

(5) uridylic-N-glycosylase;

(6) reversed transcriptive enzyme as claimed in claim 11.

Images