CN103255227A - Primer-mediated cyclized constant-temperature nucleic acid rolling circle amplification method and kit - Google Patents

Abstract

The invention discloses a primer-mediated circularization thermostatic nucleic acid rolling circle amplification method and a kit, comprising: 1) oligonucleotide sequence design; 2) amplifying a single-stranded DNA target template from a target nucleic acid; 3 ) DNA ligase circularizes the DNA target template; 4) circularizes the DNA target template rolling circle amplification. The present invention does not need to synthesize high-cost long lock probes, the length of the sequence of the target nucleic acid can be larger, can perform rolling circle amplification on any sequence of the target nucleic acid, and provides a solution to prevent samples from being polluted by amplified products. Opened a new era of genetic testing into the application of grassroots units.

Description

Primer-mediated circularization constant temperature nucleic acid rolling circle amplification method and kit

technical field

The present invention relates to a nucleic acid sequence constant temperature amplification method and kit, more specifically, to a constant temperature nucleic acid rolling circle amplification method for primer-mediated circularization, that is, two primer-related sequences for preparing single-stranded DNA strands A method and a kit (Primer mediated Rolling Circle Amplification, PRCA) capable of starting constant temperature rolling circle amplification with at least two primers connected to form a circle at the ends.

Background technique

In 1985, the U.S. Cetus company used Polymerase Chain Reaction (Polymerase Chain Reaction, PCR) technology to realize the in vitro amplification of nucleic acid for the first time, which played a very important role in the development of modern molecular biology. It can be said that PCR technology is a biological A revolutionary initiative and milestone in the field of medicine. However, the PCR method still has deficiencies such as: the double-stranded DNA needs to be denatured during the amplification process, a special PCR instrument that can rapidly raise and lower the temperature is required, and false positive results are generated due to non-specific amplification. Therefore, some new nucleic acid amplification techniques have been developed in the past ten years to make up for the shortage of PCR technology, and even have a tendency to replace PCR technology. Therefore, the amplification methods of gene fragments are now abundant and diverse, and have become the basic techniques of modern molecular biology.

In recent years, a variety of constant temperature amplification technologies have emerged, which can achieve nucleic acid (DNA or RNA) amplification under one or more specific temperature conditions (such as 64°C, 42°C, etc.). The existing isothermal amplification technologies in the world are as follows:

Strand Displacement Amplification (SDA)

Nucleic acid sequence-dependent amplification technique (NASBA)

Transcription Mediated Amplification (TMA)

Rolling Circle Amplification (RCA)

Ligase Chain Reaction (LCR)

Helicase-dependent amplification (HDA)

Loop-mediated isothermal amplification (LAMP).

Among them, NASBA avoids high-temperature denaturation through a series of transcription and reverse transcription cycles, and SDA uses restriction enzymes and modified templates for cycle amplification. Although they are all highly sensitive and can amplify nucleic acid samples with less than 10 copies, they also have their own shortcomings that need to be overcome. Technical requirements, material and instrument requirements, and specific defects of the technology itself seriously restrict the popularization and application of these technologies.

Walker et al first proposed the DNA strand displacement amplification (SDA) method in 1991. In this method, a base gap is generated on a strand of DNA by a certain technical means (such as a restriction endonuclease), and the DNA polymerase starts the extension reaction from the 3' end of the base gap, and at the same time, the downstream old strand is stripped, The base gaps blocked by chain extension can be repeatedly generated, so that the process of cleavage and extension chain displacement is repeated. In 1992, Walker et al. simplified the SDA design and used 4 primers (B1, B2, S1, S2) to anneal to the target DNA after heat denaturation, among which primers S1 and S2 were primers for SDA amplification; B1, B2 Located upstream and downstream of S1 and S2 respectively, the function is to strip the products after the first and second rounds of extension of S1 and S2.

In 2000, the Japanese scholar Notomi disclosed the loop-mediated isothermal amplification reaction LAMP technology in the journal Nucleic Acids Res. It overcomes the shortcomings of previous gene amplification methods and can perform specific, efficient and rapid nucleic acid amplification under isothermal conditions. Has many advantages. However, the length of the nucleic acid target sequence of LAMP is generally recommended to be 120-180bp, preferably within 300bp, and it is difficult to amplify if it is greater than 500bp. Therefore, the amplification of long-chain DNA cannot be performed. In addition, the LAMP technology is inferior to the traditional PCR method in terms of recovery and identification, cloning, and single-strand isolation of nucleic acid amplification products.

Rolling circle amplification (RCA) is a newly developed constant temperature nucleic acid amplification method, which has gradually attracted people's attention in recent years due to its high specificity, high sensitivity and easy operation, and has become more and more popular. It is widely used in basic research and practical testing. People have developed various amplification methods using RCA, and related literature can refer to US Patent Nos.

Rolling circle amplification is a nucleic acid amplification technology established by referring to the rolling circle replication method of DNA molecules of circular pathogenic microorganisms in nature. People's research focuses on how to circularize nucleic acid fragments and how to design primers to trigger rolling circle amplification. The RCA reaction described in most existing literatures is divided into two parts: the ligation of the padlock probe and the amplification after ligation. The 5-terminal and 3-terminal specific sequences of the padlock probe are combined with the complementary regions on the target sequence, and then connected into a circle under the action of ligase. The circularized padlock probes are subjected to rolling circle amplification at a constant temperature in the presence of a primer and a suitable DNA polymerase. In 1998, based on the linear rolling circle amplification technique, Lizardi et al. invented the hyperbranched rolling circle amplification technique (HRCA/CRCA/RAM). On the basis of RCA, HRCA adds a primer with the same sequence as that in the padlock probe. It not only has the high sequence specificity and simple operation of RCA, but also the product is highly branched in the presence of two primers. amplification with high sensitivity.

US Patent No. 60/506,218 introduces a variety of technologies for rolling circle amplification using RNA or DNA templates, which utilize nucleic acid linker fragments to connect target nucleic acid sequences to form a circle.

The article "Establishment of a Method for Efficiently Amplifying Small DNA Fragments" published by Li Yan et al. (Journal of Capital Medical University, Issue 01, 2011) introduces a new method instead of synthesizing small DNA fragments, which is directly connected by single-stranded DNA ligase Form a circle, then add specific forward and reverse primers to amplify and replicate by the rolling circle method, and finally obtain a large number of small fragments of the same sequence by enzyme digestion.

Existing RCA and HRCA often require multi-step reactions such as double-strand denaturation, enzyme ligation, and rolling circle amplification, which require different temperatures and multiple additions of reaction reagents. Specially designed primers need to be added to start rolling circle amplification. Not suitable for grassroots use.

In 2012, Wang Xiaoliang published his master's degree thesis "Research on SC-RCA DNA Amplification Technology at Normal Temperature" (Ocean University of China), which introduced an improved rolling circle amplification technology--Self circularization-RCA technology. , SC-RCA), this technology uses a restriction endonuclease with a specific enzyme cutting site to digest the target DNA, and then connects the digested fragment and the specially designed linker into a circle by ligase to realize the target DNA Rolling circle replication. The high-cost synthesis of long lock-type probes is omitted, and the specificity of ligation into a circle can be guaranteed. SC-RCA technology avoids the disadvantage of LAMP technology that it is difficult to distinguish non-specific amplification, and it is easier to form a circle than Padlock-RCA. In SC-RCA technology, after the target nucleotide sequence with a restriction endonuclease site is specifically digested, the digested fragment is connected to a specially designed nucleic acid linker by DNA ligase to form a circular circle. Although this article can replace the synthetic sequence of the target nucleic acid partial sequence with a specially designed adapter to directly form a circle by enzymatic digestion, which saves the high-cost synthesis of long lock probes, it requires an enzyme at the position of the amplified target nucleic acid sequence. Cutting sites, specifically designed adapters should be added for circularization, and specially designed primers should be added for rolling circle amplification. The experiments in this article need to carry out enzyme digestion, ligation, and rolling circle amplification separately, which cannot be completed in one solution system at one time. operate.

Contents of the invention

The technical problem to be solved by the present invention is to provide a constant temperature nucleic acid rolling circle amplification method and kit for primer-mediated circularization, that is, a method for preparing a single-stranded DNA chain with two primer-related sequence ends connected to form a circle and capable of at least The two primers directly start the constant temperature rolling circle amplification method and kit. The method of the present invention can complete the nucleic acid amplification after adding all the reagents in a solution system at a time and maintaining the constant temperature for a certain period of time. The present invention also applies the UNG enzyme to the constant temperature rolling circle amplification method. Thoroughly eliminate possible amplification product contamination of the sample. In addition, the amplification product of the present invention can also be detected by immunochromatographic test paper. Therefore, the present invention can turn the amplification and detection of genes into simple operations, and can open the era of the application of gene diagnosis technology towards grassroots units.

According to the 3'-5' sequence direction of the target nucleic acid, the present invention has four primers: F3, FIP, BIP, and B3. Among them, FIP is the front-end inner primer, BIP is the back-end inner primer, and F3 and B3 are a pair of outer primers, which are respectively located upstream and downstream of FIP and BIP. DNA polymerase with strand displacement function and reverse transcription can be increased if necessary. Under the action of enzymes and appropriate amplification promoters, the four primers use the target nucleic acid as a template to amplify and strip off a single-stranded target template. The first and last ends of the DNA target template are ligated by a suitable DNA ligase at a constant temperature to form a closed circularized target template. The initial primer that can be complementary to the circularized target template starts DNA rolling circle amplification from the 3' end along the circularized target template, and repeats the replication of the circularized target template. The amplification product is thousands of A tandem repeat copy that is twice the length of the single loop of the target template. Each single loop sequence has sequences complementary to other primers that hybridize and initiate DNA strand synthesis in reverse, replicating amplification that terminates in the tandem repeat copy The end of the product is the complementary strand to the 5' end of the starting primer. The complementary strand terminating at the 5' tail of the initial primer contains single or multiple lengths of target templates, and the initial primer will hybridize with the complementary sequence in each target template to initiate new replication. Complementary strands containing target templates of multiple lengths will generate a single-length target template after alternate replication and stripping of the inner primer; the newly replicated single-length target template will be continuously circularized by ligase and start a new round of rolling circle Amplify. Repeatedly, a huge amount of nucleic acid products will be amplified and copied (as shown in Figure 2).

One of the contents of the present invention is that when the length of the single-stranded target template is appropriate, the two ends of the single-stranded target template can be directly docked and closed to form a circle by single-stranded DNA ligase; thereafter, the two internal primers used to amplify and copy the single-stranded target template start Rolling circle amplification with alternate replacements; in rolling circle amplification, new target templates will be copied continuously, which will be continuously circularized by ligase and start a new round of rolling circle amplification.

The second content of the present invention is to design two internal primers whose tails are complementary to the target nucleic acid sequence, so that both ends of the copied target template form a hairpin structure, and there is no base gap between them and are adjacent to the target nucleic acid sequence. Partial sequence hybridization; under the action of a suitable DNA ligase, the two ends of the target template are ligated and closed to form a circle; the two internal primers used to amplify and copy the single-stranded target template initiate rolling circle amplification with alternate displacement in sequence. In rolling circle amplification, new target templates will be continuously copied, which will be circularized by ligase and start a new round of rolling circle amplification.

The third content of the present invention is to design at least one inner primer and one bridge primer whose tail is not complementary to the target nucleic acid sequence. The 3'-end tail sequence of the replicated and stripped target template does not hybridize with the target nucleic acid sequence, but hybridizes with the bridge primer in whole or in part; the 5'-end tail sequence of the target template hybridizes with the bridge primer in whole or in part; between the two ends of the target template There is no base gap and adjacently hybridizes with the bridge primer; under the action of a suitable DNA ligase, the two ends of the target template are connected and closed to form a circle; the two internal primers used to amplify and copy the single-stranded target template start to alternate Replacement rolling circle amplification; in rolling circle amplification, new single-stranded target templates will be continuously copied, which will be continuously circularized by ligase and start a new round of rolling circle amplification. Please refer to Figure 1 for the above description.

More specifically, a method of the present invention for preparing a single-stranded DNA chain in which two primer-related sequence ends are connected to form a circle and at least the two primers can be used to initiate constant temperature rolling circle amplification, comprising the steps of:

1) Oligonucleotide sequence design

The oligonucleotide sequence has at least four primers designed according to the 3'→5' direction of the target nucleic acid: F3, FIP, BIP, B3;

Wherein, FIP is the front-end inner primer;

BIP is the back-end inner primer;

F3 and B3 are a pair of outer primers located upstream of FIP and downstream of BIP respectively;

2) Amplify the single-stranded DNA target template from the target nucleic acid

When the target nucleic acid is a DNA strand or the RNA strand target nucleic acid is reverse-transcribed into a DNA strand in a reaction solution containing at least a reverse transcriptase, in a nucleic acid amplification reaction solution containing at least a DNA polymerase with a strand displacement function, using a primer F3, FIP, BIP, B3, synthesize single-stranded DNA target templates according to target nucleic acid sequence amplification;

3) DNA ligase circularizes DNA target template

In the reaction solution containing at least DNA ligase, the first and last ends of the DNA target template are ligated to form a closed circularized DNA chain;

4) Circularized DNA target template rolling circle amplification

In the reaction solution containing at least DNA ligase and DNA polymerase with strand displacement function, at least two internal primers in step 1) are used to initiate rolling circle amplification of circularized DNA strands to obtain amplified nucleic acid products.

The oligonucleotide sequence in step 1) also includes: a bridge primer BP, a hybridization probe, and an auxiliary primer; all or part of the bridge primer BP is complementary to the tail sequence of an inner primer, and all or The part is complementary to the tail sequence of the complementary sequence of another internal primer, so that it hybridizes the two end sequences of the two internal primers adjacent to each other without a base gap like a bridge; Sequence hybridization among the relative sequence positions of the two internal primers; the auxiliary primer is derived from the partial sequence of the BIP or FIP primer that does not affect its stable combination with the target nucleic acid or the bridge primer, or the auxiliary primer is also derived from the combination of the BIP primer and the bridge primer The sequence between the B3 primers or the sequence between the FIP primer and the F3 primer.

The oligonucleotide sequences in the step 1) can also be modified and marked with different or the same, including: digoxin, fluorescent dye FAM, fluorescein isothiocyanate, biotin, fluorescence quenching group or nanoparticles.

In the step 1), the FIP only includes the F2 sequence, and F2 is complementary to the target nucleic acid sequence F2c; the BIP only includes the B2 sequence, and B2 is identical to the partial sequence of the target nucleic acid; in the step 2), using primers F3, FIP, BIP, After B3 amplifies the single-stranded DNA target template from the target nucleic acid, its two ends are the relevant sequences F2c and B2 of the two inner primers respectively, and the two ends of the complementary chain are F2 and B2c respectively; wherein, B2c is the complementary sequence of B2; In step 3), the DNA target template and its complementary strand can be joined by DNA ligase to form a closed circularized DNA strand; in step 4), in the reaction solution containing at least a DNA polymerase with strand displacement function, at least Rolling circle amplification of circularized DNA strands was initiated with two primers, FIP and BIP.

In the step 1), the oligonucleotide sequence is also designed with auxiliary primers; the auxiliary primers are several: the auxiliary primers are derived from the 5' end sequence or BIP that does not affect the stable binding of B2 to the target nucleic acid sequence in the BIP primer The sequence between the primer and the B3 primer, or the auxiliary primer is also derived from the 3' end sequence of the FIP primer that does not affect the stable combination of F2 and the target nucleic acid sequence or the sequence between the FIP primer and the F3 primer.

In the step 1), the front-end internal primer FIP contains at least two sequences F1c and F2 in the sequence direction of 5'→3', wherein F2 and F2c are complementary, and F2c is a partial sequence of the target nucleic acid sequence F3c in the 5' direction of the target nucleic acid ; F1c in the FIP primer is the complementary sequence of F1, F1c is identical with the partial sequence in the 5' direction of the target nucleic acid sequence F2c, and F3c is the complementary sequence of F3; the primer BIP in the back end is in the sequence of 3'→5' The direction includes at least two sequences B2 and B1c, wherein B2 in the BIP primer is identical to the partial sequence of the target nucleic acid, and B1c is complementary to the partial sequence B1 in the 3' direction of the target nucleic acid B2 sequence; The nucleic acid sequence is two sequences before and after adjacent abasic intervals; in step 2), after using primers F3, FIP, BIP, and B3 to amplify the single-stranded DNA target template from the target nucleic acid, the DNA target template and its complementary strand The two ends respectively form a hairpin structure; among them, a hybridization gap without a base gap is formed between F1 and B1c or between F1c and B1; in step 3), the gap between the two ends of the DNA target template and its complementary strand can be DNA ligase joins and closes to form a circularized DNA chain; in step 4), in a reaction solution containing at least a DNA polymerase with strand displacement function, at least two internal primers, FIP and BIP, are used to initiate the rolling of the circularized DNA chain Circle amplification.

In the step 1), the oligonucleotide sequence is also designed with auxiliary primers; the auxiliary primers are several; the auxiliary primers are derived from the intermediate sequence or BIP in the BIP primers that do not affect the stable combination of B2 and B1c with the target nucleic acid sequence The sequence between the primer and the B3 primer, or the auxiliary primer is also derived from the intermediate sequence in the FIP primer that does not affect the stable combination of F2 and F1c with the target nucleic acid sequence, or the sequence between the FIP primer and the F3 primer.

In the step 1), the front-end internal primer FIP contains at least two sequences F4 and F2 in the sequence direction of 5'→3', wherein, F2 is complementary to the target nucleic acid sequence F2c and hybridizes; the F4 sequence is different from the single-stranded DNA target template and a non-complementary DNA sequence; the back-end internal primer BIP contains at least two sequences B2 and B4 in the sequence direction of 3'→5', wherein, B2 is identical to the partial sequence of the target nucleic acid; the sequence of B4 is identical to the single-stranded DNA target template Different and non-complementary DNA sequences; in step 1), there is also a bridge primer BP, which is the complementary sequence F4c of F4 in FIP and the two sequences of B4 in BIP respectively in the 5'→3' sequence direction or all or Partial base hybridization and complementarity, or hybridization and complementarity with all or part of the bases of the complementary sequence B4c of B4 in BIP and F4 in FIP in the sequence direction of 5'→3'; FIP and BIP have at most one inner primer Part of the sequence is not complementary to the bridge primer, but is identical or complementary to the partial sequence of the target nucleic acid, and its position is in the direction of the 3' end of the same or complementary position of the internal primer F2 or B2 to the target nucleic acid; in step 2), use primers F3, After FIP, BIP, and B3 amplify the single-stranded DNA target template from the target nucleic acid, the two ends of the DNA target template or its complementary strand form a hybridization gap without base gaps with the bridge primer as the complementary strand; step 3), The two ends of the DNA target template or its complementary strand can be connected into a circularized DNA strand by DNA ligase; in step 4), in the reaction solution containing at least a DNA polymerase with strand displacement function, at least two FIP and BIP Each internal primer initiates rolling circle amplification of the circularized DNA strand.

The bridge primer BP can be amplified and stripped from the sequence completely unrelated to the single-stranded DNA target template sequence in the target nucleic acid sequence through four additionally designed primer sequences; wherein, the four primer sequences are: re- Two sequences of inner primers and outer primers different from F3, FIP, BIP, and B3 were designed.

The oligonucleotide sequence in the step 1) is also designed with an auxiliary primer; the auxiliary primer is derived from the intermediate sequence in the BIP primer that does not affect the stable binding of B2 to the target nucleic acid sequence, and the stable binding of B4 to the bridge primer or the BIP primer and The sequence between the B3 primers, or the auxiliary primer is also derived from the intermediate sequence in the FIP primer that does not affect the stable binding of F2 to the target nucleic acid sequence, the stable binding of F4c to the bridge primer, or the sequence between the FIP primer and the F3 primer.

In the step 2), the reverse transcriptase includes: AMV or M-MLV; the DNA polymerase with strand displacement function includes: Bst DNA polymerase or Phi29 DNA polymerase; in step 2), at least the DNA polymerase with strand displacement function The nucleic acid amplification reaction solution of the DNA polymerase, its component also comprises at least: amplification promoter and nucleic acid dye; Wherein, the amplification promoter comprises the combination of following one or more components: betaine, trehalose, promethazine amino acid, dimethyl sulfoxide, trimethylamine-N-oxide, tetramethylammonium chloride, formamide, BSA, single-chain binding protein, T4Gene32Protein, homoectoine, Zn ²⁺ -cyclen (cyclen is 1,4, 7,10-tetraazacyclododecane); the nucleic acid dyes include: SYBR Green I, Calcein, GELGREEN and GELRED.

In the step 2), before the single-stranded DNA target template is amplified according to the target nucleic acid, the target nucleic acid amplification product contamination elimination treatment of the sample can also be carried out: after the nucleic acid extraction of the sample is completed, uracil-N-glycosylated The enzyme hydrolyzes the glycosidic bond of uracil in the target nucleic acid amplification product that may have caused contamination to the sample. After that, the temperature of the solution is raised to 55-98°C and maintained for a maximum of 10 minutes. The uracil-N- in the solution Glycosylases will be inactivated.

In the four steps of pollution elimination treatment, amplification of single-stranded target template, DNA ligase circularization target template, and circularization target template rolling circle amplification, different temperature conditions can be set for each step, or several steps can be set to The same temperature; the relevant reagent components in these four steps can be added multiple times or completed in one addition.

In the steps 3) and 4), the DNA ligase includes: T4DNA ligase, Taq DNA Ligase, Ampligase and ssDNAligase.

In step 4), the DNA polymerase with strand displacement function includes: Bst DNA polymerase or Phi29 DNA polymerase; the reaction solution containing DNA ligase and DNA polymerase with strand displacement function, its components It also includes at least: an amplification accelerator or a nucleic acid dye; wherein, the amplification accelerator includes a combination of one or more of the following components: betaine, trehalose, proline, dimethyl sulfoxide, trimethylamine-N- oxide, tetramethylammonium chloride, formamide, BSA, single-chain binding protein, T4Gene32Protein, homoectoine, Zn ²⁺ -cyclen; the nucleic acid dyes include: SYBR Green I, calcein, GELGREEN and GELRED.

The amplified single-stranded DNA target template in step 2), the circularized DNA strand in step 3) and the nucleic acid product in step 4) can be detected by immunochromatographic test paper or fluorescent signals. For example, the amplified single-stranded DNA target template in step 2), the circularized DNA strand in step 3), and the nucleic acid product in step 4) may carry or be combined with an oligonucleotide sequence of a modified labeling molecule; wherein, the modification The labeled molecule can be recognized by the corresponding ligand, and the product can be detected by immunochromatographic test paper; the amplified single-stranded DNA target template in step 2), the circularized DNA strand in step 3) and the nucleic acid in step 4) The product can also cause the rise or fall of the fluorescent signal, and the product can be detected by the fluorescent signal.

In addition, according to the above method, the present invention also discloses a kit applied to the method, comprising at least the above oligonucleotide sequence.

The kit also includes at least one of the following components:

(1) The above-mentioned DNA polymerase with strand displacement function;

(2) The above-mentioned DNA ligase;

(3) The above-mentioned amplification promoters;

(4) The above-mentioned nucleic acid dyes;

(5) Uracil-N-glycosylase;

(6) The above-mentioned reverse transcriptase.

In the present invention, the two ends of the DNA single-strand target template that are amplified and stripped from the target nucleic acid by two internal and external primers can be ligated under suitable conditions by a suitable DNA ligase to form a closed circularized target template. DNA polymerase with strand displacement function initiates rolling circle amplification using closed circular DNA as a template under constant temperature conditions. New single-stranded DNA target templates constantly appear in the rolling circle amplification product, which will be continuously circularized by DNA ligase and start a new round of rolling circle amplification. The invention can complete the amplification after adding all the reagents in a solution system at a time and keeping the constant temperature for a certain period of time.

Compared with prior art, the beneficial effect of the present invention is:

1) Compared with the existing padlock probe rolling circle amplification technology, the present invention does not need to synthesize high-cost long padlock probes, and the sequence length of the target nucleic acid can be larger;

2) Compared with the existing enzyme-cut rolling circle amplification technology, the present invention can carry out rolling circle amplification on any sequence of target nucleic acid through the design of primers;

3) Compared with the existing rolling circle amplification technology and other constant temperature amplification technologies (except LAMP), which need to be operated at different temperatures in different solution systems step by step, the present invention can add all the reagents in one solution system at one time The amplification can be completed by keeping the constant temperature for a certain period of time, which provides a solution for the closed amplification of the amplification product and to prevent the sample from being contaminated by the amplification product;

4) Compared with the current LAMP technology that can add all the reagents in one solution system at one time and amplify at a constant temperature, the present invention can provide fewer and simpler primer designs. In some methods, only four primers related to the target nucleic acid are required , some methods require 5 primers related to the target nucleic acid. In view of the fact that RNA viruses are easy to mutate genes, and there are point mutations even in conserved sequences, a small number of primers can be more convenient for species-specific design;

5) Compared with the existing constant temperature amplification technology, the present invention applies UNG enzyme to the constant temperature rolling circle amplification method to completely eliminate possible amplification product contamination of the sample before starting the amplification. This technically solves the problem that grassroots units cannot use existing nucleic acid reagents due to the inability to perform detection partition operations, and truly opens a new era of genetic testing entering grassroots units.

Description of drawings

Fig. 1 is the schematic diagram of constant temperature rolling circle amplification of the present invention;

In Figure 1, there are four primers in sequence according to the 3'-5' sequence direction of the target nucleic acid: F3, FIP, BIP, B3. Among them, FIP is the front-end inner primer, BIP is the back-end inner primer, and F3 and B3 are a pair of outer primers, which are respectively located upstream and downstream of FIP and BIP. DNA polymerase with strand displacement function and reverse transcription can be increased if necessary. Under the action of enzymes and appropriate amplification promoters, the four primers use the target nucleic acid as a template to amplify and strip off a single-stranded target template.

According to the difference in the design of the two internal primers, three amplification methods are derived respectively:

The first method is self-primed rolling circle amplification (SP-RCA): the FIP front-end primer FIP only contains the F2 sequence; the back-end primer BIP only contains the B2 sequence; after the single-stranded DNA target template is copied and synthesized, the two The ends are F2c and B2 respectively, which can be ligated by DNA ligase to form a closed circularized DNA chain; the circularized DNA chain will undergo rolling circle amplification under the initiation of FIP primers.

The second method is hairpin primer rolling circle amplification (HP-RCA): the front-end internal primer FIP contains F1c and F2 in the 5'→3' sequence direction; the back-end internal primer BIP contains B2 in the 3'→5' sequence direction , B1c. At the same time, F1c and B1 are the two sequences before and after the adjacent abasic interval on the target nucleic acid sequence; after the target template is copied and synthesized, its two ends are the related sequences F1 and B1c of the two internal primers, and F1 and F1c are complementary , B1 and B1c are complementary, and the two ends of the target template form a hairpin structure respectively, and a gap without a base gap is formed between F1 and B1c; the gap between the two ends of the target template is connected and closed by DNA ligase, and its complementary strand into a circularized DNA strand. Inner FIP primers complementary to circularized DNA strands initiate rolling circle amplification

The third method is bridge hairpin primer rolling circle amplification (BH-RCA): the front-end inner primer FIP includes F4 and F2 in the sequence direction of 5'→3'. The primer BIP in the back end contains B2 and B4 in the sequence direction of 3'→5'. The bridge primer BP was hybridized and complementary to the two complementary sequences of F4, F4c and B4, respectively in the 5'→3' sequence direction. After the target template is copied and synthesized, its two ends are F4c and B4 respectively; the 5' end part sequence of the bridge primer is fully hybridized with B4, and its 3' end part sequence is fully hybridized with F4c; both ends of the target template are F4c and B4. The bridge primer is used as the complementary strand to form a hybridization gap without base gaps, which is connected by a suitable DNA ligase as a circularized target template; the middle sequence of the primer in FIP is not complementary to the bridge primer, but is identical to the partial sequence of the target nucleic acid . The complementary sequence of the middle sequence of the primer in the FIP in the copied target template can hybridize with the target nucleic acid, so the circularized target template has a dumbbell-shaped structure. The inner primer complementary to the circularized target template and BP are simultaneously used as initial primers to initiate rolling circle amplification.

Fig. 2 is a schematic diagram of the amplification method of the present invention.

In Figure 2, a schematic illustration of self-primer rolling circle amplification (SP-RCA): four primers are set in sequence according to the 3'-5' sequence direction of the target nucleic acid: F3, FIP, BIP, B3. Among them, FIP is the front-end inner primer, BIP is the back-end inner primer, and F3 and B3 are a pair of outer primers, which are respectively located upstream and downstream of FIP and BIP. DNA polymerase with strand displacement function and reverse transcription can be increased if necessary. Under the action of enzymes and appropriate amplification promoters, the four primers use the target nucleic acid as a template to amplify and strip off a single-stranded target template. The first and last ends of the DNA target template are ligated by a suitable DNA ligase at a constant temperature to form a closed circularized target template.

The initial primer FIP, which can be complementary to the circularized target template, starts DNA rolling circle amplification from the 3' end of the circularized target template, and repeats the replication of the circularized target template. A tandem repeat copy thousands of times the length of the target template single loop, each single loop sequence has a sequence complementary to the BIP primer, the BIP primer hybridizes and initiates reverse DNA strand synthesis, and can replicate the amplified terminating in the tandem repeat copy The end of the amplified product is the complementary strand at the 5' end of the FIP primer. The complementary strand terminating at the 5' end of the FIP primer contains target templates of single or multiple lengths, and the FIP primer will hybridize with the complementary sequence in each target template to initiate new replication. Complementary strands containing target templates of multiple lengths will generate a single-length target template after alternate replication and stripping of primers in FIP and BIP; this newly replicated single-length target template will be continuously circularized by ligase and start a new round rolling circle amplification. Repeatedly, a huge amount of nucleic acid products will be amplified and copied

Detailed ways

The present invention will be described in further detail below by way of examples.

The chemical reagents involved in the following examples are commercially available commercial products unless otherwise specified.

Example 1: Bridge hairpin primer BHP-RCA detects double-stranded DNA

In this embodiment, a bacterial culture of Listeria monocytogenes is used as a sample. Bacteria were purchased from ATCC (ATCC19116). Take 1 μL of the original seed solution into 3 ml of TSBYE medium, shake and culture at 35°C for 24 hours, take 200 μL of bacterial suspension, centrifuge at 5000 rpm for 2 minutes, and collect the bacteria for subsequent DNA extraction. According to the sequence information released by NCBI, the relatively conserved hemolysin coding gene hlyA of Listeria monocytogenes was used as the target sequence, and the partial sequence is as follows (GenBank No.AB566375):

CAGATTTTTCGGCAAAGCTGTTACTAAAGAGCAGTTGCAAGCGCTTGGAGTGAATGCAGAAAATCCTCCTGCATATCTCCAAGTGTGGCATATGGCCGTCCAAGTTTATTTGAAATTATCAACTAATTCCCATAGTACTAAAGTAAAAGCTGCTTTTGACGCTGCCGTAAGTGGGAAATCTGTCTCAGGTGATGTAGAACTGACAAATATCAT (shown in SEQ ID NO.1)

1. According to the above sequences, design the required five primers and complete them through the primer synthesis company. The primer sequences are as follows:

Outer primer F3: CGGCAAAGCTGTTACTA (as shown in SEQ ID NO.2)

Outer primer B3: GTCAGTTTCATCATCACC (as shown in SEQ ID NO.3)

Internal primer FIP: TGAATCCGTTAGTTTTTTATATGCAGGAGGGCAGTTGCAAGCGCTTGG (as shown in SEQ ID NO.4)

Internal primer BIP: AATAAGGAGGCGGCTGCTGG GACAGATTTCCCACTTACG (as shown in SEQ ID NO.5)

Bridge primer BP: CTAACGGATTCAAATAAGGAGG (as shown in SEQ ID NO.6)

2. Sample processing:

A commercial bacterial nucleic acid extraction kit was used for DNA extraction to obtain a DNA template of Listeria monocytogenes at a concentration of 320 ng/μL.

3. Isothermal amplification reaction and detection:

The system configuration is as follows:

10×BST Buffer (NEB Company) 1 μL

10×Taqe ligase Buffer (Thermo Company) 1 μL

dNTP (25mM, Takara company) 1 μL

Outer primer F3 (100μM) 0.1μL

Outer primer B3 (100μM) 0.1μL

Internal primer FIP (100μM) 0.2μL

Internal primer BIP (100μM) 0.2μL

Bridge primer BP (100μM) 0.2μL

DNA template 1 μL

Bst enzyme (NEB company, diluted to 8U/μl) 1 μL

Taqe ligase (Thermo, 40U/μL) 0.5μL

ddH ₂ O 13.7 μL

After the above reaction system is prepared, mix well, centrifuge at 3000rpm for 30 seconds, and amplify at a constant temperature of 64°C for 1 hour. The amplified product was subjected to 2% (2g/100mL) agarose gel electrophoresis, showing a bright Marker-like ladder-shaped band. The results show that the target template can be well detected after 1 hour constant temperature amplification reaction by using the method of the present invention.

In addition, according to the components of the above constant temperature amplification reaction system, a corresponding detection kit can also be prepared for wide use, that is, the detection kit (without DNA template), its components include: outer primer F3, outer Primer B3, inner primer FIP, inner primer BIP, bridge primer BP; in addition, the components of the detection kit may also contain 10×BST Buffer, 10×Taqe ligase Buffer, dNTP, Bst enzyme, Taqeligase and ddH ₂ O.

4. The effect of amplification reaction time on the result:

In the reaction system described in step 3, under the condition that other conditions remain unchanged, only the constant temperature amplification reaction time is changed, and the amplification reaction at 64°C is carried out at 20min, 30min, and 50min respectively. The test results show that with the method of the present invention, After 30 minutes of constant temperature amplification reaction, the target template can be well detected.

5. Effect of amplification reaction temperature on the result:

In the reaction system described in step 3, when other conditions remain unchanged, only the reaction temperature is changed, at 45°C, 48°C, 50°C, 52°C, 55°C, 58°C, 60°C, 62°C, 65°C, Under the temperature condition of 70°C, constant temperature amplification was carried out for 1 hour, and the test results showed that the optimum reaction temperature of the present invention was: 62-64°C.

Example 2: Bridge hairpin primer BHP-RCA detects single-stranded DNA

This implementation case uses porcine circovirus (Porcine Circovirus, PCV) inactivated vaccine as a sample. The vaccine was purchased from Harbin Veken Biotechnology Development Company, and the virus content of the vaccine was not less than 105.5 TCID50 before inactivation. PCV is a single-stranded closed circular DNA virus with a full-length genome of about 1.76kb. PCV2 has high pathogenicity and is the main pathogen of post-weaning multisystemic wasting syndrome in piglets. According to the sequence information published by NCBI, the relatively conservative replication-related gene Rep of PCV2 is used as the target sequence, and the partial sequence is as follows (GenBank No. AF207700):

CTAGATCTCAAGGACAACGGAGTGACCTTGTCTACTGCTGTGAGTACCTTGTTGGAGAGCGGGAGTCTGGTGGCCGTTGCAGAGCAGCACCCTGTAACGTTTGTCAGAAATTTCCGCGGGCTGGCTGAACTTTTGAAAGTGAGCGGGAAAATGCAGAAGCGTGATTGGAAGACGAATGTACACGTCATTGTGGGGCCACNOGGGTGTG (as shown in SEQ ID 7)

1. According to the above sequences, design the required five primers and complete them through the primer synthesis company. The primer sequences are as follows:

Outer primer F3: AGATCTCAAGGACAACG (as shown in SEQ ID NO.8)

Outer primer B3: GTCATTGTGGGGCCACCT (as shown in SEQ ID NO.9)

Internal primer FIP: TGAATCCGTTAGTTTTTCTCCCGCTCTCCGACCTGTCTACTGCTGTGAG (as shown in SEQ ID NO.10)

Internal primer BIP: AATAAGGAGGCGGCTGCTGG- CATTCGTCTTCCAATCACG (as shown in SEQ ID NO.11)

Bridge primer BP: CTAACGGATTCAAATAAGGAGG (as shown in SEQ ID NO.12)

2. Sample processing:

A commercial viral nucleic acid extraction kit was used for nucleic acid extraction to obtain a PCV2 DNA template with a concentration of 130 ng/μL.

3. Isothermal amplification reaction and detection:

The system configuration is as follows:

10×BST Buffer (NEB Company) 1 μL

10×Taqe ligase Buffer (Thermo Company) 1 μL

dNTP (25mM, Takara company) 1 μL

Outer primer F3 (100μM) 0.1μL

Outer primer B3 (100μM) 0.1μL

Internal primer FIP (100μM) 0.2μL

Internal primer BIP (100μM) 0.2μL

Bridge primer BP (100μM) 0.2μL

DNA template 1 μL

Bst enzyme (NEB company, diluted to 8U/μl) 1 μL

Taq ligase (Thermo, 40U/μL) 0.5μL

ddH ₂ O 13.7 μL

The above reaction system was prepared and mixed evenly, centrifuged at 3000rpm for 30 seconds, and amplified at a constant temperature of 64°C for 1 hour. The amplified product was subjected to 2% (2g/100ml) agarose gel electrophoresis, showing a bright Marker-like ladder-shaped band. The result shows that the porcine pseudorabies virus DNA can be well detected through the 1-hour constant temperature amplification reaction by using the method of the present invention.

Example 3: Bridge hairpin primer BHP-RCA detects RNA

In this embodiment, human immunodeficiency virus (Human Immunodeficiency Virus, HIV) is used as the detection object. Viral RNA samples were donated by Dr. Xu Feihai from Xiamen Wantai Canghai Biotechnology Co., Ltd. HIV is a single-stranded RNA retrovirus, and the vast majority of AIDS is caused by HIV-1. According to the sequence information published by NCBI, the gag gene, a relatively conserved structural protein of HIV-1, is used as the target sequence, and the partial sequence is as follows

(GenBank NO.: AF128998):

TCGACGGAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAATTTTTACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATAAATGGGAGAAAATTCGGTTAAGGCCAGGAGGAAAGAAAACATATCAGTNOAAACATATAGTAT as shown in GGGCGA1GC

1. According to the above sequence, design the required five primers, the primer sequence is as follows:

Outer primer F3: CGACGGAGGACTCGGCTTG (as shown in SEQ ID NO.14)

Outer primer B3: GCTTGCCCATACTATATG (as shown in SEQ ID NO.15)

Internal primer FIP: TGAATCCGTTAGTTTTTCGTACTCACCAGAAGCGCGCACGGCAAG (as shown in SEQ ID NO.16)

Internal primer BIP: AATAAGGAGGCGGCTGCTGGCTGATATGTTTTTCTTTCCTCC (as shown in SEQ ID NO.17)

Bridge primer BP: CTAACGGATTCAAATAAGGAGG (as shown in SEQ ID NO.18)

2. Sample processing:

A commercial viral nucleic acid extraction kit was used for nucleic acid extraction to obtain an HIV RNA template at a concentration of 210 ng/μL.

3. Isothermal amplification reaction and detection:

The system configuration is as follows:

10×BST Buffer (NEB Company) 1 μL

10×Taqe ligase Buffer (Thermo Company) 1 μL

dNTP (25mM, Takara company) 1 μL

Outer primer F3 (100μM) 0.1μL

Outer primer B3 (100μM) 0.1μL

Internal primer FIP (100μM) 0.2μL

Internal primer BIP (100μM) 0.2μL

Bridge primer BP (100μM) 0.2μL

RNA template 1 μL

Bst enzyme (NEB, diluted to 8U/μl) 1 μL

AMV enzyme (30U/μL, Takara) 1 μL

Taq ligase (40U/μL, Thermo) 0.5μL

ddH ₂ O 12.7 μL

The above reaction system was prepared and mixed evenly, centrifuged at 3000rpm for 30 seconds, and amplified at a constant temperature of 64°C for 1 hour. The amplified product was subjected to 2% (2g/100ml) agarose gel electrophoresis, showing a bright Marker-like ladder-shaped band. The results show that HIV-1 can be well detected after 1 hour constant temperature amplification reaction by using the method of the present invention.

Example 4: Bridge hairpin primer BHP-RCA combined with UNG enzyme anti-pollution system to detect Ehrlich canis

The method of the invention has high sensitivity and is very easy to cause aerosol pollution and cause false positive results. The method of the present invention can be combined with the UNG enzyme (uracil-N-glycosylase) anti-pollution system to avoid the occurrence of false positive results. Ehrlichi is an obligate intracellular parasite, causing low immunity and extreme emaciation in dogs. Canine Ehrlichi disease is also known as canine AIDS. The genome size of Ehrlich canis is about 1000kbp. According to the sequence information released by NCBI, the relatively conserved 16S rDNA gene of Ehrlich canis was used as the target sequence for detection. The partial sequence is as follows (GenBank NO.: AF162860)

GAGGGGGAAAGATTTATCGCTATTAGATGAGCCTACGTTAGATTAGCTAGTTGGTGAGGTAATGGCTTACCAAGGCTATGATCTATAGCTGGTCTGAGAGGACGATCAGCCACACTGGAACTGAGATACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCTATGTCGT.GTGAGTGAAGAAGGTCTAG

1. According to the above sequence, design the required five primers, the primer sequence is as follows:

Outer primer F3: GAAAGATTTATCGCTAT (as shown in SEQ ID NO.20)

Outer primer B3: CGAAGGCCTTCTTCACT (as shown in SEQ ID NO.21)

Internal primer FIP: TGAATCCGTTAGTTTTTTGCCTTGGTAAGCATGAGCCTACGTTAGAT (as shown in SEQ ID NO.22)

Internal primer BIP: AATAAGGAGGGCATAGCTGGATCAGGCT (as shown in SEQ ID NO.23)

Bridge primer BP: CTAACGGATTCAAATAAGGAGG (as shown in SEQ ID NO.24)

2. Sample processing:

Whole blood samples were taken from dogs clinically diagnosed with Ehrlich's disease, and nucleic acid was extracted using a commercial whole blood genome extraction kit to obtain DNA templates at a concentration of 600 ng/μL.

3. UNG enzyme treatment, constant temperature amplification reaction and detection:

The system configuration is as follows:

10×BST Buffer (NEB Company) 1 μL

10×Taqe ligase Buffer (NEB Company) 1 μL

dUNTP (25mM, Takara company) 1μL

Outer primer F3 (100μM) 0.1μL

Outer primer B3 (100μM) 0.1μL

Internal primer FIP (100μM) 0.2μL

Internal primer BIP (100μM) 0.2μL

Bridge primer BP (100μM) 0.2μL

DNA template 1 μL

Bst enzyme (NEB, diluted to 8U/μl) 1 μL

Taq ligase (40U/μL, Thermo) 0.5μL

ddH ₂ O 12.7 μL

The above reaction system was prepared and mixed evenly, centrifuged at 3000rpm for 30 seconds, and amplified at a constant temperature of 64°C for 1 hour. The amplified product was subjected to 2% (2g/100ml) agarose gel electrophoresis, showing a bright Marker-like ladder-shaped band.

Take 0.1 μL of the above-mentioned amplification reaction solution as a template and combine it with the UNG enzyme system to verify its decontamination effect. Reaction system and method are as follows:

reaction system:

10×BST Buffer (NEB Company) 1 μL

10×Taqe ligase Buffer (Thermo Company) 1 μL

dUNTP (25mM, Takara company) 1 μL

Outer primer F3 (100μM) 0.1μL

Outer primer B3 (100μM) 0.1μL

Internal primer FIP (100μM) 0.2μL

Internal primer BIP (100μM) 0.2μL

Bridge primer BP (100μM) 0.2μL

UNG enzyme (2U/μL) 0.5 μL

The above amplification reaction solution 0.1μL

ddH ₂ O 14.1 μL

The above reaction system was incubated at 25°C for 10 minutes, then acted at 95°C for 2 minutes to inactivate UNG enzyme. Add 1 μL Bst enzyme (NEB, diluted to 8 U/μl) and 0.5 μL Taq ligase (Thermo, 40 U/μL) into the reaction system, mix well, centrifuge at 3000 rpm for 30 seconds, and amplify at 64°C for 1 hour. At the same time, make a control tube without UNG enzyme treatment. The reaction product was subjected to 2% (2g/100ml) agarose gel electrophoresis, and the results showed that: the reaction system without UNG enzyme treatment, the final amplified product presented a bright Marker-like trapezoidal band, and the reaction system treated with UNG enzyme , the amplified product does not produce any bands, which effectively avoids the generation of false positive results. Using the method of the invention in combination with the UNG enzyme pollution prevention system can effectively avoid the generation of false positive results.

Embodiment 5: Self-ligating primer SP-RCA detects double-stranded DNA

The method of the present invention can directly form a circle of the first-round amplification product under the action of the single-stranded DNA polymerase without the bridge primer, so as to obtain the template sequence amplified by RCA. Take the detection of Listeria monocytogenes as an example to illustrate as follows:

A bacterial culture of Listeria monocytogenes was used as the sample. Bacteria were purchased from ATCC (ATCC19116). Take 1 μL of the original seed solution into 3 ml of TSBYE medium, shake and culture at 35°C for 24 hours, take 200 μL of bacterial suspension, centrifuge at 5000 rpm for 2 minutes, and collect the bacteria for subsequent DNA extraction. According to the sequence information published by NCBI, the relatively conserved hemolysin coding gene hlyA of Listeria monocytogenes was used as the target sequence, and the partial sequence is as follows (GenBank No. AB566375):

CAGATTTTTCGGCAAAGCTGTTACTAAAGAGCAGTTGCAAGCGCTTGGAGTGAATGCAGAAAATCCTCCTGCATATCTCCAAGTGTGGCATATGGCCGTCCAAGTTTATTTGAAATTATCAACTAATTCCCATAGTACTAAAGTAAAAGCTGCTTTTGACGCTGCCGTAAGTGGGAAATCTGTCTCAGGTGATGTAGAACTGACAAATATCAT (shown in SEQ ID NO.1)

1. According to the above sequences, design the four required primers and complete them through the primer synthesis company. The primer sequences are as follows:

Outer primer F3: CGGCAAAGCTGTTACTA (as shown in SEQ ID NO.2)

Outer primer B3: GTCAGTTTCATCATCACC (as shown in SEQ ID NO.3)

Internal primer FIP: GCAGTTGCAAGCGCTTGG (as shown in SEQ ID NO.25)

Internal primer BIP: GACAGATTTCCCACTTACG (as shown in SEQ ID NO.26)

2. Sample processing:

A commercial bacterial nucleic acid extraction kit was used for DNA extraction to obtain a DNA template of Listeria monocytogenes at a concentration of 320 ng/μL.

3. Isothermal amplification reaction and detection:

The 20μL system was prepared as follows:

10×BST Buffer (NEB Company) 1 μL

10×ssDNA Ligase Buffer (Epicentre) 1 μL

dNTP (25mM, Takara company) 1 μL

ATP (1mM, Epicentre Company) 1 μL

_MnCl2 (50mM) 1μL

Outer primer F3 (100μM) 0.1μL

Outer primer B3 (100μM) 0.1μL

Internal primer FIP (100μM) 0.2μL

Internal primer BIP (100μM) 0.2μL

DNA template 1 μL

Bst enzyme (NEB company, diluted to 8U/μl) 1 μL

ssDNA Ligase (100U/μL, Epicentre Company) 1 μL

ddH ₂ O 11.4 μL

The above reaction system was prepared and mixed evenly, centrifuged at 3000rpm for 30 seconds, and amplified at a constant temperature of 64°C for 1 hour. The amplified product was subjected to 2% (2g/100ml) agarose gel electrophoresis, showing a bright Marker-like ladder-shaped band. The results showed that the self-ligating primer HP-RCA amplification method combined with single-strand DNA ligase can detect the target template well after 1 hour constant temperature amplification reaction without bridge primer.

Embodiment 6: Hairpin primer HP-RCA detects double-stranded DNA

The method of the present invention can use specially designed FIP and BIP without bridge primers to form a hairpin structure after amplification, the two ends of the amplified product are directly connected closely, and a closed circular structure is formed under the action of ligase, This was used as a template for subsequent RCA amplification. According to this method, take the detection of Listeria monocytogenes as an example to illustrate as follows:

A bacterial culture of Listeria monocytogenes was used as the sample. Bacteria were purchased from ATCC (ATCC 19116). Take 1 μL of the original seed liquid into 3ml TSBYE medium, shake and culture at 35°C for 24 hours, take 200 μL of bacterial suspension, centrifuge at 5000rpm for 2 minutes, and collect the bacteria for subsequent DNA extraction . According to the sequence information published by NCBI, the relatively conserved hemolysin coding gene hlyA of Listeria monocytogenes was used as the target sequence, and the partial sequence is as follows (GenBank No. AB566375):

CAGATTTTTCGGCAAAGCTGTTACTAAAGAGCAGTTGCAAGCGCTTGGAGTGAATGCAGAAAATCCTCCTGCATATCTCCAAGTGTGGCATATGGCCGTCCAAGTTTATTTGAAATTATCAACTAATTCCCATAGTACTAAAGTAAAAGCTGCTTTTGACGCTGCCGTAAGTGGGAAATCTGTCTCAGGTGATGTAG (shown in SEQ ID NO. 27)

1. According to the above sequences, design the four required primers and complete them through the primer synthesis company. The primer sequences are as follows:

Outer primer F3: CGGCAAAGCTGTTACTA (as shown in SEQ ID NO.2)

Outer primer B3: CTTTTACTTTAGTACTATGG (as shown in SEQ ID NO.28)

Internal primer FIP: ATATGCAGGAGG GCAGTTGCAAGCGCTTGG (as shown in SEQ ID NO.29)

Internal primer BIP: ATCTCAAGTGTGGTTGATAATTTCAAATAAACTTG (as shown in SEQ ID NO.30)

2. Sample processing:

A commercial bacterial nucleic acid extraction kit was used for DNA extraction to obtain a DNA template of Listeria monocytogenes at a concentration of 320 ng/μL.

3. Isothermal amplification reaction and detection:

The 20μL system was prepared as follows:

10×BST Buffer (NEB Company) 1 μL

10×Taq DNA Ligase Buffer (Thermo Company) 1 μL

dNTP (25mM, Takara company) 1 μL

Outer primer F3 (100μM) 0.1μL

Outer primer B3 (100μM) 0.1μL

Internal primer FIP (100μM) 0.2μL

Internal primer BIP (100μM) 0.2μL

DNA template 1 μL

Bst enzyme (NEB company, diluted to 8U/μl) 1 μL

Taq DNA ligase (Thermo, 40U/μL) 0.5μL

ddH ₂ O 13.9 μL

The above reaction system was prepared and mixed evenly, centrifuged at 3000rpm for 30 seconds, and amplified at a constant temperature of 64°C for 1 hour. The amplified product was subjected to 2% (2g/100ml) agarose gel electrophoresis, showing a bright Marker-like ladder-shaped band. The results show that the target nucleic acid template can be well detected by using the HP-RCA amplification method after a 1-hour constant temperature amplification reaction.

Example 7: Bridge hairpin primer BHP-RCA combined with molecular beacons for real-time detection of target templates

The method of the present invention can realize the real-time monitoring of the amplification product through the molecular beacon. This embodiment is illustrated by taking human immunodeficiency virus (Human Immunodeficiency Virus, HIV) as an example. HIV is a single-stranded RNA retrovirus, and the vast majority of AIDS is caused by HIV-1. According to the sequence information released by NCBI, the HIV-1 conservative structural protein gag gene is used as the target sequence, and the partial sequence is as follows (GenBank NO.: AF128998):

TCGACGGAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAATTTTTACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATAAATGGGAGAAAATTCGGTTAAGGCCAGGAGGAAAGAAAACATATCAGTNOAAACATATAGTAT as shown in GGGCGA1GC

1. According to the above sequence, four required primers and a detection probe were designed. The primer sequence is as follows:

Outer primer F3: CGACGGAGGACTCGGCTTG (as shown in SEQ ID NO.14)

Outer primer B3: GCTTGCCCATACTATATG (as shown in SEQ ID NO.15)

Internal primer FIP: TGAATCCGTTAGTTTTTCGTACTCACCAGAAGCGCGCACGGCAAG (as shown in SEQ ID NO.16)

Internal primer BIP: AATAAGGAGGCGGCTGCTGGCTGATATGTTTTTCTTTCCTCC (as shown in SEQ ID NO.17)

Bridge primer BP: CTAACGGATTCAAATAAGGAGG (as shown in SEQ ID NO.18)

Molecular beacon (probe for detection): FAM-cacctcGATGGGTGCGAGAGCGTCAGgaggtg-DABCYL (as shown in SEQ ID NO.31); wherein, the Chinese names of FAM and DABCYL are carboxyfluorescein and 4-(4-oxanaminophenylazo ) Benzoic acid, which are fluorescent groups and fluorescent quenching groups, respectively, is the most commonly used pair combination of molecular beacons.

2. Sample processing:

The HIV virus RNA sample was donated by Dr. Xu Feihai from Xiamen Wantai Canghai Biotechnology Co., Ltd. A commercial viral nucleic acid extraction kit was used for nucleic acid extraction to obtain an HIV RNA template at a concentration of 210 ng/μL.

3. Isothermal amplification reaction and detection:

The 20μL system was prepared as follows:

10×BST Buffer (NEB Company) 1 μL

10×Taqe ligase Buffer (NEB Company) 1 μL

dNTP (25mM, Takara company) 1 μL

Outer primer F3 (100μM) 0.1μL

Outer primer B3 (100μM) 0.1μL

Internal primer FIP (100μM) 0.2μL

Internal primer BIP (100μM) 0.2μL

Bridge primer BP (100μM) 0.2μL

The above molecular beacon (10 μM) 0.2 μL

ROX Dye (150μM) 0.2μL

DNA template 1 μL

Bst enzyme (NEB, diluted to 8U/μl) 1 μL

AMV enzyme (30U/μL, Takara company) 1 μL

Taq ligase (40U/μL, Thermo Company) 0.5μL

ddH ₂ O 12.3 μL

After preparing the above reaction system, mix well, centrifuge at 3000rpm for 30 seconds, amplify at a constant temperature of 64°C for 1 hour, use ABI7500 fluorescent quantitative PCR to collect fluorescence, and collect fluorescence signals every 30 seconds. The fluorescence curve shows that it enters the exponential amplification phase at about 25 minutes. The result shows that the real-time monitoring of the amplified product can be realized through the molecular beacon by using the method of the present invention.

In addition, according to the components of the constant temperature amplification reaction system of Example 2-7, according to the method for preparing the detection kit in Example 1, the components of the constant temperature amplification reaction system of Example 2-7 (removing DNA Components outside the template) to prepare a corresponding detection kit for the method of connecting the two primer-related sequence ends of a single-stranded DNA strand to form a circle and at least using the two primers to initiate constant temperature rolling circle amplification, and according to The reaction conditions and detection methods in each embodiment are tested.

Claims (18)

1. two primer correlated series ends that prepare the single stranded DNA chain connect into the method for encircling and starting the constant temperature rolling circle amplifications at least with these two primers, it is characterized in that, comprise step:

1) oligonucleotide sequence design

Oligonucleotide sequence has four sections primers that design by target nucleic acid 3 ' → 5 ' direction at least: F3, FIP, BIP, B3;

Wherein, FIP is the front end inner primer;

BIP is the rear end inner primer;

F3, B3 are a pair of outer primers, lay respectively at the upstream of FIP and the downstream of BIP;

2) from target nucleic acid, amplify the single stranded DNA To Template

Target nucleic acid is DNA chain or when in the reaction soln that contains reversed transcriptive enzyme at least RNA chain target nucleic acid reverse transcription being the DNA chain, in containing the nucleic acid amplification reaction solution of the archaeal dna polymerase that has the strand displacement function at least, utilize primers F 3, FIP, BIP, B3, amplification synthesizes the single stranded DNA To Template according to target nucleic acid sequence;

3) dna ligase cyclized DNA To Template

In the reaction soln that contains dna ligase at least, the head and the tail two ends of DNA To Template are connected to form closed cyclized DNA chain;

4) cyclized DNA To Template rolling circle amplification

In the reaction soln that contains dna ligase and the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chains at least with two inner primers in the step 1), the nucleic acid product that obtains increasing.

2. the method for claim 1, it is characterized in that: the oligonucleotide sequence of described step 1) also comprises: bridge-type primer BP, hybridization probe, auxiliary primer;

Described bridge-type primer BP, its all or part of sequence and the complementation of an inner primer afterbody sequence, and its all or part of and afterbody sequence complementation another inner primer complementary sequence makes it as bridge the adjacent no base breach of the two terminal sequences ground of these two inner primers to be hybridized together;

Described hybridization probe, itself and the sequence hybridization of target nucleic acid among two inner primer correlated series positions;

Described auxiliary primer derives from the partial sequence that does not influence itself and target nucleic acid or bridge-type primer stable bond in BIP or the FIP primer, maybe should auxiliary primer also derives from sequence between BIP primer and the B3 primer or the sequence between this FIP primer and the F3 primer.

3. the method for claim 1, it is characterized in that: the oligonucleotide sequence of described step 1) can also carry out similar and different modification mark respectively, and this modification mark comprises: digoxin, fluorescence dye FAM, fluorescein isothiocyanate, vitamin H, fluorescent quenching group or nano particle.

4. the method for claim 1, it is characterized in that: in the described step 1), FIP only comprises the F2 sequence, F2 and target nucleic acid sequence F2c complementation; Described BIP only comprises the B2 sequence, and B2 is identical with the target nucleic acid partial sequence;

Step 2) in, utilize primers F 3, FIP, BIP, B3 to amplify the single stranded DNA To Template from target nucleic acid after, its two ends are respectively correlated series F2c, the B2 of two inner primers, its complementary strand two ends are respectively F2, B2c; Wherein, B2c is the complementary sequence of B2;

In the step 3), DNA To Template and complementary strand thereof can be connected to form the cyclized DNA chain of a closure by dna ligase;

In the step 4), in the reaction soln that contains the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chain at least with FIP and these two primers of BIP.

5. method as claimed in claim 4, it is characterized in that: in the described step 1), oligonucleotide sequence has also designed auxiliary primer;

Described auxiliary primer is several: this auxiliary primer derives from the 5 ' terminal sequence that do not influence B2 and target nucleic acid sequence stable bond in the BIP primer or the sequence between BIP primer and the B3 primer, maybe should auxiliary primer also derives from the 3 ' terminal sequence that do not influence F2 and target nucleic acid sequence stable bond in the FIP primer or the sequence between FIP primer and the F3 primer simultaneously.

6. the method for claim 1, it is characterized in that: in the described step 1), front end inner primer FIP comprises 2 sections sequence F1c, F2 at least by 5 ' → 3 ' sequence direction, wherein, F2 and F2c complementation, F2c is that target nucleic acid sequence F3c is in the partial sequence of target nucleic acid 5 ' direction; F1c in the FIP primer is the complementary sequence of F1, and F1c is identical with the partial sequence of the 5 ' direction that is in target nucleic acid sequence F2c, and F3c is the complementary sequence of F3;

Described rear end inner primer BIP comprises 2 sections sequence B 2, B1c at least by 3 ' → 5 ' sequence direction, and wherein, the B2 in the BIP primer is identical with the target nucleic acid partial sequence, and B1c is the partial sequence B1 complementation with the 3 ' direction that is in target nucleic acid B2 sequence;

Described F1c and B1 are adjacent no base two sections sequences in front and back at interval at target nucleic acid sequence;

Step 2) in, utilize primers F 3, FIP, BIP, B3 to amplify the single stranded DNA To Template from target nucleic acid after, DNA To Template and complementary strand two ends thereof form hairpin structure respectively; Wherein, formed between F1, the B1c or between F1c, the B1 and do not had the hybridization of base breach slit;

In the step 3), the gap between DNA To Template and the complementary strand two ends thereof can be connected closed by dna ligase, forms the cyclized DNA chain;

In the step 4), in the reaction soln that contains the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chain at least with FIP and two inner primers of BIP.

7. method as claimed in claim 6, it is characterized in that: in the described step 1), oligonucleotide sequence has also designed auxiliary primer;

Described auxiliary primer is several; Should auxiliary primer derive from the intermediate sequence that do not influence B2 and B1c and target nucleic acid sequence stable bond in the BIP primer or the sequence between BIP primer and the B3 primer, maybe this auxiliary primer also derives from the intermediate sequence that do not influence F2 and F1c and target nucleic acid sequence stable bond in the FIP primer or the sequence between FIP primer and the F3 primer simultaneously.

8. the method for claim 1, it is characterized in that: in the described step 1), front end inner primer FIP comprises 2 sections sequence F4, F2 at least by 5 ' → 3 ' sequence direction, wherein, the complementary hybridization of F2 and target nucleic acid sequence F2c; The F4 sequence is the dna sequence dna inequality and not complementary with the single stranded DNA To Template;

Described rear end inner primer BIP comprises 2 sections sequence B 2, B4 at least by 3 ' → 5 ' sequence direction, and wherein, B2 is identical with the target nucleic acid partial sequence; The B4 sequence is the dna sequence dna inequality and not complementary with the single stranded DNA To Template;

In the step 1), also be provided with bridge-type primer BP, it by 5 ' → 3 ' sequence direction respectively with FIP among the complementary sequence F4c of F4 and the BIP all or part of base hybridization of two sequences of B4 complementary, perhaps by 5 ' → 3 ' sequence direction respectively with BIP among the complementary sequence B4c of B4 and the FIP all or part of base hybridization of two sequences of F4 complementary;

Have at most among FIP and the BIP have in the inner primer partial sequence not with the complementation of bridge-type primer, and identical with the target nucleic acid partial sequence or complementary, its position is at inner primer F2 or B2 is identical with target nucleic acid or 3 ' extreme direction of complimentary positions;

Step 2) in, utilize primers F 3, FIP, BIP, B3 to amplify the single stranded DNA To Template from target nucleic acid after, the two ends of DNA To Template or its complementary strand are that complementary strand has formed and do not have the hybridization of base breach slit with the bridge-type primer;

In the step 3), the two ends of DNA To Template or its complementary strand can be connected to the cyclized DNA chain by dna ligase;

In the step 4), in the reaction soln that contains the archaeal dna polymerase that has the strand displacement function at least, start the rolling circle amplification of cyclized DNA chain at least with FIP and two inner primers of BIP.

9. method as claimed in claim 8 is characterized in that: described bridge-type primer BP, four primer sequences that can be by other design from target nucleic acid sequence with the irrelevant fully sequence of single stranded DNA To Template sequence in amplification peel off out; Wherein, described four primer sequences, for: each 2 sequence of the inner primer that is different from F3, FIP, BIP, B3 of redesign and outer primer.

10. method as claimed in claim 8, it is characterized in that: oligonucleotide sequence has also designed auxiliary primer in the described step 1);

Described auxiliary primer derives from the intermediate sequence that do not influence B2 and target nucleic acid sequence stable bond, B4 and bridge-type primer stable bond in the BIP primer or the sequence between BIP primer and the B3 primer, maybe should auxiliary primer also derives from the intermediate sequence that do not influence F2 and target nucleic acid sequence stable bond, F4c and bridge-type primer stable bond in the FIP primer or the sequence between FIP primer and the F3 primer simultaneously.

11. the method for claim 1 is characterized in that: described step 2), reversed transcriptive enzyme comprises: AMV or M-MLV; The archaeal dna polymerase that has the strand displacement function comprises: Bst archaeal dna polymerase or Phi29DNA polysaccharase;

Step 2) in, contain the nucleic acid amplification reaction solution of the archaeal dna polymerase that has the strand displacement function at least, its component also comprises at least: amplification promotor and nucleic acid dye;

Wherein, amplification promotor comprises the combination of following one or more compositions: trimethyl-glycine, trehalose, proline(Pro), dimethyl sulfoxide (DMSO), Trimethylamine 99-N-oxide compound, Tetramethylammonium chloride, methane amide, BSA, single strand binding protein, T4Gene32Protein, homoectoine, Zn ²⁺-cyclen;

Described nucleic acid dye comprises: SYBR Green I, fluorexon, GELGREEN and GELRED.

12. the method for claim 1 is characterized in that: described step 2), before amplifying the single stranded DNA To Template according to target nucleic acid, can also carry out the target nucleic acid amplified production abatement of pollution of sample and handle:

After sample is finished nucleic acid extraction, add uridylic-N-glycosylase, may cause the uridylic in the target nucleic acid amplified production that pollutes to carry out the glycosidic link hydrolysis to sample, after this, solution temperature is elevated to 55-98 ℃ and kept maximum 10 minutes, and the uridylic in the solution-N-glycosylase will be inactivated.

13. method as claimed in claim 12, it is characterized in that: described abatement of pollution is handled, is increased in strand To Template, dna ligase cyclisation To Template, four steps of cyclisation To Template rolling circle amplification, each step can arrange different temperature condition, or some steps are wherein arranged same temperature; Related reagent composition in these four steps can repeatedly add respectively or once add and finish.

14. the method for claim 1 is characterized in that: described step 3), 4), described dna ligase comprises: T4DNA ligase, Taq DNA Ligase, Ampligase and ssDNA ligase.

15. method as claimed in claim 2 is characterized in that: in the described step 4), the archaeal dna polymerase that has the strand displacement function comprises: Bst archaeal dna polymerase or Phi29DNA polysaccharase;

The described reaction soln that contains dna ligase and have the archaeal dna polymerase of strand displacement function, its component also comprises at least: amplification promotor or nucleic acid dye;

Wherein, amplification promotor comprises the combination of following one or more compositions: trimethyl-glycine, trehalose, proline(Pro), dimethyl sulfoxide (DMSO), Trimethylamine 99-N-oxide compound, Tetramethylammonium chloride, methane amide, BSA, single strand binding protein, T4Gene32Protein, homoectoine, Zn ²⁺-cyclen;

Described nucleic acid dye comprises: SYBR Green I, fluorexon, GELGREEN and GELRED.

16. the method for claim 1 is characterized in that: the nucleic acid product in the single stranded DNA To Template of amplification described step 2), the cyclized DNA chain of step 3) and the step 4), can detect by immune chromatography test paper or fluorescent signal.

17. one kind is applied to the test kit of method according to claim 1, it is characterized in that: comprise oligonucleotide sequence as claimed in claim 1 at least.

18. test kit as claimed in claim 17 is characterized in that: described test kit also comprises at least a in the following component:

(1) the strand displacement function DNA polysaccharase that has as claimed in claim 11;

(2) dna ligase as claimed in claim 14;

(3) amplification promotor as claimed in claim 11;

(4) nucleic acid dye as claimed in claim 11;

(5) uridylic-N-glycosylase;

(6) reversed transcriptive enzyme as claimed in claim 11.

Images