CN109750121A - Primer combination and its application in the testing product for preparing the high pathogenic strain of pig blue-ear disease poison american type - Google Patents

Abstract

The present invention provides a kind of real-time fluorescence RT-LAMP primer sets of the high pathogenic strain of specific detection pig blue-ear disease poison american type (HP-PRRSV) and detection methods.Use HP-PRRSV of the RT-LAMP technology in real-time fluorescence PCR instrument in real-time detection sample.Primer high sensitivity that the present invention screens, high specificity, the detection method of foundation has the advantages that accuracy rate is high, detection time is short, result can be observed in real time, 1h is only needed from sample treatment to report result, it is easy to operate, there is higher specificity than other PCR methods.The set primer can precisely detect the high pathogenic strain of pig indigo plant ear american type, with the no cross reactions such as the strain of american type classics, vaccine strain (TJM-F92), pig parvoviral (PPV), porcine circovirus 2 type (PCV2), swine influenza virus (SIV), swine fever virus (CSFV), porcine pseudorabies virus (PRV).

Description

Primer combines and its in the testing product for preparing the high pathogenic strain of pig blue-ear disease poison american type In application

Technical field

The present invention relates to field of biotechnology, in particular to primer is combined and its is caused preparing pig blue-ear disease poison american type height Application in the testing product of diseased plant.

Background technique

Porcine reproductive and respiratory syndrome (Porcine reproductive and respiratory syndrome) be by Porcine reproductive and respiratory syndrome virus (Porcine reproductive and respiratory syndrome virus, PRRSV pig Acute exposure sexually transmitted disease caused by), be mainly shown as fever, anorexia, miscarriage, the mummification of fetus, stillborn foetus, it is weak it is young with And the respiratory symptom of piglet.The back side of part affected pig, the have sharp ears of ears and edge are in reddish blue, so also referred to as pig indigo plant ear Disease.Analysis shows, PRRSV shares 2 kinds of genotype according to pathogenic characteristic or from the PRRSV strain sequence of different geographical separations, one It kind is using VR-2332 strain as the american type of representative, one is using Lelysta virus as the Europe class of representative, and different poison Antigenicity between strain and pathogenic there are significant differences.And the difference according to its pathogenicity, and can be blue by american type pig therein Otopathy poison is divided into two kinds of hypotypes of classical strain and highly pathogenic strain (HP-PRRSV).

PRRSV belongs to shell type virales, Arteriviridae, Arterivirus member, is single strand plus RNA virus, Its full-length genome about 15kb, including 10 open reading frame (ORF).Wherein, ORF1 encodes the rna replicon enzyme of virus, is Unique non-structural protein that PRRSV is generated, i.e. ORF1a, ORF1b and Nsp2-12.Wherein Nsp2 is the diversity gene of PRRSV, Variation plays an important role during PRRSV makes a variation derivation.And HP-PRRSV is exactly discontinuously to lack 30 by Nsp2 gene Caused by amino acid.

Since two thousand six, highly pathogenic PRRS (HP-PRRS) has been broken out in China, and the subsequent disease is each main in China rapidly The sprawling of pig raising province.According to the preliminary statistics, the disease incidence of HP-PRRS infection pig up to 50% or more, make up to 30% or more by case fatality rate At heavy huge economic loss.Compared with classical PRRSV, the pathogenic of pig is remarkably reinforced in HP-PRRSV.It is quick-fried with epidemic situation Hair, vaccine have started large-scale use.Domestic most commonly used vaccine is TJM-F92 at present.But vaccine can be grown in pig body Time survival brings many puzzlements to highly pathogenic PRRS diagnosis.

Traditional PRRSV diagnostic method will include separation identification, the enzyme-linked immunosorbent assay (ELISA), routine RT- of virus PCR etc..But all there are some problems in these methods in sensibility, specificity, timeliness.Such as Virus Isolation, operation Cumbersome, time-consuming and laborious, the Serum experiments such as ELISA, which exist, intersects reflection, and sensitivity is low.Conventional RT-PCR needs to carry out subsequent electricity Swimming identification, operation take a long time.

Ring mediated isothermal amplification method (loop-mediated isothermal amplification, LAMP) is to utilize one Kind has the Bst archaeal dna polymerase of strand-displacement activity and waterfall type nucleic acid amplification function, carries out the change of nucleic acid under isothermal conditions The strand displacement nucleic acid amplification reaction of property and automatic cycle.LAMP designs 4 special primers for 6 regions of target sequence, utilizes The archaeal dna polymerase for having strand displacement function constantly replicates DNA amplification at a constant temperature.It, can be anti-in order to improve reaction efficiency Two ring primers of addition in system are answered, are allowed to respectively in conjunction with loop-stem structure, starting strand displacement synthesis, recursive copying.Imai etc. People established the RT-LAMP detection architecture of quick diagnosis H5N1 avian influenza virus in 2007.Realize one-step method detection virus The method of RNA, is greatly saved detection time.Reaction result can observe by the naked eye, but visually observe there are human error, Can not accurately it determine when virus quantity is few.Also there is addition SYBR Green I dyestuff in the system of researcher after the completion of reaction Method detect amplified production, but this process must uncap and add dyestuff, extremely be easy pollution environment；Furthermore add before reflection Enter fluorescent dyeing reagent, observe in the UV lamp, but the method is not accurate enough to the judgement of weakly positive.

Summary of the invention

In view of this, the present invention provides, a kind of speed is fast, pig blue-ear disease poison american type height of high sensitivity, high specificity causes Diseased plant RT-LAMP detection primer and detection method.

In order to achieve the above-mentioned object of the invention, the present invention the following technical schemes are provided:

The present invention provides a kind of markers, have the nucleotide sequence as shown in SEQ ID NO:7.

In addition, the present invention also provides the nucleotide with the sequence as shown in SEQ ID NO:7 to prepare as marker Application in the testing product of the high pathogenic strain of pig blue-ear disease poison american type.

The present invention also provides the nucleotide with the sequence as shown in SEQ ID NO:7 as marker in preparation pig indigo plant ear Application in the testing product of the viral high pathogenic strain of american type.

On the basis of the studies above, the present invention also provides primer combinations, comprising: primer-F3, primer-B3, primer- FIP, primer-BIP, primer-LF and primer-LB；

Primer-the F3 has any one in nucleotide sequence as follows:

(I), there is nucleotide sequence shown in SEQ ID NO:1；

(II), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, deletion and/or addition one or more The nucleotide sequence that a base obtains；

(III), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；

(IV), the complementary series of the sequence as shown in (I), (II) or (III)；

Primer-the B3 has any one in nucleotide sequence as follows:

(V), there is nucleotide sequence shown in SEQ ID NO:2；

(VI), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, deletion and/or addition one or more The nucleotide sequence that a base obtains；

(VII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；

(VIII), the complementary series of the sequence as shown in (V), (VI) or (VII)；

Primer-the FIP has any one in nucleotide sequence as follows:

(IX), there is nucleotide sequence shown in SEQ ID NO:3；

(X), have nucleotide sequence shown in SEQ ID NO:3 through modification, substitution, deletion and/or addition one or more The nucleotide sequence that a base obtains；

(XI), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:3；

(XII), the complementary series of the sequence as shown in (IX), (X) or (XI)；

Primer-the BIP has any one in nucleotide sequence as follows:

(XIII), there is nucleotide sequence shown in SEQ ID NO:4；

(XIV), have SEQ ID NO:4 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(XV), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；

(XVI), the complementary series of the sequence as shown in (XIII), (XIV) or (XV)；

Primer-the LF has any one in nucleotide sequence as follows:

(XVII), there is nucleotide sequence shown in SEQ ID NO:5；

(XVIII), have nucleotide sequence shown in SEQ ID NO:5 through modification, substitution, deletion and/or addition one Or the nucleotide sequence that multiple bases obtain；

(XIX), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；

(XX), the complementary series of the sequence as shown in (XVII), (XVIII) or (XIX)；

Primer-the LB has any one in nucleotide sequence as follows:

(XXI), there is nucleotide sequence shown in SEQ ID NO:6；

(XXII), have SEQ ID NO:6 shown in nucleotide sequence through modification, substitution, deletion and/or addition one or The nucleotide sequence that multiple bases obtain；

(XXIII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:6；

(XXIV), the complementary series of the sequence as shown in (XXI), (XXII) or (XXIII).

In some specific embodiments of the invention, primer-F3, the primer-B3, institute described in the primer combination The molar ratio for stating primer-FIP, the primer-BIP, the primer-LF and the primer-LB is 0.3:0.3:2.4:2.4:1: 1。

In addition, being combined the present invention also provides kit including the primer.

On this basis, the present invention also provides primer combinations or the kit in pig blue-ear disease poison America Application in the high pathogenic strain identification of type.

In addition, the present invention also provides the detection method of the high pathogenic strain of pig blue-ear disease poison american type, including it is as follows

Step:

(1) nucleic acid of sample to be tested is obtained；

(2) nucleic acid extracted using step (1) is respectively adopted in primer combination as described in claim 4 or 5 as template Primer carries out reverse transcription-ring mediated isothermal amplification, obtains amplification；

(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is pig The blue high pathogenic strain of otopathy poison american type；If can not achieve specific amplification, sample to be tested is not pig blue-ear disease poison american type High pathogenic strain.

The present invention also provides the detection methods of the high pathogenic strain of pig blue-ear disease poison american type, include the following steps:

(1) nucleic acid of sample to be tested is obtained；

(2) nucleic acid extracted using step (1) is respectively adopted in primer combination as described in claim 4 or 5 as template Primer carries out reverse transcription-ring mediated isothermal amplification, obtains amplification；

(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is pig The blue high pathogenic strain of otopathy poison american type；If can not achieve specific amplification, sample to be tested is not pig blue-ear disease poison american type High pathogenic strain.

In some specific embodiments of the invention, the reaction system of the reverse transcription-ring mediated isothermal amplification are as follows: Each 0.12 μ L of outer primer F3 and B3 of 0.3mM；Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；Ring the primer LF and LB of 1mM is each 0.4μL；2 × amplification reaction solution, 10 μ L；The sample to be tested nucleic acid of 2 μ L, 0.5 μ L AMV reverse transcriptase, adds RNase-free Water is to 20 μ L systems.

In some specific embodiments of the invention, the reaction temperature of the reverse transcription-ring mediated isothermal amplification is 60 DEG C~65 DEG C, reaction time 50min.

Fluorescent dye and AMV reverse transcriptase is added in the present invention in RT-LAMP reaction system, realizes that one-step method detection pig is blue The high pathogenic strain of otopathy poison american type realizes whole real time monitoring in conjunction with fluorescent quantitation, can go out result within an hour.This method Both there is easy, quick, sensitive, special advantage, in turn avoid error and caused environment of uncapping caused by artificially determining Pollution.It is known that primer is the key factor for determining testing result sensitivity and specificity in LAMP technology.Sequence alignment hair The Nsp2 gene of existing TJM-F92 live vaccine has lacked 360bp compared with the high pathogenic strain of pig blue-ear disease poison american type, therefore can be Specific primer is designed at this deletion fragment and distinguishes high pathogenic strain and vaccine strain (TJM-F92), while comparing pig blue-ear disease poison beauty The high pathogenic strain of continent type and classical strain NSP2 gene discovery, in the 360bp sequence of vaccine strain missing, high pathogenic strain and classical strain sequence Column homology is very high, reaches 90% or more, only discontinuous 30 nucleotide differences, therefore using primer-design software at this Section region is difficult to find one group of primer that can distinguish high pathogenic strain and classical group, can only manually compare analysis at difference nucleotide Design specific primer reaches can distinguish the high pathogenic strain of pig blue-ear disease poison american type, classical strain and vaccine strain (TJM-F92) simultaneously Effect.

The present invention covers LAMP primers by the way that design, and it is good that finishing screen selects a set of specificity, the primer of high sensitivity.The set Primer can not only distinguish swine influenza virus (SIV), pig parvoviral (PPV), pig circular ring virus (PCV2), swine fever virus (CSFV) The virus that other belong to pseudorabies virus (PRV) etc., can more distinguish live vaccine TJM-F92 and pig blue-ear disease poison american type passes through Allusion quotation strain.Detection sensitivity also reaches 50 copies/μ L.

The invention discloses it is a kind of for detect pig indigo plant ear american type height cause a disease strain virus LAMP primer composition and its answer With.Primer combination provided by the invention, 6 kinds of DNA moleculars shown in sequence 1 to sequence 6 form.The primer combination can apply In detecting whether virus to be measured is the pathogenic strain virus of pig indigo plant ear american type height, can be applied in detection sample to be tested whether contain pig Blue ear american type height causes a disease strain virus.Primer sets provided by the invention are shared in the pathogenic strain virus of detection pig indigo plant ear american type height, With high specific and high sensitivity, easy, quick, accurate detection may be implemented.The present invention has great promotional value.

Detailed description of the invention

In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described.

Fig. 1 shows the testing result of primer sets 1 in embodiment 1；

Fig. 2 shows the testing result of primer sets 2 (PRRSV-HP) in embodiment 1；

Fig. 3 shows the testing result of primer sets 3 in embodiment 1；

Fig. 4 shows the testing result of primer sets 4 in embodiment 1；

Fig. 5 shows the testing result of primer sets 5 in embodiment 1；

Fig. 6 shows the testing result of primer sets 6 in embodiment 1；

Fig. 7 shows the testing result of primer sets 7 in embodiment 1；

Fig. 8 shows the testing result of primer sets 8 in embodiment 1；

Fig. 9 shows the testing result of primer sets 9 in embodiment 1；

Figure 10 shows the testing result of primer sets 10 in embodiment 1；

Figure 11 shows the specific detection result of primer sets PRRSV-HP in embodiment 2；

When Figure 12 shows that template concentrations are 100 copies/μ L in embodiment 3, the testing result of primer sets PRRSV-HP；

When Figure 13 shows that template concentrations are 50 copies/μ L in embodiment 3, the testing result of primer sets PRRSV-HP；

When Figure 14 shows that template concentrations are 10 copies/μ L in embodiment 3, the testing result of primer sets PRRSV-HP.

Specific embodiment

The invention discloses a kind of combination of primer and its in the testing product for preparing the high pathogenic strain of pig blue-ear disease poison american type In application, those skilled in the art can use for reference present disclosure, be suitably modified realization of process parameters.In particular It is that all similar substitutions and modifications are apparent to those skilled in the art, they are considered as being included in this Invention.Method and application of the invention is described by preferred embodiment, and related personnel can obviously not depart from this Method described herein and application are modified or appropriate changes and combinations in summary of the invention, spirit and scope, realizing and Using the technology of the present invention.

Highly pathogenic PRRS poison american type (HP-PRRSV) Nsp2 gene is more living than widely used weak poison domestic at present The more 360bp of vaccine TJM-F92, can distinguish vaccine strain and high pathogenic strain, while the gene and pig blue-ear disease poisons allusion quotation Strain more also has number of base difference (as shown in SEQ ID No.7), is to collect sequence (in biological data library with this section of sequence The middle sequence for collecting cls gene to be checked simultaneously carries out biological analysis, to guarantee that the primer of design can achieve the need of practical application It asks).

SEQ ID No.7:

ATCTCGGATATACTAAATGACACCAACCCTGCACCTGTGTCATCAAGCAGCTCCCTGTCAAGTGTTAAG ATCACACGCCCAAAATACTCAGCTCAAGCCATCATCGACTCTGGCGGGCCTTGCAGTGGGCATCTCCAAAAGGAAAA AGAAGCATGCCTCAGCATCATGCGTGAGGCTTGTGATGCGTCCAAGCTTGGTGATCCTGCTACGCAGGAGTGGCTCT CTCGCATGTGGGATAGGGTTGACATGCTGACTTGGCGCAACACGTCTGCTTACCAGGCGTTTCGCATCTTAAAYGGC AGGTTTGAGTTTCTCCCAAAGATGATTCTCGAGACACCGCCGCCCCACCCGTGCGGGTTTGTGATGTTACCTCGC

Wherein, Y is degeneracy base, Y=C/T.

The present invention provides a kind of RT-LAMP detection primer for detecting the high pathogenic strain of pig blue-ear disease poison american type, RT- LAMP detection primer are as follows:

Outer primer PRRSV-HP-F3:5 '-ACGCCCAAAATACTCAGC-3 ' (as shown in SEQ ID No.1)；

Outer primer PRRSV-HP-B3:5 '-GGTAAGCAGACGTGTTGC-3 ' (as shown in SEQ ID No.2)；

Inner primer PRRSV-HP-FIP:5 '-GGACGCATCACAAGCCTCACCAAGCCATCATCGACTCTG-3 (such as SEQ Shown in ID No.3)；

Inner primer PRRSV-HP-BIP:5 '-TCCAAGCTTGGTGATCCTGCTACCCAAGTCAGCATGTCAACC-3 ' (as shown in SEQ ID No.4)；

Ring primer PRRSV-HP-LF:5 '-CTGAGGCATGCTTCTTTTTCC-3 ' (as shown in SEQ ID No.5)；

Ring primer PRRSV-HP-LB:5 '-AGTGGCTCTCTCGCATGTG-3 ' (as shown in SEQ ID No.6)；

Another aspect of the present invention is to provide a kind of detection side RT-LAMP for detecting the high pathogenic strain of pig blue-ear disease poison american type Method, which is characterized in that carry out RT-LAMP amplification with primer using above-mentioned LAMP detection.

In order to advanced optimize above-mentioned detection method, technical solution provided by the invention further include:

Each 0.12 μ L of outer primer F3 and B3 of 0.3mM；Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；The ring primer of 1mM Each 0.4 μ L of LF and LB；2 × reaction buffer, 10 μ L；The template DNA of 2 μ L, 0.5 μ L AMV reverse transcriptase, adds RNase-free Water is to 20 μ L systems.

Above-mentioned RT-LAMP detects reaction condition are as follows: 60 DEG C of -65 DEG C of constant temperature 50min.

Preferably, above-mentioned RT-LAMP detects reaction condition are as follows: 65 DEG C of constant temperature 50min.

In above-mentioned RT-LAMP detection method, testing result passes through observation real-time fluorescence PCR instrument appearance time.

Another aspect of the present invention also provides a kind of high pathogenic strain RT-LAMP detection reagent box of pig blue-ear disease poison american type, pig It include above-mentioned LAMP detection primer in the blue high pathogenic strain RT-LAMP detection reagent box of otopathy poison american type.

The present invention provides the RT-LAMP primer sets and detection of a high pathogenic strain of species specificdetection pig blue-ear disease poison american type Method.It is caused a disease using pig blue-ear disease poison american type height of the RT-LAMP technology in real-time fluorescence PCR instrument in real-time detection sample Strain.The primer sets can distinguish the high pathogenic strain of pig blue-ear disease poison american type, classical strain and vaccine strain (TJM-F92), while flow with pig Influenza Virus (SIV), pig parvoviral (PPV), porcine circovirus 2 type (PCV2), swine fever virus (CSFV), porcine pseudorabies virus (PRV) no cross reactions such as.Only one patent using LAMP technology detection pig blue-ear disease poison is authorized at present, and the patent is only The high pathogenic strain of pig blue-ear disease poison american type and classical strain can be distinguished, cannot distinguish between vaccine strain, when detection, which is easy erroneous judgement, to cause to be immunized Pig is killed；Secondly the method for color developing agent SYBR Green I dyestuff need to be added after the reaction to detect amplified production in the patent, but This process, which must uncap, adds dyestuff, is extremely easy pollution environment；Finally the patent be after the completion of reaction recycle digestion and The method of electrophoresis distinguishes the high pathogenic strain of pig blue-ear disease poison american type and classical strain, cumbersome, time-consuming and laborious.

The primer specificity that the present invention screens compared with existing RT-LAMP method is strong, and the detection method of foundation has standard The advantages of true rate is high, detection time is short, result can be observed in real time only needs 1h from sample treatment to report result, easy to operate.

Experimental method in following embodiments is unless otherwise specified conventional method.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Reaction solution is the product of Capitalbio Corporation Co., Ltd., catalog number CP.440020.

Pig indigo plant ear american type height causes a disease strain virus (HP-PRRSV-HuN4-F5), vaccine strain (TJM-F92), pig indigo plant ear America Type classics strain virus (VR-2332), Classical Swine Fever Virus Shimen Strain AV1411 (04/08/87) is purchased from Chinese veterinary drug supervision Institute, swine influenza virus (VR-333^TM), HeN1 plants of porcine pseudorabies virus (CGMCC NO.6656), pig parvoviral (PPV, CCTCC NO:V201618), SD plants of porcine circovirus 2 type (CGMCC NO.7707).

The calculation method of RNA copy number is as follows:

40 μ g/ml of 1A260 absorbance value=ssRNA；

Nucleic acid concentration=(OD260) × (extension rate) × (40)=x ng/ μ l；

Average molecular weight (MW) representative gram/mol, unit dalton (dolton), i.e. 1dolton=1g/mol；

Mole=6.02 × 10²³；

Average molecular weight (MW): ssRNA=(base number) × (340 dalton/base)；

Copy number calculation formula:

(6.02×10²³Copies/ moles) × (l × 10 x ng/ μ^-9)/(RNA length × 340)=copies/ μ l.

Below with reference to embodiment, the present invention is further explained:

The screening that embodiment 1, primer combine

1, the primer sequence is synthesized by Sheng Gong company, for the high pathogenic strain virus N SP2 gene specific of pig indigo plant ear american type Section designs LAMP primer, and it is as follows to filter out optimal primer combination:

PRRSV-HP-F3:ACGCCCAAAATACTCAGC

PRRSV-HP-B3:GGTAAGCAGACGTGTTGC

PRRSV-HP-FIP:

GGACGCATCACAAGCCTCACCAAGCCATCATCGACTCTG

PRRSV-HP-BIP:

TCCAAGCTTGGTGATCCTGCTACCCAAGTCAGCATGTCAACC

PRRSV-HP-LF:CTGAGGCATGCTTCTTTTTCC

PRRSV-HP-LB:AGTGGCTCTCTCGCATGTG

In above-mentioned primer combination, the respective independent packaging of each single stranded DNA.

In above-mentioned primer combination, the molar ratio of primers F 3, primer B3, primers F IP, primer BIP, primer LF and primer LB It is 0.3:0.3:2.4:2.4:1:1.

2, using the high pathogenic strain viral RNA of pig indigo plant ear american type as template, the primer sets that step 1 is respectively adopted carry out template Reverse transcription-ring mediated isothermal amplification detection.

Reaction system (20 μ L): 10 μ L reaction solutions (Capitalbio Corporation Co., Ltd.'s product, catalog number: CP.440020), 2.96 μ L primer mixtures, 2 μ L template ribonucleic acids (5pg-50pg), 0.5 μ L AMV reverse transcriptase, RNase-free Water moisturizing is to 20 μ L.The mixture of each primer composition in primer mixture, that is, primer combination.In reaction system, 0.3mM Each 0.12 μ L of outer primer F3 and B3；2.4mM each 0.96 μ L of inner primer FIP and BIP；Each 0.4 μ of ring primer LF and LB of 1mM L。

Reaction condition: 65 DEG C of constant temperature 50min.

In reaction process, fluorescence signal is detected using fluorescent PCR instrument.

3 repetitions are arranged in each reaction system.

If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 45min, show anti- Answer the high pathogenic strain viral genome content of pig indigo plant ear american type in system that can be detected.If do not had in 45min There is positive amplification curve (i.e. amplification curve is typical " S type " amplification curve), shows the pig indigo plant ear America in reaction system The high pathogenic strain viral genome content of type cannot be detected.

Pig indigo plant ear american type height causes a disease strain virus primer screening experimental result: the testing result of primer sets 1 such as Fig. 1, primer Testing result such as Fig. 2 of group 2, primer combination 3 such as Fig. 3, primer combination 4 such as Fig. 4, primer combination 5 such as Fig. 5, primer combination 6 are as schemed 6, primer combination 7 such as Fig. 7, primer combination 8 such as Fig. 8, primer combination 9 such as Fig. 9, primer combination 10 such as Figure 10.The results show that primer Combine that the time used in 2 appearances is short, and experimental repeatability is good three times.

Embodiment 2, specificity experiments

Pig indigo plant ear american type height causes a disease strain virus (HP-PRRSV), vaccine strain (TJM-F92), pig indigo plant ear american type classics strain Viral (RPPSV), swine fever virus (CSFV), porcine pseudorabies virus (PRV), swine influenza virus (SIV), pig parvoviral (PPV), Pig circular ring virus (PCV2) each sample to be tested carries out following steps respectively:

1, the genomic DNA or RNA of sample to be tested are extracted.

2, the viral genome extracted using step 1 carries out reverse transcription-ring using the primer sets that embodiment 1 is screened as template Mediated isothermality amplification.

Reaction system (20 μ L): 10 μ L reaction solutions, 2.96 μ L primer mixtures, 2 μ L genomic DNAs/RNA (5pg- 50pg), 0.5 μ L AMV reverse transcriptase (being added in RNA template system) is mended with RNase-freewater to 20 μ L.Primer mixing The mixture of each primer composition in object, that is, primer sets.In reaction system, each 0.12 μ L of outer primer F3 and B3 of 0.3mM； Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；Each 0.4 μ L of ring primer LF and LB of 1mM.

Reaction condition: 65 DEG C of constant temperature 50min.

In reaction process, fluorescence signal is detected using fluorescent PCR instrument

Using the result is shown in Figure 11 of primer sets PRRSV-HP, only when sample to be tested is the high pathogenic strain disease of pig indigo plant ear american type Positive amplification curve is shown when the RNA of malicious (HP-PRRSV) (i.e. amplification curve is typical " S type " amplification curve).When to test sample This is vaccine strain (TJM-F92), pig indigo plant ear american type classics strain virus (RPPSV), swine fever virus (CSFV), porcine pseudorabies virus (PRV), positive amplification is not shown when swine influenza virus (SIV), pig parvoviral (PPV), pig circular ring virus (PCV2) Curve.

The above result shows that primer sets provided by the invention have very high specificity to its target gene.

Embodiment 3, sensitivity

Sample to be tested: pig indigo plant ear american type height causes a disease strain virus (HP-PRRSV) in embodiment 2.

1, the RNA for extracting sample to be tested, carries out gradient dilution with RNase-free water, obtains each dilution.

2, for the dilution obtained using step 1 as template, the primer combination prepared using embodiment 1 carries out ring mediated isothermal expansion Increase.

Reaction system (20 μ L): (Capitalbio Corporation Co., Ltd.'s product, catalog number are 10 μ L reaction solutions CP.440020), (genome copy numbers contained in 1 μ L dilution are respectively 10 for 2.96 μ L primer mixtures, 2 μ L dilutions²、 5×10¹Or 10¹), 0.5 μ L AMV reverse transcriptase, RNase-freewater moisturizing to 20 μ L.Primer mixture, that is, primer combination In each primer composition mixture.In reaction system, each 0.12 μ L of outer primer F3 and B3 of 0.3mM；The inner primer of 2.4mM Each 0.96 μ L of FIP and BIP；Each 0.4 μ L of ring primer LF and LB of 1mM.

Reaction condition: 65 DEG C of constant temperature 50min.

In reaction process, fluorescence signal is detected using fluorescent PCR instrument.

According to the difference of genome copy numbers in dilution, total following 3 reaction systems:

The genome copy numbers contained in reaction system 1:1 μ L dilution are 10²；

The genome copy numbers contained in reaction system 2:1 μ L dilution are 5 × 10¹；

The genome copy numbers contained in reaction system 3:1 μ L dilution are 10¹；

20 repetitions are arranged in each reaction system.

If occurring positive amplification curve (i.e. amplification curve is typical " S type " amplification curve) in 45min, show anti- Answer the high pathogenic strain viral genome content of pig indigo plant ear american type in system that can be detected.If do not had in 45min There is positive amplification curve, shows that the high pathogenic strain viral genome content of pig indigo plant ear american type in reaction system cannot be detected Out.

It is 10 that primer sets PRRSV-HP, which detects target gene genome copy numbers in 1 μ L dilution,²(Figure 12) and 5 × 10¹ When (Figure 13), 20 detections are detectable out and reproducible, and 20 detections can not go out completely when copy number is 10 (Figure 14) Peak and less reproducible, therefore the sensitivity of primer combination is 50 copy numbers/μ L.

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.

Sequence table

<110>Capitalbio Corporation Co., Ltd.

<120>primer combination and its application in the testing product for preparing the high pathogenic strain of pig blue-ear disease poison american type

<130> MP1832068

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

acgcccaaaa tactcagc 18

<210> 2

<211> 18

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

ggtaagcaga cgtgttgc 18

<210> 3

<211> 39

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

ggacgcatca caagcctcac caagccatca tcgactctg 39

<210> 4

<211> 42

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

tccaagcttg gtgatcctgc tacccaagtc agcatgtcaa cc 42

<210> 5

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

ctgaggcatg cttctttttc c 21

<210> 6

<211> 19

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

agtggctctc tcgcatgtg 19

<210> 7

<211> 375

<212> DNA

<213>artificial sequence (Artificial Sequence)

<220>

<221> unsure

<222> (297)..(297)

<223> y=C/T

<400> 7

atctcggata tactaaatga caccaaccct gcacctgtgt catcaagcag ctccctgtca 60

agtgttaaga tcacacgccc aaaatactca gctcaagcca tcatcgactc tggcgggcct 120

tgcagtgggc atctccaaaa ggaaaaagaa gcatgcctca gcatcatgcg tgaggcttgt 180

gatgcgtcca agcttggtga tcctgctacg caggagtggc tctctcgcat gtgggatagg 240

gttgacatgc tgacttggcg caacacgtct gcttaccagg cgtttcgcat cttaaayggc 300

aggtttgagt ttctcccaaa gatgattctc gagacaccgc cgccccaccc gtgcgggttt 360

gtgatgttac ctcgc 375

Claims (10)

1. marker, which is characterized in that have the nucleotide sequence as shown in SEQ ID NO:7.

2. the nucleotide with the sequence as shown in SEQ ID NO:7 is as marker in the testing product for preparing pig blue-ear disease poison Application.

3. the nucleotide with the sequence as shown in SEQ ID NO:7 is as marker to prepare pig blue-ear disease poison american type height pathogenic Application in the testing product of strain.

4. primer combines characterized by comprising primer-F3, primer-B3, primer-FIP, primer-BIP, primer-LF and draw Object-LB；

Primer-the F3 has any one in nucleotide sequence as follows:

(I), there is nucleotide sequence shown in SEQ ID NO:1；

(II), have nucleotide sequence shown in SEQ ID NO:1 through modification, substitution, one or more alkali are deleted and/or added The nucleotide sequence that base obtains；

(III), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:1；

(IV), the complementary series of the sequence as shown in (I), (II) or (III)；

Primer-the B3 has any one in nucleotide sequence as follows:

(V), there is nucleotide sequence shown in SEQ ID NO:2；

(VI), have nucleotide sequence shown in SEQ ID NO:2 through modification, substitution, one or more alkali are deleted and/or added The nucleotide sequence that base obtains；

(VII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:2；

(VIII), the complementary series of the sequence as shown in (V), (VI) or (VII)；

Primer-the FIP has any one in nucleotide sequence as follows:

(IX), there is nucleotide sequence shown in SEQ ID NO:3；

(X), have nucleotide sequence shown in SEQ ID NO:3 through modification, substitution, one or more alkali are deleted and/or added The nucleotide sequence that base obtains；

(XI), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:3；

(XII), the complementary series of the sequence as shown in (IX), (X) or (XI)；

Primer-the BIP has any one in nucleotide sequence as follows:

(XIII), there is nucleotide sequence shown in SEQ ID NO:4；

(XIV), have nucleotide sequence shown in SEQ ID NO:4 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

(XV), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:4；

(XVI), the complementary series of the sequence as shown in (XIII), (XIV) or (XV)；

Primer-the LF has any one in nucleotide sequence as follows:

(XVII), there is nucleotide sequence shown in SEQ ID NO:5；

(XVIII), have nucleotide sequence shown in SEQ ID NO:5 through modification, substitution, deletion and/or addition one or more The nucleotide sequence that a base obtains；

(XIX), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:5；

(XX), the complementary series of the sequence as shown in (XVII), (XVIII) or (XIX)；

Primer-the LB has any one in nucleotide sequence as follows:

(XXI), there is nucleotide sequence shown in SEQ ID NO:6；

(XXII), have nucleotide sequence shown in SEQ ID NO:6 one or more through modification, substitution, deletion and/or addition The nucleotide sequence that base obtains；

(XXIII), there is the sequence of at least 80% homology with nucleotide sequence shown in SEQ ID NO:6；

(XXIV), the complementary series of the sequence as shown in (XXI), (XXII) or (XXIII).

5. primer as claimed in claim 4 combination, which is characterized in that primer-F3 described in the primer combination, described draw Object-B3, the primer-FIP, the primer-BIP, the primer-LF and the primer-LB molar ratio be 0.3:0.3: 2.4:2.4:1:1.

6. kit, which is characterized in that combined including primer as described in claim 4 or 5.

7. primer combination as described in claim 4 or 5 or kit as claimed in claim 6 are in pig blue-ear disease poison american type Application in high pathogenic strain identification.

8. the detection method of the high pathogenic strain of pig blue-ear disease poison american type, which comprises the steps of:

(1) nucleic acid of sample to be tested is obtained；

(2) primer in primer combination as described in claim 4 or 5 is respectively adopted as template in the nucleic acid extracted using step (1) Reverse transcription-ring mediated isothermal amplification is carried out, amplification is obtained；

(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is pig indigo plant ear The viral high pathogenic strain of american type；If can not achieve specific amplification, sample to be tested is not that pig blue-ear disease poison american type height causes Diseased plant.

9. the detection method of the high pathogenic strain of pig blue-ear disease poison american type, which comprises the steps of:

(1) nucleic acid of sample to be tested is obtained；

(2) primer in primer combination as described in claim 4 or 5 is respectively adopted as template in the nucleic acid extracted using step (1) Reverse transcription-ring mediated isothermal amplification is carried out, amplification is obtained；

(3) obtain qualification result according to the amplification: if specific amplification may be implemented, sample to be tested is pig indigo plant ear The viral high pathogenic strain of american type；If can not achieve specific amplification, sample to be tested is not that pig blue-ear disease poison american type height causes Diseased plant.

10. method as claimed in claim 8 or 9, which is characterized in that the reactant of the reverse transcription-ring mediated isothermal amplification System are as follows: each 0.12 μ L of outer primer F3 and B3 of 0.3mM；Each 0.96 μ L of inner primer FIP and BIP of 2.4mM；The ring primer LF of 1mM With each 0.4 μ L of LB；2 × amplification reaction solution, 10 μ L；The sample to be tested nucleic acid of 2 μ L, 0.5 μ L AMV reverse transcriptase, adds RNase- Free water is to 20 μ L systems；

The reaction temperature of the reverse transcription-ring mediated isothermal amplification is 60 DEG C~65 DEG C, reaction time 50min.