CN109709332B - Application of serine residue number in apple transcription factor ERF17 - Google Patents
Application of serine residue number in apple transcription factor ERF17 Download PDFInfo
- Publication number
- CN109709332B CN109709332B CN201711009930.3A CN201711009930A CN109709332B CN 109709332 B CN109709332 B CN 109709332B CN 201711009930 A CN201711009930 A CN 201711009930A CN 109709332 B CN109709332 B CN 109709332B
- Authority
- CN
- China
- Prior art keywords
- apple
- erf17
- transcription factor
- detected
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of serine residue number in an apple transcription factor ERF 17. The pericarp chlorophyll degradation rate of the to-be-detected apples with the number of 8 continuous serine residues starting from the 12 th amino acid residue at the N terminal of the apple transcription factor ERF17 and/or the number of 6 continuous serine residues starting from the 12 th amino acid residue at the N terminal of the apple transcription factor ERF17 is larger than that of the to-be-detected apples with the number of 3 continuous serine residues starting from the 12 th amino acid residue at the N terminal of the apple transcription factor ERF 17. Experiments prove that the number of continuous serine residues of the apple transcription factor ERF17 from the 12 th amino acid residue at the N terminal can be used as a detection object to predict the chlorophyll degradation rate of the apple peel to be detected. The invention has great application value.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to application of the number of serine residues in an apple transcription factor ERF17, in particular to application of the number of continuous serine residues starting from the 12 th amino acid residue from the N terminal in an apple transcription factor ERF 17.
Background
The color of the apple pericarp is one of the important appearance qualities of the fruit, and the research on the degradation of chlorophyll before pericarp coloring is particularly important. Degradation of chlorophyll occurs frequently in aging plant cells and is induced by intense light, low temperature, and other environmental and endogenous hormones ethylene (Oeller et al, 1991; Hortenstein, 2006; Pino et al, 2008). The relevant studies of the chlorophyll degradation pathway in higher plants have been clarified (Takamiya et al, 2000; Hortenstein, 2006): on chloroplast thylakoids, NYC (Non-Yellow coloring) catalyses the conversion of chlorophyll b to chlorophyll a, which is transported to the chloroplast stroma, to form chlorophyll under the action of Chlorophyllase (CLH), and then pheophorbide (blue-fluorescent intercalation) after removal of magnesium ions by a magnesium Chelating agent (MCS) under the combined action of pao (pheide a oxidase) and rccr (red cholesterol chelate reduction).
Genes involved in fruit chlorophyll degradation can be divided into two classes: one is a structural gene, and the encoded protein can directly participate in the degradation and metabolism of chlorophyll, such as NYC, CLH and PAO; another class is regulatory genes, which encode proteins that regulate the level of transcription of structural genes, such as Ethylene response Factors (ERF/AP 2). Ethylene response factors are one of the most familial transcription factors in plants, contain the amino acid conserved domain of ERF/AP2, and have domain functions of DNA binding, transcriptional activation, protein interaction, nuclear localization, etc. (Fukao et al, 2006). Existing studies have shown that the ethylene response factors CitERF5, CitERF6, CitERF7 and CitERF13 play an important role in the chlorosis of citrus fruits (Xie et al, 2014); the ethylene response factor CitERF13, in combination with the promoter of the CitPPH gene (a key gene for chlorophyll degradation), enhances the transcription level of the CitPPH gene, promoting chlorophyll degradation (Yin et al, 2016).
Disclosure of Invention
The invention aims to solve the technical problem of predicting the chlorophyll degradation rate of the apple peel to be detected. The less chlorophyll content in the apple pericarp, the redder the pericarp color.
In order to solve the technical problems, the invention provides a method for predicting the chlorophyll degradation rate of the apple peel to be detected.
The method for predicting the degradation rate of chlorophyll in apple peel to be detected provided by the invention can be specifically a method I, and can comprise the following steps: detecting the number of continuous serine residues of the apple transcription factor ERF17 of the apple to be detected from the 12 th amino acid residue at the N terminal; the degradation rate of chlorophyll peels of the apples to be tested, which is characterized in that the number of continuous serine residues of the apple transcription factor ERF17 from the 12 th amino acid residue at the N terminal is 8 (the 9 th amino acid residue is a non-serine residue) and/or the number of continuous serine residues of the apple transcription factor ERF17 from the 12 th amino acid residue at the N terminal is 6 (the 7 th amino acid residue is a non-serine residue), is larger than that of the apples to be tested, which is characterized in that the number of continuous serine residues of the apple transcription factor ERF17 from the 12 th amino acid residue at the N terminal is 3 (the 4 th amino acid residue is a non-serine residue).
In the first method, the apple transcription factor ERF17 is a protein and sequentially comprises a segment I, a segment II and a segment III from the N end to the C end; the C-terminal amino acid residue of segment I may be T, segment II may consist of 3-8 serine residues, and the N-terminal amino acid residue of segment III may be M.
The segment I may be a1) or a2) or a3) as follows:
a1) the amino acid sequence is a polypeptide shown in 1 st to 11 th positions from the N terminal of a sequence 5 in a sequence table;
a2) the polypeptide with the same function is obtained by replacing one or more amino acid residues of the polypeptide shown in a 1).
a3) Protein which has 80% or more identity with the polypeptide shown in a1) or a2), is derived from apple and has the same function.
The term "identity" as used in a3) above, refers to sequence similarity to the native amino acid sequence. "identity" includes an amino acid sequence having 80%, or 85% or more, or 90% or more, or 95% or more identity to the amino acid sequence shown at positions 1 to 11 from the N-terminus of sequence 5 in the sequence listing of the present invention.
The segment II can be b1) or b2) or b3) as follows:
b1) the amino acid sequence is polypeptide shown in 12 th to 19 th positions from the N terminal of a sequence 5 in a sequence table;
b2) the amino acid sequence is a polypeptide shown in 12 th to 17 th positions from the N terminal of a sequence 5 in a sequence table;
b3) the amino acid sequence is polypeptide shown as 12 th to 14 th positions from the N terminal of a sequence 5 in a sequence table.
The segment III may be c1) or c2) or c3) as follows:
c1) the amino acid sequence is polypeptide shown as 20 th to 235 th sites from the N terminal of a sequence 5 in a sequence table;
c2) c1) by replacing and/or deleting and/or adding one or more amino acid residues to obtain the polypeptide with the same function;
c3) protein which has 80% or more identity with the polypeptide shown in c1) or c2), is derived from apple and has the same function.
The term "identity" as used in c3) above refers to sequence similarity to the native amino acid sequence. "identity" includes an amino acid sequence having 80%, or 85% or more, or 90% or more, or 95% or more identity to the amino acid sequence shown at positions 20 to 235 from the N-terminus of sequence 5 in the sequence listing of the present invention.
Any one of the above apple transcription factors ERF17 may be d1) or d2) or d3) or d4) or d 5):
d1) the amino acid sequence is protein shown as a sequence 5 in a sequence table;
d2) the amino acid sequence is protein shown as a sequence 6 in a sequence table;
d3) the amino acid sequence is a protein shown as a sequence 8 in a sequence table;
d4) protein with the same function obtained by replacing and/or deleting and/or adding one or more amino acid residues of the protein shown by d1) or d2) or d 3);
d5) a protein which has 80% or more than 80% of identity with the protein shown by d1), d2), d3) or d4), is derived from apple and has the function of the apple transcription factor ERF 17.
The term "identity" as used in d5) above refers to sequence similarity to the native amino acid sequence. "identity" includes amino acid sequences that are 80%, or 85% or more, or 90% or more, or 95% or more identical to the amino acid sequence encoding the apple transcription factor ERF 17.
Deletion and/or addition of one or several amino acid residues in d4) above cannot be carried out in segment II.
The method for predicting the degradation rate of chlorophyll in apple peel to be detected, which is provided by the invention, can be specifically a method II, and can comprise the following steps: detecting whether the apple transcription factor ERF17 of the to-be-detected apple is an apple transcription factor ERF17-8s, an apple transcription factor ERF17-6s or an apple transcription factor ERF17-3 s; the peel chlorophyll degradation rate of the to-be-detected apple with the apple transcription factor ERF17 being the apple transcription factor ERF17-8s and/or the apple transcription factor ERF17-6s is larger than that of the to-be-detected apple with the apple transcription factor ERF17 being the apple transcription factor ERF17-3 s.
In the second method, the apple transcription factor ERF17-8s can be e1) or e2) or e3) as follows:
e1) the amino acid sequence is protein shown as a sequence 5 in a sequence table;
e2) a protein having the same function as that of the protein represented by e1) by substitution of one or more amino acid residues;
e3) protein which has 80% or more identity with the protein shown by e1) or e2) and is derived from apple and has the function of the apple transcription factor ERF17-8 s.
The term "identity" as used in e3) above refers to sequence similarity to the native amino acid sequence. "identity" includes an amino acid sequence having 80%, or 85% or more, or 90% or more, or 95% or more identity to the amino acid sequence shown in sequence 5 in the sequence listing of the present invention.
In the second method, the apple transcription factor ERF17-6s can be f1) or f2) or f3) as follows:
f1) the amino acid sequence is protein shown as a sequence 6 in a sequence table;
f2) a protein having the same function as that of the protein represented by f1) by substitution of one or more amino acid residues;
f3) protein which has 80% or more identity with the protein shown by f1) or f2) and is derived from apple and has the function of the apple transcription factor ERF17-6 s.
The term "identity" as used in f3) above refers to sequence similarity to the native amino acid sequence. "identity" includes an amino acid sequence having 80%, or 85% or more, or 90% or more, or 95% or more identity to the amino acid sequence shown in sequence No. 6 in the sequence listing of the present invention.
In the second method, the apple transcription factor ERF17-3s can be g1) or g2) or g3) as follows:
g1) the amino acid sequence is a protein shown as a sequence 8 in a sequence table;
g2) protein with the same function obtained by replacing one or more amino acid residues of the protein shown in g 1);
g3) protein which has 80% or more identity with the protein shown by g1) or g2) and is derived from apple and has the function of the apple transcription factor ERF17-3 s.
The term "identity" as used in g3) above means sequence similarity to the native amino acid sequence. "identity" includes an amino acid sequence having 80%, or 85% or more, or 90% or more, or 95% or more identity to the amino acid sequence shown in sequence No. 8 in the sequence Listing of the present invention.
In the second method above, the substitution may not occur in the region between the first and second amino acid residues of the second segment.
The method for predicting the degradation rate of chlorophyll in apple peel to be detected provided by the invention can be specifically a third method, and can comprise the following steps: detecting the number of codons for continuously coding serine at the 12 th codon in a specific transcript of the total RNA of the apples to be detected; the specific transcript is RNA obtained by transcription of a coding gene of the apple transcription factor ERF17, and the 1 st codon of the transcript is an initiation codon; the pericarp chlorophyll degradation rate of the apple to be tested is higher than that of the apple to be tested, wherein the apple to be tested has 8 codons (the 9 th codon encodes non-serine) for which the 12 th codon in the specific transcript begins to continuously encode serine and/or 6 codons (the 7 th codon encodes non-serine) for which the 12 th codon in the specific transcript begins to continuously encode serine.
The method for predicting the degradation rate of chlorophyll in the apple peel to be detected, which is provided by the invention, can be specifically the fourth method, and can comprise the following steps: detecting the number of codons which continuously code serine at the 12 th codon of the coding gene of the apple transcription factor ERF17 in the total DNA of the apples to be detected; the pericarp chlorophyll degradation rate of the to-be-tested apple with the total DNA, wherein the codon beginning to continuously code serine at the 12 th codon of the coding gene of the apple transcription factor ERF17 is 8 (the 9 th codon codes non-serine) and/or the codon beginning to continuously code serine at the 12 th codon of the coding gene of the apple transcription factor ERF17 is 6 (the 7 th codon codes non-serine) is higher than that of the to-be-tested apple with the total DNA, wherein the codon beginning to continuously code serine at the 12 th codon of the coding gene of the apple transcription factor ERF17 is 3 (the 4 th codon codes non-serine).
The method for predicting the degradation rate of chlorophyll in apple peel to be detected provided by the invention can be specifically a fifth method, and can comprise the following steps: extracting total RNA of the apples to be detected and carrying out reverse transcription to obtain cDNA, then carrying out PCR amplification by adopting a specific primer pair, and detecting PCR amplification products; the pericarp chlorophyll degradation rate of the apple to be detected, which has the DNA molecule shown in the sequence 3 and the DNA molecule shown in the sequence 4 in the PCR amplification product, is higher than that of the apple to be detected, which does not have the DNA molecule shown in the sequence 3, does not have the DNA molecule shown in the sequence 4 and has the DNA molecule shown in the sequence 7 in the PCR amplification product.
In the fifth method, the specific primer pair can be composed of two primers for amplifying specific DNA fragments. The specific DNA fragment has a target sequence of a primer pair consisting of a primer F and a primer R in an apple genome.
The primer F can be h1) or h2) as follows:
h1) a single-stranded DNA molecule shown in sequence 9 of the sequence table;
h2) and (b) a DNA molecule which is obtained by replacing and/or deleting and/or adding one or more nucleotides in the sequence 9 and has the same function as the sequence 9.
The primer R is the following i3) or i 4):
i3) a single-stranded DNA molecule shown in sequence 10 of the sequence table;
i4) a DNA molecule which is obtained by replacing and/or deleting and/or adding one or more nucleotides in the sequence 10 and has the same function as the sequence 10.
In the fifth method, the specific primer pair may be composed of the primer F and the primer R.
The invention also protects the application of the substance A, the substance B or the substance C in predicting the chlorophyll degradation rate of the apple peel to be detected.
In the above application, the substance A may be a substance for detecting the number of consecutive serine residues of the apple transcription factor ERF17 from the 12 th amino acid residue at the N-terminal.
In the above application, the substance B may be a substance for detecting the number of codons which start with the 12 th codon and continuously encode serine in a specific transcript; the specific transcript is RNA obtained by transcription of the coding gene of the apple transcription factor ERF17, and the 1 st codon of the transcript is an initiation codon.
In the application, the substance C can be used for detecting the number of codons for continuously coding serine from the 12 th codon of the coding gene of the apple transcription factor ERF17 in the total DNA of the apples to be detected.
In the above application, the substance C may be specifically the specific primer pair.
The invention also protects the application of the complete set product A, the complete set product B or the complete set product C in predicting the chlorophyll degradation rate of the apple peel to be detected.
In the application, the kit A can be the substance A and a carrier recorded with the method A; the method A can be as follows: the pericarp chlorophyll degradation rate of the to-be-tested apple with the apple transcription factor ERF17, in which the number of continuous serine residues starting from the 12 th amino acid residue at the N terminal is 8 (the 9 th amino acid residue is a non-serine residue) and/or the number of continuous serine residues starting from the 12 th amino acid residue at the N terminal of the apple transcription factor ERF17 is 6 (the 7 th amino acid residue is a non-serine residue), is higher than that of the to-be-tested apple with the apple transcription factor ERF17, in which the number of continuous serine residues starting from the 12 th amino acid residue at the N terminal is 3 (the 4 th amino acid residue is a non-serine residue).
In the application, the kit B can be the substance B and a carrier for recording the method B; the method B can be as follows: the specific transcript is RNA obtained by transcription of a coding gene of an apple transcription factor ERF17, and the 1 st codon of the specific transcript is an initiation codon.
In the application, the kit C can be the substance C and a carrier recorded with the method C; the method can be as follows: the pericarp chlorophyll degradation rate of the to-be-tested apple with the total DNA, wherein the codon beginning to continuously code serine at the 12 th codon of the coding gene of the apple transcription factor ERF17 is 8 (the 9 th codon codes non-serine) and/or the codon beginning to continuously code serine at the 12 th codon of the coding gene of the apple transcription factor ERF17 is 6 (the 7 th codon codes non-serine) is higher than that of the to-be-tested apple with the total DNA, wherein the codon beginning to continuously code serine at the 12 th codon of the coding gene of the apple transcription factor ERF17 is 3 (the 4 th codon codes non-serine).
The following A1) or A2) or A3) also belong to the scope of protection of the invention:
A1) the application of the number of continuous serine residues of the apple transcription factor ERF17 starting from the 12 th amino acid residue at the N terminal as a detection object in predicting the chlorophyll degradation rate of the apple peel to be detected;
A2) the number of codons for continuously coding serine at the beginning of the 12 th codon in the specific transcript is used as an application of a detection object in predicting the chlorophyll degradation rate of the apple peel to be detected; the specific transcript is RNA obtained by transcription of a coding gene of the apple transcription factor ERF 17;
A3) the application of the number of codons which start to continuously code serine at the 12 th codon of the coding gene of the apple transcription factor ERF17 in the total DNA of the apples as a detection object in predicting the chlorophyll degradation rate of the apple peels to be detected.
Any specific primer pair described above also belongs to the protection scope of the invention.
The following B1) or B2) or B3) also belong to the scope of protection of the present invention:
B1) the apple transcription factor ERF 17;
B2) the coding gene of the apple transcription factor ERF 17;
B3) the application of the coding gene of the apple transcription factor ERF17 and/or the apple transcription factor ERF17 is j1) or j2) or j3) as follows: j1) promoting the degradation of chlorophyll in the apple peel; j2) promoting apple fruit ripening; j3) enhance the red color of apple peel.
In the above, the coding gene of the apple transcription factor ERF17 can be a DNA molecule shown in the following x1) or x2) or x3) or x4) or x5) or x6) or x7) or x 8):
x1) the coding region is shown as a DNA molecule in a sequence 3 in a sequence table;
x2) is a DNA molecule shown in a sequence 3 in the sequence table;
x3) the coding region is shown as a DNA molecule in a sequence 4 in a sequence table;
x4) is a DNA molecule shown in a sequence 4 in the sequence table;
x5) the coding region is shown as a DNA molecule in a sequence 7 in a sequence table;
x6) is a DNA molecule shown as a sequence 7 in the sequence table;
x7) has 75% or more than 75% of identity with the nucleotide sequence defined by x1) or x2) or x3) or x4) or x5) or x6), and encodes the apple transcription factor ERF 17;
x8) hybridizes with a nucleotide sequence limited by x1) or x2) or x3) or x4) or x5) or x6) under strict conditions, and encodes the apple transcription factor ERF 17.
Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.
The term "identity" as used in x7) above refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75%, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to a nucleotide sequence of the protein consisting of the amino acid sequence represented by sequence 5 in the sequence listing of the present invention, or a nucleotide sequence of the protein consisting of the amino acid sequence represented by sequence 6 in the sequence listing of the present invention, or a nucleotide sequence of the protein consisting of the amino acid sequence represented by sequence 8 in the sequence listing of the present invention.
The sequence 3 in the sequence table is composed of 708 nucleotides, and the nucleotide of the sequence 3 in the sequence table encodes an amino acid sequence shown as a sequence 5 in the sequence table. The sequence 4 in the sequence table consists of 702 nucleotides, and the nucleotide of the sequence 4 in the sequence table encodes an amino acid sequence shown as a sequence 6 in the sequence table. The sequence 7 in the sequence table consists of 696 nucleotides, and the nucleotide of the sequence 7 in the sequence table encodes an amino acid sequence shown as a sequence 8 in the sequence table.
Above, identity can be evaluated with the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.
Experiments prove that the number of continuous serine residues of the apple transcription factor ERF17 from the 12 th amino acid residue at the N terminal can be used as a detection object to predict the chlorophyll degradation rate of the apple peel to be detected. The invention has great application value.
Drawings
FIG. 1 shows the nucleotide sequence alignment of ERF17-8s gene, ERF17-6s gene and ERF17-3s gene.
FIG. 2 shows the alignment results of the amino acid sequences of apple transcription factor ERF17-8s, apple transcription factor ERF17-6s and apple transcription factor ERF17-3 s.
FIG. 3 is a graph of the pericarp color phenotype and chlorophyll content of red Fuji and Zisenzhu.
FIG. 4 is a chart of pericarp color phenotype and chlorophyll content of hybrid progeny lines of Fuji and Zisenzhu.
FIG. 5 shows the results of transient expression of the pericarp of the morning glory of Taishan mountain.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
The cultivation of apples ' Red Fuji ' (Malus domestica Borkh cv. ' Red Fuji ') and Malus asiatica Pearl ' (Malus asiatica Nakai. cv. ' Zisai Pearl ') are described in the following documents: jingxiaokang, Lusong, Liu Xin Ying, Wang Ying, Wu Ting, Zhang Xin Zhong, Han Zheng Hai, Li Tianhong, Malus asiatica x M.domestica interspecies hybrid apple alternaria QTL location of susceptibility, Chinese university of agriculture report 2014, 19 (6): 140-147; zhengfeixue, Zhangxinzhong, Queenyi, Han Zhenhai, apple seedling tree in different stages of ontogeny and development2O2Changes in content and related enzyme activities, fruit tree bulletins, 2013, 30 (5): 759 contains 764, publicly available from the university of agriculture. The cultivated apple 'Red Fuji' (Malus domestica Borkhcv. 'Red Fuji') is hereinafter abbreviated Red Fuji. The crabapple 'Zisai Pearl' (Malus asiatica nakai. cv. 'Zisai Pearl') is hereinafter referred to simply as Zisai Pearl.
The cultivated apple ' Taishan mountain precocious morning (Malus domestica Borkh cv. ' Taishan Zaoxia ') is described in the following documents: chen schasen, cheng xiao liu, xinpegang, zhang tai yan, zhang yang min, penfu field, zhou chao hua, shong yang mao, cheng xiao liu, wang habo. The cultivated apple 'Taishan early-morning Xia' (Malus domestica Borkh cv. 'Taishan Zaoxia') is hereinafter referred to as Taishan early-morning Xia.
Both the pEasy-T1 vector and the HIFI Mix are products of Beijing Quanyujin Biotechnology, Inc.
Example 1 cloning of the Gene encoding apple transcription factor ERF17
Cloning of genes encoding apple transcription factor ERF17-8s and apple transcription factor ERF17-6s
1. Extracting total RNA of red Fuji pericarp, and performing reverse transcription to obtain first strand cDNA.
2. And (3) carrying out PCR amplification by using the cDNA obtained in the step (1) as a template and adopting a primer pair consisting of a primer F1 and a primer R1 to obtain a PCR amplification product.
Primer F1: 5'-CTTTCACTGCATGTCAAACCACTTC-3' (SEQ ID NO: 1 in the sequence Listing).
Primer R1: 5'-CTCTAGAAATTCCAGAGGAAAGACTC-3' (SEQ ID NO: 2 in the sequence Listing).
Reaction system (50 μ L): the mixture was prepared from 25. mu.L of HIFI Mix, 2. mu.L of primer F1 aqueous solution (10. mu.M), 2. mu.L of primer R1 aqueous solution (10. mu.M), 2. mu.L of cDNA (containing 10-50ng cDNA), and 19. mu.LH2And (C) O.
Reaction procedure: 5min at 95 ℃; 30sec at 94 ℃, 30sec at 58 ℃, 1min at 72 ℃ and 35 cycles; 7min at 72 ℃; storing at 4 ℃.
3. And (3) connecting the PCR amplification product obtained in the step (2) with a pEasy-T1 vector to obtain a recombinant plasmid A.
Sequencing the recombinant plasmid A obtained in the step 3 by using the Huada gene. Sequencing results show that the recombinant plasmid A has two types, one type contains a DNA molecule shown as a sequence 3 in a sequence table and is named as recombinant plasmid A-1; the other DNA molecule containing the sequence 4 in the sequence table is named as recombinant plasmid A-2.
The nucleotide sequence shown in the sequence 3 in the sequence table codes the apple transcription factor ERF17-8s shown in the sequence 5 in the sequence table. The gene (namely the nucleotide sequence shown in the sequence 3 in the sequence table) for coding the apple transcription factor ERF17-8s is named as ERF17-8s gene.
The nucleotide sequence shown in the sequence 4 in the sequence table encodes an apple transcription factor ERF17-6s shown in the sequence 6 in the sequence table. The gene (namely the nucleotide sequence shown in the sequence 4 in the sequence table) for coding the apple transcription factor ERF17-6s is named as ERF17-6s gene.
Cloning of gene encoding apple transcription factor ERF17-3s
Replacing the red Fuji in the step 1 with the zisaiming pearl according to the method of the step one, and obtaining the recombinant plasmid B without changing other steps.
Sequencing the recombinant plasmid B by the Huada gene. The sequencing result shows that the recombinant plasmid B is only one type and contains DNA molecules shown in a sequence 7 in a sequence table.
The nucleotide sequence shown in the sequence 7 in the sequence table encodes an apple transcription factor ERF17-3s shown in the sequence 8 in the sequence table. The gene (namely the nucleotide sequence shown as the sequence 7 in the sequence table) of the coding apple transcription factor ERF17-3s is named as ERF17-3s gene.
The nucleotide sequences shown in the sequence 3, the sequence 4 and the sequence 7 are compared and analyzed by using DNAman and NCBI, and the experimental result is shown in figure 1. The amino acid sequences shown in the sequence 5, the sequence 6 and the sequence 8 are aligned and analyzed by using DNAman and NCBI, and the experimental result is shown in figure 2. The results show that the numbers of continuous serine residues from the 12 th amino acid residue at the N terminal of the apple transcription factor ERF17-8s, the apple transcription factor ERF17-6s and the apple transcription factor ERF17-3s are different: the 12 th to 19 th positions of the apple transcription factor ERF17-8s from the N terminal are 8 continuous serine residues, the 12 th to 17 th positions of the apple transcription factor ERF17-6s from the N terminal are 6 continuous serine residues, and the 12 th to 14 th positions of the apple transcription factor ERF17-3s from the N terminal are 3 continuous serine residues.
Example 2 pericarp color phenotype and chlorophyll content of Fuji and Zisenzhu
The apple to be tested is red Fuji or Zisaiming pearl.
1. Planting 80 seedlings of apples to be tested in eight test bases of Zhuang in Chang plain district of Beijing city.
2. And (3) After the step 1 is finished, respectively in the sixth year, the seventh year and the eighth year of planting, and collecting fruits at the 50 th, 80 th, 110 th, 140 th or 170 th days After the apples to be tested are full of flowers.
3. And (4) taking the fruits collected in the step (2), photographing (in the same year), and recording the color of the peel.
4. And (3) taking the fruits collected in the step (2), separating peels, extracting chlorophyll, calculating the chlorophyll content in the peels, and taking an average value.
The experimental results of the sixth year of planting are shown in fig. 3. The peel color results were as follows: the 140d-170d pericarp of the red Fushi flourishing flower begins to be colored red; the pericarp of the 110d to 140d after the pearl of Zisaiming pearl is full-red after the flower is full, and the pericarp of the 170d after the flower is full. The results for chlorophyll content in the pericarp were as follows: the chlorophyll content of the pericarp of Fuji is highest when the fruit is young (50 d after full bloom), and gradually decreases with the continuous maturation of the fruit; the change trend of the chlorophyll content in the purple Securinega peel is basically similar to that of Fuji, but the level of the chlorophyll content in the peel is integrally lower; the chlorophyll degradation rate of Fuji is significantly greater than that of Ziseneming. The level of chlorophyll in the pericarp is directly related to the color phenotype of the pericarp.
The fruit peel color results in the seventh year of planting are as follows: the 140d-170d pericarp of the red Fushi flourishing flower begins to be colored red; the pericarp of the 110d to 140d after the pearl of Zisaiming pearl is full-red after the flower is full, and the pericarp of the 170d after the flower is full. The results for chlorophyll content in the peel at fifth year of planting were as follows: the chlorophyll content of the pericarp of Fuji is highest when the fruit is young (50 d after full bloom), and gradually decreases with the continuous maturation of the fruit; the change trend of the chlorophyll content in the purple Securinega peel is basically similar to that of Fuji, but the level of the chlorophyll content in the peel is integrally lower; the chlorophyll degradation rate of Fuji is significantly greater than that of Ziseneming.
The fruit peel color results in the eighth year of planting are as follows: the 140d-170d pericarp of the red Fushi flourishing flower begins to be colored red; the pericarp of the 110d to 140d after the pearl of Zisaiming pearl is full-red after the flower is full, and the pericarp of the 170d after the flower is full. The results for chlorophyll content in the peel at the sixth year of planting were as follows: the chlorophyll content of the pericarp of Fuji is highest when the fruit is young (50 d after full bloom), and gradually decreases with the continuous maturation of the fruit; the change trend of the chlorophyll content in the purple Securinega peel is basically similar to that of Fuji, but the level of the chlorophyll content in the peel is integrally lower; the chlorophyll degradation rate of Fuji is significantly greater than that of Ziseneming.
Example 3 pericarp color phenotype and chlorophyll content of hybrid progeny lines of Fuji and Zisenzhu
Pericarp color phenotype and chlorophyll content of hybrid progeny strains of Fuji and Zisenzhu
1. Hybridizing the red Fushi (male parent) and the Zisaiming pearl (female parent) to obtain hybrid F1 generation seeds.
2. After the step 1 is completed, the hybrid F1 generation seeds are raised, and then tissue culture and propagation are carried out to obtain a plurality of hybrid lines (a plurality of plants obtained by propagation of the seedlings of the same seed are used as one line). The 6 hybrid lines obtained by propagation are named as 07-130, 11-132, 16-122, 04-153, 06-174 and 09-129 in sequence.
3. The seedlings (80 of each line) of the hybrid lines (07-130, 11-132, 16-122, 04-153, 06-174 or 09-129) are planted in eight test bases of Chang's plain district in Beijing.
4. After the step 3 is completed, fruits are collected at 50 th, 80 th, 110 th, 140 th or 170 th days After the hybrid lines are full of flowers in the sixth year, the seventh year and the eighth year, respectively.
5. And (4) taking the fruits collected in the step (4), photographing (in the same year), and recording the color of the peel.
6. And (4) taking the fruits collected in the step (4), separating peels, extracting chlorophyll, and then calculating the chlorophyll content in the peels.
The experimental results of the sixth year of planting are shown in fig. 4. The results for chlorophyll content in the pericarp were as follows: 07-130, 11-132 and 16-122, the chlorophyll content in the pericarp is highest when the fruit is young (50 d after full bloom), the chlorophyll content gradually decreases and the decline trend is faster along with the continuous maturation of the fruit, and the pericarp begins to turn red at 160d-180d after full bloom; 04-153, 06-174 and 09-129 have a trend of decreasing chlorophyll content in the whole ripening process, but the chlorophyll content in the pericarp is lower and has a slower trend in the young fruit (50 d after full bloom), and the pericarp begins to turn red at 130d-150d after full bloom. The chlorophyll degradation rate of 07-130, 11-132, or 16-122 is significantly greater than the chlorophyll degradation rate of 04-153, 06-174, or 09-129. The level of chlorophyll in the pericarp is directly related to the color phenotype of the pericarp.
The results of chlorophyll content in the pericarp in the seventh year of planting were as follows: 07-130, 11-132 or 16-122, the chlorophyll content in the pericarp is highest when the fruit is young (50 d after full bloom), the chlorophyll content gradually decreases and the decline trend is faster along with the continuous maturation of the fruit, and the pericarp begins to turn red at 160d-180d after full bloom; 04-153, 06-174 and 09-129 have a trend of decreasing chlorophyll content in the whole ripening process, but the chlorophyll content in the pericarp is lower and has a slower trend in the young fruit (50 d after full bloom), and the pericarp begins to turn red at 130d-150d after full bloom. The chlorophyll degradation rate of 07-130, 11-132, or 16-122 is significantly greater than the chlorophyll degradation rate of 04-153, 06-174, or 09-129.
The results for chlorophyll content in the pericarp in the eighth year of planting were as follows: 07-130, 11-132 or 16-122, the chlorophyll content in the pericarp is highest when the fruit is young (50 d after full bloom), the chlorophyll content gradually decreases and the decline trend is faster along with the continuous maturation of the fruit, and the pericarp begins to turn red at 160d-180d after full bloom; 04-153, 06-174 and 09-129 have a trend of decreasing chlorophyll content in the whole ripening process, but the chlorophyll content in the pericarp is lower and has a slower trend in the young fruit (50 d after full bloom), and the pericarp begins to turn red at 130d-150d after full bloom. The chlorophyll degradation rate of 07-130, 11-132, or 16-122 is significantly greater than the chlorophyll degradation rate of 04-153, 06-174, or 09-129.
Secondly, detecting the number of continuous serine residues of the apple transcription factor ERF17 starting from the 12 th amino acid residue at the N terminal of the hybrid progeny strain of red Fuji and Zisening pearl
And (3) the plant to be detected: 07-130, 11-132, 16-122, 04-153, 06-174, or 09-129 plants.
1. Extracting total RNA of the pericarp of the plant to be detected, and then carrying out reverse transcription to obtain first-strand cDNA.
2. And (3) carrying out PCR amplification by using the cDNA obtained in the step (1) as a template and adopting a primer pair consisting of the primer F1 and the primer R1 in the step (2) in the step one in the example 1 to obtain a PCR amplification product.
The reaction system was the same as that in 2 of step one of example 1.
The reaction sequence was the same as that of 2 in step one of example 1.
3. And connecting the PCR amplification product with a pEasy-T1 vector to obtain a recombinant plasmid.
Sequencing the recombinant plasmid by using the Huada gene. Sequencing results show that when the plant to be detected is 07-130, 11-132 or 16-122, the recombinant plasmid has two types, wherein one type contains a nucleotide sequence of an ERF17-8s gene, the other type contains a nucleotide sequence of an ERF17-3s gene, namely the genotypes of the 07-130, 11-132 and 16-122 are ERF17-8s/ERF17-3s (the left graph of A in figure 4), and the recombinant plasmid can code an apple transcription factor ERF17-8s with 8 continuous serine residues starting from the 12 th amino acid residue at the N terminal and an apple transcription factor ERF17-3s with 3 continuous serine residues starting from the 12 th amino acid residue at the N terminal; when the plant to be detected is 04-153, 06-174 or 09-129, the recombinant plasmid has two types, one type contains nucleotide sequence of ERF17-6s gene, the other type contains nucleotide sequence of ERF17-3s gene, namely, the genotypes of 04-153, 06-174 and 09-129 are all ERF17-6s/ERF17-3s (right picture of A in figure 4), and the recombinant plasmid can code apple transcription factor ERF17-6s with 6 continuous serine residues starting from the 12 th amino acid residue at the N terminal and apple transcription factor ERF17-3s with 3 continuous serine residues starting from the 12 th amino acid residue at the N terminal.
Example 4 transient expression of pericarp of ERF17 Gene-transferred apple
First, the acquisition of ERF17-3s gene, ERF17-6s gene and ERF17-8s gene
1. And respectively taking the recombinant plasmid A-1, the recombinant plasmid A-2 or the recombinant plasmid B as templates, and performing PCR amplification by adopting a primer pair consisting of a primer F2 and a primer R2 to obtain PCR amplification products.
Primer F2: 5' -GCTCTAGAATGTCAAACCACTTC-3' (recognition site for the restriction enzyme XbaI is underlined).
Primer R2: 5' -TGGTACCGAAATTCCAGAGGAAAG-3' (the recognition site for the restriction enzyme KpnI is underlined).
Reaction system (50 μ L): the mixture was prepared from 25. mu.L of HIFI Mix, 2. mu.L of primer F2 aqueous solution (10. mu.M), 2. mu.L of primer R2 aqueous solution (10. mu.M), 2. mu.L of cDNA (containing 10-50ng cDNA), and 19. mu.LH2And (C) O.
Reaction procedure: 5min at 95 ℃; 94 ℃ for 30sec, 58 ℃ for 30sec, 72 ℃ for 1 min; 7min at 72 ℃; storing at 4 ℃.
2. And connecting the PCR amplification product with a pEasy-T1 vector to obtain a recombinant plasmid T1-ERF 17.
The recombinant plasmid T1-ERF17 was sequenced from Huada gene. The sequencing result shows that when the recombinant plasmid A-1 is taken as a template, the recombinant plasmid T1-ERF17 contains the nucleotide sequence of the ERF17-8s gene (the recombinant plasmid T1-ERF17 is named as recombinant plasmid T1-8 s); when the recombinant plasmid A-2 is taken as a template, the recombinant plasmid T1-ERF17 contains the nucleotide sequence of the ERF17-6s gene (the recombinant plasmid T1-ERF17 is named as recombinant plasmid T1-6 s); when the recombinant plasmid B is taken as a template, the recombinant plasmid T1-ERF17 contains the nucleotide sequence of the ERF17-3s gene (the recombinant plasmid T1-ERF17 is named as recombinant plasmid T1-3 s).
Second, construction of recombinant plasmid
1. The vector pBI1300 (described in Liu et al., 2013) was digested with restriction enzymes XbaI and KpnI, and a vector backbone of about 10762bp was recovered.
2. Taking the recombinant plasmid T1-8s obtained in the step one, carrying out double enzyme digestion by using restriction enzymes XbaI and KpnI, and recovering a DNA fragment A with about 719 bp; taking the recombinant plasmid T1-6s obtained in the step one, carrying out double enzyme digestion by using restriction enzymes XbaI and KpnI, and recovering a DNA fragment B with the length of about 713 bp; the recombinant plasmid T1-3s obtained in the first step was digested with restriction enzymes XbaI and KpnI, and the DNA fragment C of about 707bp was recovered.
3. And connecting the vector skeleton with the DNA fragment A to obtain the recombinant plasmid pBI1300-ERF17-8 s. And connecting the vector skeleton with the DNA fragment B to obtain the recombinant plasmid pBI1300-ERF17-6 s. The vector skeleton is connected with the DNA fragment C to obtain the recombinant plasmid pBI1300-ERF17-3 s.
Thirdly, obtaining of Agrobacterium
1. The recombinant plasmid pBI1300-ERF17-8s is introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, which is named as EHA105/pBI1300-ERF17-8 s.
2. The recombinant plasmid pBI1300-ERF17-6s is introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, which is named as EHA105/pBI1300-ERF17-6 s.
3. The recombinant plasmid pBI1300-ERF17-3s is introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, which is named as EHA105/pBI1300-ERF17-3 s.
4. The vector pBI1300 is introduced into agrobacterium tumefaciens EHA105 to obtain recombinant agrobacterium tumefaciens named
EHA105/pBI1300。
Four, transient transformation
1. Inoculating recombinant Agrobacterium (EHA105/pBI1300-ERF17-8s, EHA105/pBI1300-ERF17-6s, EHA105/pBI1300-ERF17-3s or EHA105/pBI1300) into culture medium, culturing at 28 deg.C and 200rpm under shaking to obtain OD600nmA value of 1.0 to 1.2.
2. After the step 1 is completed, taking the culture bacterial liquid, centrifuging for 10min at 4 ℃ and 5000rpm, discarding the supernatant, and collecting the thalli.
3. Taking the thalli collected in the step 2, adding suspension MMA (containing 10mM MgCl)2And 200. mu.M acetosyringone in 10mM MES buffer, pH 7.0) and then OD was adjusted600nmAnd (4) standing for 4-6h at room temperature after the value reaches 0.8-1.0 to obtain a conversion solution.
4. After the step 3 is completed, the fruits of the Taishan mountain morning gloryvine are taken, soaked in the conversion solution, and then are subjected to instantaneous suction filtration by a vacuum pump, and the specific method comprises the following steps: maintaining the pressure at-90 Kpa for 1min, and slowly deflating; the operation is repeated once and then the air is quickly discharged. Finally culturing alternately in light and dark (light for 16h and dark for 8h) for 7 d. The color of the pericarp of the ERF17 gene-transferred Taishan mountain precocious morning glory is observed, and the chlorophyll content in the pericarp is determined.
5. Taking fruits of Taishan mountain morning Xixia, culturing alternately in light and dark (light illumination for 16h and dark illumination for 8h) for 7 d. The color of the pericarp of the non-transgenic morning gloriosa of Taishan mountain was observed and the chlorophyll content in the pericarp was determined (as a control).
The experimental results are shown in FIG. 5(CK is non-transgenic Taishan early canula, pBI1300 is empty vector-transferred Taishan early canula, pBI1300-ERF17-3s is ERF17-3s gene-transferred Taishan early canula, pBI1300-ERF17-6s is ERF17-6s gene-transferred Taishan early canula, and pBI1300-ERF17-8s is ERF17-8s gene-transferred Taishan early canula). The results show that the chlorophyll content in the fruit peel of the ERF17-3s gene-transferred Taishan early morning glorysum, the ERF17-6s gene-transferred Taishan early glorysum and the ERF17-8s gene-transferred Taishan early glorysum is obviously reduced and the color of the fruit peel is redder compared with the non-transgenic Taishan early glorysum.
The results show that the apple transcription factor ERF17-8s (the number of continuous serine residues starting from the 12 th amino acid residue at the N terminal is 8), the apple transcription factor ERF17-6s (the number of continuous serine residues starting from the 12 th amino acid residue at the N terminal is 6) and the apple transcription factor ERF17-3s (the number of continuous serine residues starting from the 12 th amino acid residue at the N terminal is 3) have the functions of promoting chlorophyll degradation in apple pericarp, enhancing the red color characteristic of the apple pericarp and promoting apple fruit ripening.
<110> university of agriculture in China
<120> application of serine residue number in apple transcription factor ERF17
<160>10
<170>PatentIn version 3.5
<210>1
<211>25
<212>DNA
<213>Artificial sequence
<400>1
ctttcactgc atgtcaaacc acttc 25
<210>2
<211>26
<212>DNA
<213>Artificial sequence
<400>2
ctctagaaat tccagaggaa agactc 26
<210>3
<211>708
<212>DNA
<213> cultivation of apple 'Red Fuji' (Malus domestica Borkh cv. 'Red Fuji')
<400>3
atgtcaaacc acttctccaa aatctttgat acgtcgtcgt cgtcgtcgtc gtcgtccatg 60
ctgaaccaga cgagcgggga gccctccgag cgaaacgacg tcaagtacaa gggcgtccgc 120
aagcgcaagt ggggcaaatg ggtgtcggaa atccgcctcc ccaactgccg cgagagaatc 180
tggttgggat cctatgacac gccagagaag gcggcgcgtg ccttcgacgc ggcactcttt 240
tgcttacgtg gtcgcaccgc caagtttaat ttccccgaca acccgccgga tattcctggg 300
ggaaggtcgc tgagccctgc cgagatccag gtcgaggcgg cgaggttcgc gaattcggag 360
attccgagga gccaccagtc gatgtcggcg ccgcaggctg agtgtcagtc catgtcggag 420
ttgcaggcgg agtctcagtc tccgtccctg tcggagggca gtgggaccgc cttcatggac 480
actgattttc aagtgactcc aaacgagtcg ctttcggacc tgtttggttc attcgggtcg 540
ggttattacg ccacggagta cggtttgttt ccgggatttg atgaaatgaa cggtcagttt 600
ttcagtccag catcggcggc gccaacgccg gccgttgatt acgtggaaga gaacttggac 660
ggtcagtttt tcaatccggc ccaggagtct ttcctctgga atttctag 708
<210>4
<211>702
<212>DNA
<213> cultivation of apple 'Red Fuji' (Malus domestica Borkh cv. 'Red Fuji')
<400>4
atgtcaaacc acttctccaa aatctttgat acgtcgtcgt cgtcgtcgtc catgctgaac 60
cagacgagcg gggagccctc cgagcgaaac gacgtcaagt acaagggcgt ccgcaagcgc 120
aagtggggca aatgggtgtc ggaaatccgc ctccccaact gccgcgagag aatctggttg 180
ggatcctatg acacgccaga gaaggcggcg cgtgccttcg acgcggcact cttttgctta 240
cgtggtcgca ccgccaagtt taatttccccgacaacccgc cggatattcc tgggggaagg 300
tcgctgagcc ctgccgagat ccaggtcgag gcggcgaggt tcgcgaattc ggagattccg 360
aggagccacc agtcgatgtc ggcgccgcag gctgagtgtc agtccatgtc ggagttgcag 420
gccgagtctc agtctccgtc cctgtcggag ggcagtggga ccgccttcat ggacactgat 480
tttcaagtga ctccaaacga gtcgctttcg gacttgtttg gttcattcgg gtcgggtaat 540
tacgccacgg agtacggttt gtttccggga tttgatgaaa tgaacggtca gtttttcagt 600
ccagcatcgg cggcaccaac gccggccgtt gattacgcgg aagagaactt ggacggtcag 660
tttttcaatc cggcccagga gtctttcctc tggaatttct ag 702
<210>5
<211>235
<212>PRT
<213> cultivation of apple 'Red Fuji' (Malus domestica Borkh cv. 'Red Fuji')
<400>5
Met Ser Asn His Phe Ser Lys Ile Phe Asp Thr Ser Ser Ser Ser Ser
1 5 10 15
Ser Ser Ser Met Leu Asn Gln Thr Ser Gly Glu Pro Ser Glu Arg Asn
20 25 30
Asp Val Lys Tyr Lys Gly Val Arg Lys Arg Lys Trp Gly Lys Trp Val
35 40 45
Ser Glu Ile Arg Leu Pro Asn Cys Arg Glu Arg Ile Trp Leu Gly Ser
50 55 60
Tyr Asp Thr Pro Glu Lys Ala Ala Arg Ala Phe Asp Ala Ala Leu Phe
65 70 75 80
Cys Leu Arg Gly Arg Thr Ala Lys Phe Asn Phe Pro Asp Asn Pro Pro
85 90 95
Asp Ile Pro Gly Gly Arg Ser Leu Ser Pro Ala Glu Ile Gln Val Glu
100 105 110
Ala Ala Arg Phe Ala Asn Ser Glu Ile Pro Arg Ser His Gln Ser Met
115 120 125
Ser Ala Pro Gln Ala Glu Cys Gln Ser Met Ser Glu Leu Gln Ala Glu
130 135 140
Ser Gln Ser Pro Ser Leu Ser Glu Gly Ser Gly Thr Ala Phe Met Asp
145 150 155 160
Thr Asp Phe Gln Val Thr Pro Asn Glu Ser Leu Ser Asp Leu Phe Gly
165 170 175
Ser Phe Gly Ser Gly Tyr Tyr Ala Thr Glu Tyr Gly Leu Phe Pro Gly
180 185 190
Phe Asp Glu Met Asn Gly Gln Phe Phe Ser Pro Ala Ser Ala Ala Pro
195 200 205
Thr Pro Ala Val Asp Tyr Val Glu Glu Asn Leu Asp Gly Gln Phe Phe
210 215 220
Asn Pro Ala Gln Glu Ser Phe Leu Trp Asn Phe
225 230 235
<210>6
<211>233
<212>PRT
<213> cultivation of apple 'Red Fuji' (Malus domestica Borkh cv. 'Red Fuji')
<400>6
Met Ser Asn His Phe Ser Lys Ile Phe Asp Thr Ser Ser Ser Ser Ser
1 5 10 15
Ser Met Leu Asn Gln Thr Ser Gly Glu Pro Ser Glu Arg Asn Asp Val
20 25 30
Lys Tyr Lys Gly Val Arg Lys Arg Lys Trp Gly Lys Trp Val Ser Glu
35 40 45
Ile Arg Leu Pro Asn Cys Arg Glu Arg Ile Trp Leu Gly Ser Tyr Asp
50 55 60
Thr Pro Glu Lys Ala Ala Arg Ala Phe Asp Ala Ala Leu Phe Cys Leu
65 70 75 80
Arg Gly Arg Thr Ala Lys Phe Asn Phe Pro Asp Asn Pro Pro Asp Ile
85 90 95
Pro Gly Gly Arg Ser Leu Ser Pro Ala Glu Ile Gln Val Glu Ala Ala
100 105 110
Arg Phe Ala Asn Ser Glu Ile Pro Arg Ser His Gln Ser Met Ser Ala
115 120 125
Pro Gln Ala Glu Cys Gln Ser Met Ser Glu Leu Gln Ala Glu Ser Gln
130 135 140
Ser Pro Ser Leu Ser Glu Gly Ser Gly Thr Ala Phe Met Asp Thr Asp
145 150 155 160
Phe Gln Val Thr Pro Asn Glu Ser Leu Ser Asp Leu Phe Gly Ser Phe
165 170 175
Gly Ser Gly Asn Tyr Ala Thr Glu Tyr Gly Leu Phe Pro Gly Phe Asp
180 185 190
Glu Met Asn Gly Gln Phe Phe Ser Pro Ala Ser Ala Ala Pro Thr Pro
195 200 205
Ala Val Asp Tyr Ala Glu Glu Asn Leu Asp Gly Gln Phe Phe Asn Pro
210 215 220
Ala Gln Glu Ser Phe Leu Trp Asn Phe
225 230
<210>7
<211>696
<212>DNA
<213> Shaguo 'Zisaiming bead' (Malus asiatica Nakai, cv. 'Zisai Pearl')
<400>7
atgtcaaacc acttctccaa aatctttgat acgtcgtcgt ccatgctgaa ccagacgagc 60
ggggagccct ccgagcgaaa cgacgtcaag tacaagggcg tccgcaagcg caagtggggc 120
aaatgggtgt cggaaatccg cctccccaac tgccgcgaga gaatctggtt gggatcctat 180
gacacgccag agaaggcggc gcgtgccttc gacgcggcac tcttttgctt acgtggtcgc 240
accgccaagt ttaatttccc cgacaacccg ccggatattc ctgggggaag gtcgctgagc 300
ccttccgaga tccaggtcga ggcggcgagg ttcgcgaatt cggagattcc gaggagccac 360
cagtcgatgt cggcgccgca ggctgagtgt cagtccatgt cggagttgca ggcggagtct 420
cagtctccgt ccctgtcgga gggcagtggg accgccttca tggacactga ttttcaagtg 480
actccaaacg agtcgctttc ggacctgttt ggttcattcg ggtcgggtaa ttacgccacg 540
gagtacggtt tgtttccggg atttgatgaa atgaacggtc agtttttcag tccagcatcg 600
gcggcgccaa ccccggccgt tgattactac gcggaagaga acttggacgg tcagtttttc 660
aatccggacc aggagtcttt cctctggaat ttctag 696
<210>8
<211>231
<212>PRT
<213> Shaguo 'Zisaiming bead' (Malus asiatica Nakai, cv. 'Zisai Pearl')
<400>8
Met Ser Asn His Phe Ser Lys Ile Phe Asp Thr Ser Ser Ser Met Leu
1 5 10 15
Asn Gln Thr Ser Gly Glu Pro Ser Glu Arg Asn Asp Val Lys Tyr Lys
20 25 30
Gly Val Arg Lys Arg Lys Trp Gly Lys Trp Val Ser Glu Ile Arg Leu
35 40 45
Pro Asn Cys Arg Glu Arg Ile Trp Leu Gly Ser Tyr Asp Thr Pro Glu
50 55 60
Lys Ala Ala Arg Ala Phe Asp Ala Ala Leu Phe Cys Leu Arg Gly Arg
65 70 75 80
Thr Ala Lys Phe Asn Phe Pro Asp Asn Pro Pro Asp Ile Pro Gly Gly
85 90 95
Arg Ser Leu Ser Pro Ser Glu Ile Gln Val Glu Ala Ala Arg Phe Ala
100 105 110
Asn Ser Glu Ile Pro Arg Ser His Gln Ser Met Ser Ala Pro Gln Ala
115 120 125
Glu Cys Gln Ser Met Ser Glu Leu Gln Ala Glu Ser Gln Ser Pro Ser
130 135 140
Leu Ser Glu Gly Ser Gly Thr Ala Phe Met Asp Thr Asp Phe Gln Val
145 150 155 160
Thr Pro Asn Glu Ser Leu Ser Asp Leu Phe Gly Ser Phe Gly Ser Gly
165 170 175
Asn Tyr Ala Thr Glu Tyr Gly Leu Phe Pro Gly Phe Asp Glu Met Asn
180 185 190
Gly Gln Phe Phe Ser Pro Ala Ser Ala Ala Pro Thr Pro Ala Val Asp
195 200 205
Tyr Tyr Ala Glu Glu Asn Leu Asp Gly Gln Phe Phe Asn Pro Asp Gln
210 215 220
Glu Ser Phe Leu Trp Asn Phe
225 230
<210>9
<211>15
<212>DNA
<213>Artificial sequence
<400>9
atgtcaaacc acttc 15
<210>10
<211>17
<212>DNA
<213>Artificial sequence
<400>10
gaaattccag aggaaag 17
Claims (11)
1. A method for predicting the degradation rate of chlorophyll of apple peel to be detected comprises the following steps: detecting the number of continuous serine residues of an apple transcription factor ERF17 of the peel of the apple to be detected from the 12 th amino acid residue at the N tail end;
the pericarp chlorophyll degradation rate of the to-be-detected apple with the apple transcription factor ERF17 of 8 continuous serine residues starting from the 12 th amino acid residue at the N terminal and/or the apple transcription factor ERF17 of 6 continuous serine residues starting from the 12 th amino acid residue at the N terminal is higher than that of the to-be-detected apple with the apple transcription factor ERF17 of 3 continuous serine residues starting from the 12 th amino acid residue at the N terminal.
2. A method for predicting the degradation rate of chlorophyll of apple peel to be detected comprises the following steps: detecting whether an apple transcription factor ERF17 of the peel of the apple to be detected is an apple transcription factor ERF17-8s, an apple transcription factor ERF17-6s or an apple transcription factor ERF17-3 s; the peel chlorophyll degradation rate of the to-be-detected apples with the apple transcription factor ERF17 being the apple transcription factor ERF17-8s and/or the apple transcription factor ERF17-6s is larger than that of the to-be-detected apples with the apple transcription factor ERF17 being the apple transcription factor ERF17-3 s;
the apple transcription factor ERF17-8s is a protein with an amino acid sequence shown as a sequence 5 in a sequence table;
the apple transcription factor ERF17-6s is a protein with an amino acid sequence shown as a sequence 6 in a sequence table;
the apple transcription factor ERF17-3s is protein with the amino acid sequence shown in sequence 8 in the sequence table.
3. A method for predicting the degradation rate of chlorophyll of apple peel to be detected comprises the following steps: detecting the number of codons for continuously coding serine at the 12 th codon in the transcript of the total RNA of the peel of the apple to be detected; the transcript is RNA obtained by transcription of an encoding gene of an apple transcription factor ERF17, and the 1 st codon of the transcript is an initiation codon;
the pericarp chlorophyll degradation rate of the apple to be detected is higher than that of the apple to be detected, wherein the apple to be detected has the characteristic that the codons for continuously coding serine at the beginning of the 12 th codon in the transcript are 8 and/or the codons for continuously coding serine at the beginning of the 12 th codon in the transcript are 6.
4. A method for predicting the degradation rate of chlorophyll of apple peel to be detected comprises the following steps: detecting the number of codons for continuously encoding serine from the 12 th codon of the coding gene of the apple transcription factor ERF17 in the total DNA of the peel of the apple to be detected;
the pericarp chlorophyll degradation rate of the to-be-detected apple is higher than that of the to-be-detected apple, wherein the to-be-detected apple is that the codons for continuously coding serine at the beginning of the 12 th codon of the coding gene of the apple transcription factor ERF17 in the total pericarp DNA are 8 and/or the codons for continuously coding serine at the beginning of the 12 th codon of the coding gene of the apple transcription factor ERF17 in the total pericarp DNA are 6.
5. A method for predicting the degradation rate of chlorophyll of apple peel to be detected comprises the following steps: extracting total RNA of the peel of the apple to be detected and carrying out reverse transcription to obtain cDNA, carrying out PCR amplification by adopting a specific primer pair, and detecting a PCR amplification product;
the pericarp chlorophyll degradation rate of the apple to be detected, which has the DNA molecule shown in the sequence 3 and the DNA molecule shown in the sequence 4 in the PCR amplification product, is higher than that of the apple to be detected, which does not have the DNA molecule shown in the sequence 3, does not have the DNA molecule shown in the sequence 4 and has the DNA molecule shown in the sequence 7 in the PCR amplification product;
the specific primer pair consists of a primer F and a primer R;
the primer F is a single-stranded DNA molecule shown in a sequence 9 of a sequence table;
the primer R is a single-stranded DNA molecule shown in a sequence 10 of a sequence table.
6. The application of the substance A, the substance B or the substance C in predicting the chlorophyll degradation rate of the apple peel to be detected;
the substance A is used for detecting the number of continuous serine residues of the apple transcription factor ERF17 from the 12 th amino acid residue at the N terminal of the apple peel;
the substance B is used for detecting the number of codons for continuously coding serine at the 12 th codon in the transcript of the apple peel total RNA; the transcript is RNA obtained by transcription of an encoding gene of an apple transcription factor ERF17, and the 1 st codon of the transcript is an initiation codon;
and the substance C is used for detecting the number of codons for continuously coding serine at the 12 th codon of an encoding gene of an apple transcription factor ERF17 in the total DNA of the apple peel to be detected.
7. The application of the complete product A, the complete product B or the complete product C in predicting the chlorophyll degradation rate of the apple peel to be detected;
the kit A is the substance A in claim 6 and a carrier recorded with the method A;
the method A comprises the following steps: the pericarp chlorophyll degradation rate of the to-be-detected apple with the apple transcription factor ERF17 of 8 continuous serine residues starting from the 12 th amino acid residue at the N terminal and/or the apple transcription factor ERF17 of 6 continuous serine residues starting from the 12 th amino acid residue at the N terminal is higher than that of the to-be-detected apple with the apple transcription factor ERF17 of 3 continuous serine residues starting from the 12 th amino acid residue at the N terminal;
the kit B is the substance B and a carrier describing the method B in claim 6;
the method B comprises the following steps: the pericarp chlorophyll degradation rate of the apple to be detected is higher than that of the apple to be detected, wherein the apple to be detected has the '8 codons for continuously coding serine at the beginning of the 12 th codon in the transcript and/or 6 codons for continuously coding serine at the beginning of the 12 th codon in the transcript'; the transcript is RNA obtained by transcription of an encoding gene of an apple transcription factor ERF17, and the 1 st codon of the transcript is an initiation codon;
the kit C is the substance C in claim 6 and a carrier describing the method C;
the method C comprises the following steps: the pericarp chlorophyll degradation rate of the to-be-detected apple is higher than that of the to-be-detected apple, wherein the to-be-detected apple is that the codons for continuously coding serine at the beginning of the 12 th codon of the coding gene of the apple transcription factor ERF17 in the total pericarp DNA are 8 and/or the codons for continuously coding serine at the beginning of the 12 th codon of the coding gene of the apple transcription factor ERF17 in the total pericarp DNA are 6.
8. The application of the number of continuous serine residues of the apple transcription factor ERF17 from the 12 th amino acid residue at the N terminal of the apple pericarp as a detection object in predicting the chlorophyll degradation rate of the apple pericarp to be detected.
9. The application of the number of codons for continuously coding serine at the 12 th codon in the transcript of the apple pericarp total RNA as a detection object in predicting the chlorophyll degradation rate of the apple pericarp to be detected; the transcript of the apple pericarp total RNA is RNA obtained by transcription of an encoding gene of an apple transcription factor ERF 17.
10. The application of the number of codons continuously encoding serine from the 12 th codon of the coding gene of the apple transcription factor ERF17 in the total DNA of apple pericarp as a detection object in predicting the chlorophyll degradation rate of the apple pericarp to be detected.
11. The application of the coding gene of the apple transcription factor ERF17 and/or the apple transcription factor ERF17 is to promote the chlorophyll degradation in apple peel by transferring the coding gene of the apple transcription factor ERF17-8s, the coding gene of the apple transcription factor ERF17-6s or the coding gene of the apple transcription factor ERF17-3 s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711009930.3A CN109709332B (en) | 2017-10-25 | 2017-10-25 | Application of serine residue number in apple transcription factor ERF17 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711009930.3A CN109709332B (en) | 2017-10-25 | 2017-10-25 | Application of serine residue number in apple transcription factor ERF17 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109709332A CN109709332A (en) | 2019-05-03 |
| CN109709332B true CN109709332B (en) | 2020-10-27 |
Family
ID=66252146
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711009930.3A Active CN109709332B (en) | 2017-10-25 | 2017-10-25 | Application of serine residue number in apple transcription factor ERF17 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109709332B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007127206A1 (en) * | 2006-04-26 | 2007-11-08 | Colorado State University Research Foundation | Biological systems input-output: response system and plant sentinels |
| CN104774849A (en) * | 2015-04-06 | 2015-07-15 | 浙江大学 | Critical ethylene response factor (ERF) for regulating and controlling orange peel chlorophyll removal and application of critical ERF |
| CN106047890A (en) * | 2016-06-12 | 2016-10-26 | 浙江大学 | Key ethylene response factor for regulating chlorophyll degradation of citrus peels |
-
2017
- 2017-10-25 CN CN201711009930.3A patent/CN109709332B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007127206A1 (en) * | 2006-04-26 | 2007-11-08 | Colorado State University Research Foundation | Biological systems input-output: response system and plant sentinels |
| CN104774849A (en) * | 2015-04-06 | 2015-07-15 | 浙江大学 | Critical ethylene response factor (ERF) for regulating and controlling orange peel chlorophyll removal and application of critical ERF |
| CN106047890A (en) * | 2016-06-12 | 2016-10-26 | 浙江大学 | Key ethylene response factor for regulating chlorophyll degradation of citrus peels |
Non-Patent Citations (2)
| Title |
|---|
| AP2 domain class transcription factor [Malus domestica];Tacken,E. et al.;《GenBank ADE41099.1》;20100506;序列表及其说明 * |
| Malus x domestica AP2 domain class transcription factor (AP2D6) mRNA, complete cds;Tacken,E. et al.;《GenBank GU732430.1》;20100506;序列表及其说明 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109709332A (en) | 2019-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113337635B (en) | Chinese wolfberry gene and its coding protein, recombinant vector and use | |
| CN107686840A (en) | Pears transcription factor PyERF3 and its recombinant expression carrier and application | |
| CN108822194B (en) | Plant starch synthesis related protein OsFLO10, and coding gene and application thereof | |
| CN101280006B (en) | Protein related to tolerance to Fe deficiency of plant, coding genes and application thereof | |
| CN111909941B (en) | Lily transcription factor gene LrWRKY-L1 and application thereof | |
| CN112608928B (en) | Longan single fruit weight character regulatory gene DlCNR8, protein and application thereof | |
| CN112143746B (en) | Gene GmAP5 for improving disease resistance of plants and application thereof | |
| CN114807068B (en) | Acetaldehyde dehydrogenase gene DkALDH10 and application thereof | |
| CN113024648A (en) | Heat shock transcription factor ZmHsf05 of corn and application thereof | |
| CN101208430A (en) | Method of constructing plant having nodules with high nitrogen fixation activity | |
| CN109709332B (en) | Application of serine residue number in apple transcription factor ERF17 | |
| CN101302523A (en) | Application of physiological clock regulation protein LHY to stress-tolerant plant cultivation | |
| CN114214332B (en) | Tianmu rehmannia anthocyanin related gene RcMYB1 and application thereof | |
| CN107267525B (en) | Application of panax notoginseng polygalacturonase inhibitor protein gene PnPGIP | |
| CN107937358A (en) | A kind of GAP-associated protein GAP TaPaO1 for inducing plant pollen abortion and its encoding gene and application | |
| CN114836437A (en) | Application of peony PsMYB4 gene in changing color and size of plant petal color spot | |
| CN109971772B (en) | Breeding method of low-temperature-resistant cotton variety | |
| CN109055394B (en) | Peach transcription factor PpHB G7 gene, protein, recombinant expression vector and application thereof | |
| CN112608938A (en) | Application of OsAO2 gene in controlling drought resistance of rice | |
| CN107176983B (en) | Application of protein PpLEA3-3 in regulation and control of plant stress resistance | |
| CN108690847B (en) | Application of protein nog1 in regulation and control of plant yield and grain number per ear | |
| CN110592106A (en) | Molecular marker Lb14-3-3c gene and application thereof | |
| CN112724210A (en) | Plant amyloplast development related protein OsSSG7 and coding gene and application thereof | |
| CN110387430B (en) | Method for predicting apple fruit hardness based on variety of 225 th amino acid residue of apple transcription factor ERF4 | |
| CN114605514B (en) | Application of protein VvANN1 in improving drought resistance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |