CN109055394B - Peach transcription factor PpHB G7 gene, protein, recombinant expression vector and application thereof - Google Patents

Abstract

The invention discloses a peach transcription factor PpHB.G7, belonging to HB family members, wherein the nucleotide sequence is shown as a sequence table SEQ ID NO.1, the length of a coding region sequence is 936bp, 311 amino acids are coded, and the amino acid sequence is shown as a sequence table SEQ ID NO. 2. The expression level of PpHB. G7 gene in the fruit mature period is higher than that in the fruit mature early period. Biological function verification shows that the cloned PpHB.G7 gene has the function of promoting ethylene biosynthesis. The discovery of the PpHB. G7 gene provides a new gene resource for promoting molecular breeding of ethylene biosynthesis and a new genetic resource for implementing green agriculture, and the development and utilization of the resource are beneficial to improving the commodity value and market competitiveness of peach fruits, prolonging the shelf life of the fruits, reducing the agricultural cost and realizing environmental friendliness.

Description

Peach transcription factor PpHB G7 gene, protein, recombinant expression vector and application thereof

Technical Field

The invention relates to a peach transcription factor PpHB.G7 gene, a protein, a recombinant expression vector and application thereof, belonging to the field of plant genetic engineering.

Background

Fruit ripening refers to a complex and ordered series of physiological and biochemical reactions occurring after growth and development of fruits stop, and relates to aspects such as color, flavor, aroma, texture and the like, and the fruit ripening directly affects commodity value, postharvest storage and market competitiveness of fruits (Giovannoni et al, 2004; L i et al, 2010; Tianshiping, 2013). fruit ripening has extensive research in tomatoes, apples, bananas, peaches and the like.

Transcription Factors (TF) are important regulatory factors in organisms and play a crucial role in plant growth and morphogenesis (Populus Vetivum et al, 2004), which can activate or inhibit the Transcription effect of genes, regulate the expression of genes, or respond to environmental stress and hormone induction, etc. (L iu et al, 2010; Sungyu, 2013). the Transcription factors generally consist of 4 functional regions of DNA binding regions, Transcription regulatory regions (including activation or suppression regions), nuclear localization signals, and oligomerization sites.A Transcription factor regulates the expression of genes by the functional regions acting with promoter cis-elements or interacting with functional regions of other Transcription factors (Liuqiang et al, 2000). according to the difference in DNA binding domains, the Transcription factors can be classified into MADS-box domains, leucine zipper domains (L, L Z), basic helix-loop-helix domains (bH 25H), zinc domains (395932, HD-5932, MYiF/387 domains, etc.; 3. the Transcription factors can be classified into MADS-box domains (L, 389-387 domains).

The Homeobox (Homeobox, HB) protein contains a typical Homeodomain (HD), which mainly contains a conserved DNA sequence, is 183bp in length and encodes 61 amino acid residues (Mukherjee K et al, 2006). according to the characteristics of the position, association with other domains and gene structure of the homeodomain, the HB family is divided into HD-Zip, PHD, BE LL, WOX, KNOX, DDT and SAWADEE family (F.D. ariel et al, 2007; A.Bhattacharjee, et al, 2015; K.Mukherjee al,2009) and Vollbrecht, etc. and a gene motif (E.Voronated-1, Knotted-1) related to the maize leaf node mutation exists in a homologous Homeobox-related DNA motif (E.Voronox, 1991) related to the growth of the maize (embryo), growth promoting gene of the growth of the somatic embryo, growth, development, etc. for example, development.

The HD-ZIP family comprises four subfamilies I, II, III and IV, all genes containing leucine zipper domain and having similar functional effects to the other families (F.D. Ariel et al, 2007; A.Bhattacharjee, et al, 2015; K.Mukherjee et al, 2009). in the HD-ZIP I subfamily, Arabidopsis thaliana AtHB1, AtHB3, AtHB13, AtHB20 and AtHB23 have a modulating leaf development effect (T.Aoyama et al,1995), AtHB4, AtHB6, AtHB7 and AtHB12 can respond to abiotic stress (C.2006.Dezar et al, 2005; A.Olsson et al, 2004; E.Soderman et al) in the HD-ZIP II subfamily, sunflower HB10 (Shhb 10) promotes early stage development of Arabidopsis thaliana (HD.2005; PHS.Olsson et al, HD-III, H.2005) and in the other subfamily, PHABhP II subfamily, PHABD.IV, PHB-H-III family, PHB, III family, JOB, and ABHB-JG, have a direct inducing effects on the development of the stem type of the leaf.

The research firstly carries out phylogenetic tree construction and gene expression analysis on the HB gene in peach fruits to screen candidate genes related to fruit ripening, after qRT-PCR identification, the candidate genes are transiently transformed into peach fruits at the early stage of ripening, and the gene functions are evaluated by measuring the expression level and ethylene yield of the genes related to fruit ripening.

Disclosure of Invention

The invention aims to provide a transcription factor PpHB.G7 gene for promoting ethylene biosynthesis, which belongs to HB family members, the nucleotide sequence of the gene is shown as a sequence table SEQ ID NO.1, the length of a coding region sequence CDS is 936bp, 311 amino acids are coded, the coded amino acid sequence is shown as a sequence table SEQ ID NO.2, the isoelectric point is 6.09, and the molecular weight is 35.04 KD.

The invention also provides a recombinant expression vector containing the PpHB.G7 gene.

The recombinant expression vector preferably takes pCAMBIA1301 as a starting vector, and the insertion point of the PpHB. G7 gene is between Xbal and HindIII.

The invention also provides a host bacterium containing the PpHB.G7 gene and a primer pair for cloning the cDNA sequence of the PpHB.G7 gene, wherein the sequence of an upstream primer PpHB.G7-F1 is shown as SEQ ID NO.3, and the sequence of a downstream primer PpHB.G7-R1 is shown as SEQ ID NO. 4.

Another purpose of the invention is to provide the application of the gene.

The application of the PpHB. G7 gene in promoting peach ethylene synthesis is included.

And the application of the recombinant expression vector in promoting the synthesis of the peach ethylene.

And (3) constructing a phylogenetic tree by software analysis and combining transcriptome data and carrying out qRT-PCR analysis on related genes.

The PpHB.G7 is related to the ethylene biosynthesis by utilizing the qRT-PCR technical analysis.

The overexpression and silencing of PpHB.G7 are respectively increased and reduced by constructing an overexpression vector and a silencing vector of PpHB.G7, and the expression level and the ethylene yield of PpACS1 and PpACO1 genes are respectively increased and reduced by the agrobacterium-mediated transient transformation of peach fruits.

The interaction relationship of the PpHB.G7 genes, the PpACS1 genes and the PpACO1 genes is analyzed by using a dual-luciferase reporter gene system, and the result shows that the promoter interaction of the PpHB.G7 genes, the PpACS1 genes and the PpACO1 genes is realized.

Single hybrid analysis using yeast revealed that pphb. g7 mediates its expression by a promoter that binds PpACS1 and PpACO 1.

Compared with the prior art, the invention has the following advantages and effects:

the discovery of the PpHB. G7 gene provides a new gene resource for promoting molecular breeding of ethylene synthesis and a new genetic resource for implementing green agriculture, the development and utilization of the resource are beneficial to providing the commodity value of peach fruits, prolonging the shelf life of the fruits, reducing the agricultural cost and realizing environmental friendliness.

Drawings

FIG. 1 is an HB gene family map, and 398 HB genes are divided into two classes I and II, which are 5 groups (A to E) and 2 groups (F and G), respectively. Further divided into 67 clusters in addition to group D, A1 → A20, B1, B2, C1 → C3, E1 → E13, F1 → F10 and G1 → G19, respectively.

Fig. 2A is a heat map analysis of two varieties of nanshan sweet peach and morning glory, two genes pphb.g2 and ppb.g 7 are expressed higher during fruit ripening than during fruit development, while five genes pphb.a11, pphb.e1, pphb.e12, pphb.e13 and pphb.f4 are expressed at the lowest level during fruit ripening.

Fig. 2B shows that differences in expression amounts of pphb.a11, pphb.e12, and pphb.e13 were not significant at the stages of lithification (S2), precocity (S3), and maturation (S4), while other four genes pphb.g2, pphb.g7, pphb.e1, and pphb.f4 had expression patterns similar to the transcriptome sequencing data.

FIG. 3 shows 11 HB genes of the HD-ZIP I (G9 → G19) subfamily.

FIG. 4 shows 8 HB genes of the HD-ZIP II (G1 → G8) subfamily.

FIG. 5 shows that the expression level of PpHB.G7 in 10 peach varieties is higher in the mature period of fruits. The expression level of PpHB. G2 in most varieties is slightly different between the early mature period and the mature fruit period of the fruit.

FIG. 6A is a schematic diagram of analysis of ethylene release amount after the peach fruit is infected with the cloned gene PpHB.G7 overexpression and silencing vector of the present invention through agrobacterium transient transformation.

FIG. 6B is a qRT-PCR expression analysis chart of PpHB.G7, PpACS1 and PpACO1 after the peach fruit is infected by the cloned gene PpHB.G7 overexpression and silencing vector of the invention through agrobacterium transient transformation. The lower case letters a, b, c represent significant differences in P values < 0.05.

FIG. 7A is a dual-luciferase reporter gene system analyzing the regulation effect of cloned gene PpACS. G7 on PpACS1 and PpACO1 promoters, the expression amount of L UC gene driven by PpACS1 and PpACO1 promoters in Arabidopsis protoplasts is higher than that of a control group, and the lowercase letters a and b represent the significant difference of P value < 0.05.

FIG. 7B shows the results of yeast single hybrid experiments, which indicate that fragment 1 and fragment 2 of the promoter of the cloned gene PpHB. G7 and PpACS1 interact.

FIG. 7C shows the results of yeast single hybrid experiments, which indicate that fragment 3 and fragment 4 of the promoter of the cloned gene PpHB. G7 and PpACO1 interact with each other.

Detailed Description

The present invention will be described in detail with reference to specific examples. From the following description and examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

Example 1 identification of HB families of peach and other fruit trees

A large number of HB genes were isolated from the peach genome (1 st edition), and the nucleotide and amino acid sequences thereof were downloaded from a Rosaceae genome database (GDR; http:// www.rosaceae.org /), and the obtained amino acid sequences were screened to obtain members of the HB family in the peach genome while searching and downloading all of the HB family members from gene libraries such as pear (Pyrus bretscheieri; http:// pearlgenome. n jau. edu. cn /), raspberry ((Rubus occidentalis; GDR), strawberry (Fragaria × anassassa), Citrus (Citrus sinensis), grape (Vitis vinifera), papaya (Carica payaya) and the like.

Example 2 sequence and phylogenetic Tree analysis

The amino acid sequences of the genes after screening described above were downloaded and aligned by the cultal X approach, using the software MEGA6 to construct phylogenetic trees based on the megaweighted adjacency (NJ) the 70 HB genes were isolated from the peach genome and constructed together with the HB genes in pear, strawberry, citrus, papaya and grape the phylogenetic trees results show that 398 genes can BE divided into two classes I and II with 5 groups (a-E) and 2 groups (F and G) respectively (fig. 1) which, in addition to the D group, were further divided into 67 clusters, a1 → a20, B1, B2, C1 → C3, E1 → E13, F1 → F10 and G1 → g19.ncbi sequence alignment results show that the a group contains three previously reported families L (a → a11), a12 a → D (PHD → G29) and G1 → 19.ncbi, which contain the previously reported three families known as the ad 9, cd 42, cd-9, cd 42, cd-9, cd 7, cd 7, and cd 7, I.

TABLE 1 clustering code naming table of 70 HB genes in peach

Example 3 expression Profile of HB Gene in peach fruit

According to transcriptome data, 10 varieties of Baixianglu, Zao Baifeng, late garden honey, Chunmei, Xiahui No.2, Yuhualu, Chunxue, Baifeng, lake Jing honey dew and Xiahui No. 6 are adopted, and the expression levels of 70 genes are analyzed on the transcriptome levels of the fruit development stage (S1-S3) and the maturity stage (S4). The results show that: two genes pphb.g2 and pphb.g7 were expressed during fruit ripening higher than during fruit development, while five genes pphb.a11, pphb.e1, pphb.e12, pphb.e13 and pphb.f4 were expressed at the lowest level during fruit ripening (fig. 2A). In order to verify the expression quantity of the 7 genes, the expression level of the 7 genes in the development stage and the mature stage of the peach fruit of Zhongyou No.4 is detected by adopting a qRT-PCR technology. The results showed that the differences in the expression levels of pphb.a11, pphb.e12 and pphb.e13 were not significant in the stone hardening (S2), pre-ripening (S3) and ripening (S4) stages. The other four genes pphb.g2, pphb.g7, pphb.e1, pphb.f4 had similar expression patterns to the transcriptome sequencing data (fig. 2B). Therefore, the four genes PpHB.G2, PpHB.G7, PpHB.E1 and PpHB.F4 in peach fruit are probably related to fruit ripening.

Example 4 verification of PpHB.G7 involvement in fruit ripening

L eHB-1 has been reported to be involved in the regulation of tomato fruit ripening (Z.F. L in et al,2008), but the peach HB gene in the HD-ZIPI subfamily (G9 → G19) (fig. 3) is clearly not related to fruit ripening (fig. 2). the pp hb.g2(Ppa007421m) and pp.g 7(Ppa008984m (fig. 4) of the HD-ZIP II subfamily may be involved in the ripening of peach fruits.

Example 5PpHB.G7 Gene isolation cloning and vector construction

1. A plant total RNA extraction kit (purchased from TIANGEN company, according to the kit instructions) for extracting RNA from peach pulp is adopted, and the first strand cDNA obtained by reverse transcription is used for amplifying the full length of PpHB.G7 gene. 50ul of the reaction system included 2ul of the above primers, 17ul of ddH₂O, 25ul 2 × Buffer,1ul dNTP,2ul cDNA template, 1ul high-securityEuzyme (Phanta Super-Fidelity DNA Polymerase) (available from Vazyme). The PCR reaction was performed on an eppendor PCR amplificator according to the following procedure: pre-denaturation at 95 ℃ for 3 min, denaturation at 95 ℃ for 30 sec, annealing at 60 ℃ for 30 sec, extension at 72 ℃ for 1 min, 30 thermal cycles, extension at 72 ℃ for 10 min and extension at 20 ℃ for 5 min after completion of the cycles.

2. The PCR product is subjected to 1% agarose gel electrophoresis, the generated target band is recovered according to the operation of an AxyPrep DNA gel recovery kit, the purified PCR product and pCAMBIA1301 which is subjected to double enzyme digestion by XbaI and HindIII are recovered through recombinase (purchased from Vazyme company), a recombinant system is operated according to the operation of a one-step cloning recombinant kit, the recombinant product is transformed into Escherichia coli DH5 by a heat shock method (refer to molecular cloning laboratory Manual, third edition, scientific publishing agency, 2002), the Escherichia coli DH5 is uniformly coated on an L B solid plate containing 50 mg/L kanamycin, positive clones are screened, 6 positive clones are selected for sequencing, and the sequencing result shows that the amplified target fragment is 936bp in length, the nucleotide sequence of the amplified fragment is shown in a sequence table SEQ ID NO.1, and the sequence is determined to be the target gene required by the invention through sequence comparison and analysis.

Example 6 construction of PpHB. G7 Gene overexpression and silencing vector

1. XbaI and HindIII were selected as the endonucleases based on the multiple cloning site of the PSAK277 vector and the restriction site analysis on the coding region sequence of the PpHB.G7 gene. Primers with restriction sites were designed according to the general primer design principle using Primer5.0 software, and the sequences of the primer pairs are shown below:

PpHB.G7-F1：tttaagcTTAGAGAGAGATGAGTTTTGATGAAG(SEQ ID NO.3)

PpHB.G7-R1：ttttctagaTTTAGCAAGCTGTAGATGGATGGGT(SEQ ID NO.4)

taking the correctly sequenced extracted plasmid of the preserved bacterial liquid as a template to clone the gene containing the restriction endonuclease site. The annealing temperature for PCR amplification was 60 ℃ and the PCR reaction system and amplification procedure were the same as in example 1. The PSAK277 vector was double digested with two enzymes (from NEB) with an overall digestion rate of 50 ul: vector plasmid 5ul, CutSmart Buffer 5ul, XbaI and HindIII 1ul each, ddH₂Placing O38 ul. in a medium at 37 ℃ for enzyme digestion for 3-4 hours, purifying the enzyme digestion product by using an AxyPrep cleaning kit (the operation process is carried out according to the instruction), recombining and connecting the PCR product and the purified double enzyme digestion product, converting escherichia coli DH5 alpha, uniformly coating the product on a L B solid plate containing 50 mg/L kanamycin, screening positive clones, extracting plasmids for enzyme digestion and PCR identification, determining a sequencing result to ensure that no frame reading mutation exists, obtaining a recombinant vector containing an insertion fragment, and introducing the recombinant plasmid into agrobacterium EHA105 by using a freeze-thaw method, wherein the recombinant vector is named as a super-expression vector pCAMBIA 1301-PpHB.G7.

2. KpnI and EcoRI were selected as endonucleases based on the multiple cloning site of the TRV vector and the restriction site analysis on the coding region sequence of the PpHB.G7 gene. The method for designing the primer and the method for constructing the TRV-PpHB.G7 silencing vector are the same as the above. And the silencing vector plasmid is transferred into agrobacterium GV3101 by an electric excitation method.

Designing a primer with an enzyme cutting site, wherein the sequence of a primer pair is shown as follows:

TRV-F2：ACCGAATTCACACCACCCTCAATCCCAAGC (SEQ ID NO.5)

TRV-R2：CTCGGTACCTTTAGCAAGCTGTAGATGGATGGGT (SEQ ID NO.6)

example 7 transient transformation of peach fruit

1. Respectively picking single agrobacterium colony containing over-expression vector PSAK277-PpHB. G7 in a liquid culture medium containing kanamycin and rifampicin resistance, and single agrobacterium colony containing silent vector TRV-PpHB. G7 in a liquid culture medium containing spectinomycin and rifampicin resistance, and simultaneously taking agrobacterium containing empty vector PSAK277 and TRV1+ TRV2 as a control. Culturing at 28 deg.C and 220rpm for 24-48 h. Then, each Agrobacterium was grown in a Erlenmeyer flask containing 40ml of liquid medium to an OD600 of 0.8-1.0. The centrifuge was centrifuged at 5000g for 10 min at 4 ℃ and the supernatant was discarded to collect the inoculum and resuspended in the invader (10mM Mgcl2,10mM MES, pH 5.7,200. mu.M acetosyringone), 5000g was centrifuged for 10 min and the supernatant was discarded to collect the inoculum and repeated once. And finally suspending and placing the mixture in a TY-200S shaking table (Nanjing Puyang) for 3 hours at 60rpm and standing for 1 hour.

2. The bacterial liquids are taken and injected with No. 8 peach fruit Charysophora by a 1ml injector 7 days before the commodity is harvested. All analyses were obtained by three biological replicates, each containing at least four peach fruits.

Example 8 ethylene measurement

Ethylene emissions from each infested fruit were measured using an ethylene probe (purchased from Shenzhen pril electococo technologies, Inc.). At least six infected peach fruits were placed individually in a 3 liter closed tank for 3 hours at room temperature, and then the tank was sealed with a cork and the gas was transferred with a hose. After zero calibration of the ethylene detector, the probe was connected to a hose to receive the released gas. The yield of ethylene released was determined and the concentration was displayed on a monitor. The results show that the release amount of ethylene from peach fruits injected with the pphb.g7 overexpression vector is higher than that of ethylene from peach fruits injected with the pphb.g7 silencing vector (fig. 6A), and the results show that pphb.g7 has the effect of promoting ethylene synthesis.

Example 9qRT-PCR analysis of expression levels of PpHB. G7, PpACS1 and PpACO1 in transiently transformed peach fruits

qRT-PCR detection of bacterially covered pulp was performed by means of a Total RNA extraction kit from polyphenolic polysaccharides (available from TIANGEN, according to the kit instructions) from the pulp of the infected peaches in case 3, and the cDNA was obtained by reverse transcription in L ittCycler 480II/96 thermocycling, the kit was L htCycler 480SYBR Green I Master and the qPCR 96 well plate were provided by Roche, the qPCR reaction system was SYBR Green I Master 10ul, ddH₂04 ul, forward primer 2.5ul, reverse primer 2.5ul, cDNA 1 ul. The reaction program comprises denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 30s and 45 cycles. All analyses were done in three independent biological replicates. The peach Ppa008668m gene is used as an internal reference gene. All primer sequences are in table 2. The qRT-PCR results showed that the expression levels of PpACS1 and PpACO1 were increased in the flesh injected with the PpAHB. G7 overexpression vector, and the expression levels of PpACS1 and PpACO1 were decreased in the flesh injected with the PpAHB. G7 silencing vector (FIG. 6B). These results indicate that pphb.g7 can mediate ethylene biosynthesis by stimulating the activity of PpACS1 and PpACO1。

Example 10 protoplast isolation and Dual luciferase assay

1. The ACS and ACO promoter codon upstream 2000bp sequence is amplified from peach pulp, the amplified product is inserted into PGRI L II 0800-L UC vector, and two vectors of PGRI L II 0800-L UC-ACS and PGRI L II 0800-L UC-ACO are constructed, the method for constructing the vector is the same as that in embodiment 2.

The sequence of the amplification primer is

PpACS1-F：tgggtaccTGCAGTATGTCCGTTCCTTGGC (SEQ ID NO.7)

PpACS1-R：tcaagcttGGTTCCAAAGAATACTCACACACAAG (SEQ ID NO.8)

PpACO1-F：tgggtaccAAGAGACATATCAGGTGATGAAAGAACG (SEQ ID NO.9)

PpACO1-R：tcaagcttGTGAAGTGGAGTTTGGTGTGG (SEQ ID NO.10)

2. Protoplasts extracted from 3 to 5 week old plants illuminated 8 hours per day. The recombinant plasmid was transferred to protoplast and cultured in dark for 18 hours. Use of Dual luciferases

The reported analysis system (purchased from PROMEGA) processed the recombinant plasmid-transferred protoplasts (specified according to the kit instructions) and fluorescence intensity measurements were performed using a microplate reader, measurements were performed in three independent experiments, each with three biological replicates (n ═ 9), the results showed that pphb.g7 and PpACS1, the promoter of PpACO1 gene interacted, and the pacts 1 and pacao 1 promoter-driven L UC gene was expressed in higher amounts in arabidopsis protoplasts than in the control group (fig. 7A).

Example 11 Yeast Monohybrid

2 sequences of about 2000bp are cloned from ACS and ACO gene promoters cloned from peach pulp. And the promoter is divided into small fragments which are respectively connected with the pAbAi vector. Meanwhile, the full-length sequence of the isolated pphb. g7 gene was inserted into pGADT7 vector. The yeast single hybrid (Y1H) assay was performed using a yeast single hybrid library screening system. The results indicate that pphb.g7 mediates its expression by binding the promoters of PpACS1 and ppaco.a1 (fig. 7B, C). All primers are listed in table 2.

TABLE 2 primer sequence List

Reference to the literature

[1]Giovannoni,J.J.Genetic regulation of fruit development andripening.Plant Cell 16Suppl.suppl_1(2003):S170.

[2]Xian Li,Changjie Xu,Schuyler S.Korban.Regulatory Mechanisms ofTextural Changes in Ripening Fruits.Critical Reviews in Plant Sciences 29.4(2010):222-243.

[3] Tianshiping, molecular regulation mechanism of fruit ripening and senescence, plant bulletin 48.5(2013):481-488.

[4]Jean‐Marc Lelièvre,Alain Latchè,Brian Jones,Mondher Bouzayen,Jean‐Claude Pech.Ethylene and fruit ripening.Physiologia Plantarum 101.4(2006):727-739.

[5] The research progress of higher plant transcription factors of Yangrong, Wangxingchun, Liximing, inheritance 26.3(2004): 403-.

[6]Liu L,White M J,Macrae T H.Transcription factors and their genesin higher plants functional domains,evolution and regulation.[J].EuropeanJournal of Biochemistry,2010,262(2):247-257,Febs Journal 262.2(2010):247-257.

[7] Gene cloning of HB transcription factor family of rice, OsHB40, function preliminary study of OsHB102, Dis, Jilin university, 2013

[8] Liu Qiang, Zhang Gui you. "the structure and regulation of plant transcription factor". The scientific report 45.14(2000): 1465-.

[9]Jingdong Liu,Thomas E.Wilson,Jeffrey Milbrandt."Identifying DNA-Binding Sites and Analyzing DNA-Binding Domains Using a Yeast SelectionSystem."Methods5.2(1993):125–137.

[10]Mukherjee,K,and T.R.Bürglin."MEKHLA,a novel domain withsimilarity to PAS domains,is fused to plant homeodomain-leucine zipper IIIproteins."Plant Physiology 140.4(2006):1142-1150.

[11]F.D.Ariel,P.A.Manavella,C.A.Dezar,R.L.Chan,The true story of theHD-Zip family,Trends Plant Sci.12(2007)419-426.

[12]A.Bhattacharjee,R.Ghangal,R.Garg,M.Jain,Genome-wide analysis ofhomeobox gene family in legumes:identification,gene duplication andexpression profiling,Plos One 10(2015)e0119198.

[13]K.Mukherjee,L.Brocchieri,T.R.Burglin,A comprehensiveclassification and evolutionary analysis of plant homeobox genes,Mol.Biol.Evol.26(2009)2775-2794.

[14]E.Vollbrecht,B.Veit,N.Sinha,S.Hake,The developmental geneKnotted-1is a member of a maize homeobox gene family,Nature 350(1991)241-243

[15]E.Shani,Y.Burko,L.Ben-Yaakov,Y.Berger,Z.Amsellem,A.Goldshmidt,E.Sharon,N.Ori,Stage-specific regulation of Solanum lycopersicum leafmaturation by class 1KNOTTED1-LIKE HOMEOBOX proteins,Plant Cell 21(2009)3078-3092.

[16]E.Belles-Boix,O.Hamant,S.M.Witiak,H.Morin,J.Traas,V.Pautot,KNAT6:an Arabidopsis homeobox gene involved in meristem activity and organseparation,Plant Cell 18(2006)1900-1907.

[17]A.T.Groover,S.D.Mansfield,S.P.DiFazio,G.Dupper,J.R.Fontana,R.Millar,Y.Wang,The Populus homeobox gene ARBORKNOX1reveals overlappingmechanisms regulating the shoot apical meristem and the vascular cambium,Plant Mol.Biol.61(2006)917-932.

[18]S.P.Venglat,T.Dumonceaux,K.Rozwadowski,L.Parnell,V.Babic,W.Keller,R.Martienssen,G.Selvaraj,R.Datla,The homeobox gene BREVIPEDICELLUSis a key regulator of inflorescence architecture in Arabidopsis,Proc NatlAcad Sci USA 99(2002)4730-4735.

[19]J.Du,S.D.Mansfield,A.T.Groover,The Populus homeobox geneARBORKNOX2regulates cell differentiation during secondary growth,Plant J.60(2009)1000-1014

[20]G.Mele,N.Ori,Y.Sato,S.Hake,The knotted1-like homeobox geneBREVIPEDICELLUS regulates cell differentiation by modulating metabolicpathways,Genes Dev,17(2003)2088-2093.

[21]T.Sakamoto,H.Sakakibara,M.Kojima,Y.Yamamoto,H.Nagasaki,Y.Inukai,Y.Sato,M.Matsuoka,Ectopic expression of KNOTTED1-like homeobox proteininduces expression of cytokinin biosynthesis genes in rice,Plant Physiol.142(2006)54-62.

[22]F.M.Rosin,J.K.Hart,H.T.Horner,P.J.Davies,D.J.Hannapel,Overexpression of a knotted-like homeobox gene of potato alters vegetativedevelopment by decreasing gibberellin accumulation,Plant Physiol.132(2003)106-117.

[23]M.E.Byrne,A.T.Groover,J.R.Fontana,R.A.Martienssen,Phyllotacticpattern and stem cell fate are determined by the Arabidopsis homeobox geneBELLRINGER,Dev.130(2003)3941-3950.

[24]C.Gomez-Mena,R.Sablowski,ARABIDOPSIS THALIANA HOMEOBOXGENE1establishes the basal boundaries of shoot organs and controls stemgrowth,Plant Cell 20(2008)2059-2072

[25]S.Kanrar,M.Bhattacharya,B.Arthur,J.Courtier,H.M.Smith,Regulatorynetworks that function to specify flower meristems require the function ofhomeobox genes PENNYWISE and POUND-FOOLISH in Arabidopsis,Plant J.54(2008)924-937.

[26]M.Proveniers,B.Rutjens,M.Brand,S.Smeekens,The Arabidopsis TALEhomeobox gene ATH1 controls floral competency through positive regulation ofFLC,Plant J.52(2007)899-913.

[27]N.A.Horst,A.Katz,I.Pereman,E.L.Decker,N.Ohad,R.Reski,A singlehomeobox gene triggers phase transition,embryogenesis and asexualreproduction,Nat.Plants 2(2016)15209.

[28]M.Dai,Y.Hu,Y.Zhao,H.Liu,D.X.Zhou,A WUSCHEL-LIKE HOMEOBOX generepresses a YABBY gene expression required for rice leaf development,PlantPhysiol.144(2007)380-390.

[29]M.Nakata,N.Matsumoto,R.Tsugeki,E.Rikirsch,T.Laux,K.Okada,Roles ofthe middle domain-specific WUSCHEL-RELATED HOMEOBOX genes in earlydevelopment of leaves in Arabidopsis,Plant Cell 24(2012)519-535.

[30]X.Wu,T.Dabi,D.Weigel,Requirement of homeobox gene STIMPY/WOX9 forArabidopsis meristem growth and maintenance,Curr.Biol.15(2005)436-440.

[31]Y.Hirakawa,Y.Kondo,H.Fukuda,TDIF peptide signaling regulatesvascular stem cell proliferation via the WOX4 homeobox gene in Arabidopsis,Plant Cell 22(2010)2618-2629.

[32]M.Romera-Branchat,J.J.Ripoll,M.F.Yanofsky,S.Pelaz,The WOX13homeobox gene promotes replum formation in the Arabidopsis thaliana fruit,Plant J.73(2013)37-49.

[33]Y.Zhao,Y.Hu,M.Dai,L.Huang,D.X.Zhou,The WUSCHEL-related homeoboxgene WOX11 is required to activate shoot-borne crown root development inrice,Plant Cell 21(2009)736-748.

[34]S.Cheng,D.X.Zhou,Y.Zhao,WUSCHEL-related homeobox geneWOX11increases rice drought resistance by controlling root hair formation androot system development,Plant Signal Behav.11(2016)e1130198.

[35]T.Aoyama,C.H.Dong,Y.Wu,M.Carabelli,G.Sessa,I.Ruberti,G.Morelli,N.H.Chua,Ectopic expression of the Arabidopsis transcriptional activatorAthb-1 alters leaf cell fate in tobacco,Plant Cell 7(1995)1773-1785.

[36]C.A.Dezar,G.M.Gago,D.H.Gonzalez,R.L.Chan,Hahb-4,a sunflowerhomeobox-leucine zipper gene,is a developmental regulator and confers droughttolerance to Arabidopsis thaliana plants,Transgenic Res.14(2005)429-440

[37]A.S.Olsson,P.Engstrom,E.Soderman,The homeobox genes ATHB12 andATHB7 encode potential regulators of growth in response to water deficit inArabidopsis,Plant Mol.Biol.55(2004)663-677.

[38]E.Soderman,M.Hjellstrom,J.Fahleson,P.Engstrom,The HD-Zip geneATHB6in Arabidopsis is expressed in developing leaves,roots and carpels andup-regulated by water deficit conditions,Plant Mol.Biol.40(1999)1073-1083.

[39]E.C.Rueda,C.A.Dezar,D.H.Gonzalez,R.L.Chan,Hahb-10,a sunflowerhomeobox-leucine zipper gene,is regulated by light quality and quantity,andpromotes early flowering when expressed in Arabidopsis,Plant Cell Physiol.46(2005)1954-1963.

[40]K.Ohashi-Ito,H.Fukuda,HD-zip III homeobox genes that include anovel member,ZeHB-13(Zinnia)/ATHB-15(Arabidopsis),are involved in procambiumand xylem cell differentiation,Plant Cell Physiol.44(2003)1350-1358.

[41]S.P.Grigg,C.Galinha,N.Kornet,C.Canales,B.Scheres,M.Tsiantis,Repression of apical homeobox genes is required for embryonic rootdevelopment in Arabidopsis,Curr.Biol.19(2009)1485-1490.

[42]B.Shen,K.W.Sinkevicius,D.A.Selinger,M.C.Tarczynski,The homeoboxgene GLABRA2 affects seed oil content in Arabidopsis,Plant Mol.Biol.60(2006)377-387.

[43]]C.Gu,L.Wang,W.Wang,H.Zhou,B.Ma,H.Zheng,T.Fang,C.Ogutu,S.Vimolmangkang,Y.Han,Copy number variation of a gene cluster encodingendopolygalacturonase mediates flesh texture and stone adhesion in peach,J.Exp.Bot.67(2016)1993-2005.

[44]J.García-Andrade,V.Ramírez,V.Flors,P.Vera,Arabidopsis ocp3 mutantreveals a mechanism linking ABA and JA to pathogen-induced callosedeposition,Plant J.67(2011)783-794.

[45]V.Ramírez,A.Coego,A.López,A.Agorio,V.Flors,P.Vera,Droughttolerance in Arabidopsis is controlled by the OCP3 disease resistanceregulator,Plant J.58:(2009a)578-591.

[46]V.Ramírez,S.Van der Ent,J.García-Andrade,A.Coego,C.M.Pieterse,P.Vera,OCP3 is an important modulator of NPR1-mediated jasmonic acid-dependent induced defenses in Arabidopsis,BMC Plant Biol.10(2009b)199.

Sequence listing

<110> agricultural science and academy of Jiangsu province

<120> peach transcription factor PpHB G7 gene, protein, recombinant expression vector and application thereof

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>936

<212>DNA

<213> Biluo (Prunus persica)

<400>1

atgagttttg atgaagcttg taacaccggc cttggtctca gtctaggctg ccgtgacagc 60

ccagatcatg accatacaaa tttgcaggct cctcctgatc atcatcatca ccatcaccaa 120

aacacgtaca agaacaagca aatacagttg aaatatgatc acctattgcc ttctcttacg 180

ctcggcccat cggctgcttc aaagattgag gaggccgagt ccactgattt gcaccaggca 240

gtagccgcac aggaacagga ctcttctccc tgcagcggcg ccttttcatc tttttctaac 300

tcgtcaagtt tcaagaggga cagagagttg ggaggtgaag agatagaggt agaggtagag 360

gtagaggtag aggtagagga agagagagtg gtgaatatta cttcctcaag agcaagcgag 420

gagttatatg aacaagatca tgagggcagc cccagaaaga agctcaggct ttcaaaagaa 480

caatctgcca ctttggaaga cagcttcaga gaacacacca ccctcaatcc caagcaaaag 540

caagacctgg caagaaagct aaatctacgg ccgcgacaag tggaagtctg gttccaaaac 600

aggagggcca ggaccaagtt gaagcaaact gaagcggatt gtgagttgtt gaaaaagtgt 660

tgtgagacgc tgaaagaaga gaacagaagg ctacacaagg agctgcaaga gctcaagtta 720

atgaaacaaa cggcaacagc agcagcagca gtaccaccct tttacatgca gtttccaaca 780

gccactctca ccatgtgccc ttcttgtgag aaaatctgca acggcggtga ccaccataat 840

catcatgggt cgtcgacgag ttcttttttg attggatcga agccggctca cttgatcttc 900

aaccccttta gcacccatcc atctacagct tgctaa 936

<210>2

<211>311

<212>PRT

<213> Biluo (Prunus persica)

<400>2

Met Ser Phe Asp Glu Ala Cys Asn Thr Gly Leu Gly Leu Ser Leu Gly

1 5 10 15

Cys Arg Asp Ser Pro Asp His Asp His Thr Asn Leu Gln Ala Pro Pro

20 25 30

Asp His His His His His His Gln Asn Thr Tyr Lys Asn Lys Gln Ile

35 40 45

Gln Leu Lys Tyr Asp His Leu Leu Pro Ser Leu Thr Leu Gly Pro Ser

50 55 60

Ala Ala Ser Lys Ile Glu Glu Ala Glu Ser Thr Asp Leu His Gln Ala

65 70 75 80

Val Ala Ala Gln Glu Gln Asp Ser Ser Pro Cys Ser Gly Ala Phe Ser

85 90 95

Ser Phe Ser Asn Ser Ser Ser Phe Lys Arg Asp Arg Glu Leu Gly Gly

100 105 110

Glu Glu Ile Glu Val Glu Val Glu Val Glu Val Glu Val Glu Glu Glu

115 120 125

Arg Val Val Asn Ile Thr Ser Ser Arg Ala Ser Glu Glu Leu Tyr Glu

130 135 140

Gln Asp His Glu Gly Ser Pro Arg Lys Lys Leu Arg Leu Ser Lys Glu

145 150 155 160

Gln Ser Ala Thr Leu Glu Asp Ser Phe Arg Glu His Thr Thr Leu Asn

165 170 175

Pro Lys Gln Lys Gln Asp Leu Ala Arg Lys Leu Asn Leu Arg Pro Arg

180 185 190

Gln Val Glu Val Trp Phe Gln Asn Arg Arg Ala Arg Thr Lys Leu Lys

195 200 205

Gln Thr Glu Ala Asp Cys Glu Leu Leu Lys Lys Cys Cys Glu Thr Leu

210 215 220

Lys Glu Glu Asn Arg Arg Leu His Lys Glu Leu Gln Glu Leu Lys Leu

225 230 235 240

Met Lys Gln Thr Ala Thr Ala Ala Ala Ala Val Pro Pro Phe Tyr Met

245 250 255

Gln Phe Pro Thr Ala Thr Leu Thr Met Cys Pro Ser Cys Glu Lys Ile

260 265 270

Cys Asn Gly Gly Asp His His Asn His His Gly Ser Ser Thr Ser Ser

275 280 285

Phe Leu Ile Gly Ser Lys Pro Ala His Leu Ile Phe Asn Pro Phe Ser

290 295 300

Thr His Pro Ser Thr Ala Cys

305 310

<210>3

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tttaagctta gagagagatg agttttgatg aagc 34

<210>4

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ttttctagat ttagcaagct gtagatggat gggt 34

<210>5

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

accgaattca caccaccctc aatcccaagc 30

<210>6

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ctcggtacct ttagcaagct gtagatggat gggt 34

<210>7

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

tgggtacctg cagtatgtcc gttccttggc 30

<210>8

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

tcaagcttgg ttccaaagaa tactcacaca caag 34

<210>9

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

tgggtaccaa gagacatatc aggtgatgaa agaacg 36

<210>10

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

tcaagcttgt gaagtggagt ttggtgtgg 29

Claims (2)

1. The application of the gene PpHB.G7 in promoting ethylene synthesis, wherein the nucleotide sequence of the gene PpHB.G7 is shown as SEQ ID NO. 1.
2. Application of the recombinant expression vector of the PpHB.G7 gene in promoting ethylene synthesis.

Images