CN109055394A - Peach transcription factor PpHB G7 gene, albumen, its recombinant expression carrier and application - Google Patents

Abstract

The invention discloses peach transcription factor PpHB.G7, belong to HB family member, and nucleotides sequence is classified as shown in sequence table SEQ ID NO.1, and coding region sequence length is 936bp, encode 311 amino acid, and amino acid sequence is shown in sequence table SEQ ID NO.2.PpHB.G7 gene is higher than the expression quantity in fruit maturation early period in the expression quantity of fructescence.Through biological function verification, show that the PpHB.G7 gene that the present invention clones has the function of promoting Synthesis pathway.The discovery of PpHB.G7 gene, to promote the molecular breeding of Synthesis pathway to provide new genetic resources, new genetic resources is provided to implement green agriculture, the advantageous commodity value and the market competitiveness for improving Peach fruits of the development and utilization of the resource, the shelf life of extending fruit advantageously reduces agricultural cost and realizes environmental-friendly.

Description

Peach transcription factor PpHB G7 gene, albumen, its recombinant expression carrier and application

Technical field

The present invention relates to peach transcription factor PpHB.G7 gene, albumen, its recombinant expression carrier and applications, belong to plant base Because of engineering field.

Background technique

Fruit maturation refers to a series of orderly biochemical reactions of the complexity occurred after fruit development stopping, relates to And the various aspects such as color, flavor, fragrance, quality, and fruit maturation directly influence the commodity value of fruit, adopt after store and The market competitiveness.(Giovannoni et al,2004；Li et al,2010；Tian Shiping, 2013).Fruit maturation tomato, There is extensive research in apple, banana, peach etc..Whether there is climacteric in maturation according to fruit, is divided into and exhaling Inhale transition type and non-respiratory transition type (Leli E Vre J, 1997).It, can be adjoint in ripening of fruits for transition type fruit A large amount of ethylene evolution, and exogenous ethylene processing can promote fruit maturation.

Transcription factor (Transcription factor, TF) is regulatory factor important in organism, in plant growth There is vital effect (Yang Zhirong etc., 2004) in terms of development and morphogenesis, turning for gene can be activated or inhibited Effect is recorded, adjusts the expression of gene, or response environment-stress and hormone induction etc. (Liu et al., 2010；Sun Yu, 2013).Transcription factor is generally by the combined area DNA, transcription regulatory region (including active region or inhibition zone), nuclear localization signal and oligomerization Change 4, site function section composition.Transcription factor acted on by these functional areas and promoter cis element or with other turns The functional area interaction for recording the factor carrys out the expression (Liu Qiang etc., 2000) of controlling gene.Not according to DNA binding function domain Together, transcription factor can be divided into following a few classes: MADS-box structural domain, leucine zipper motif (Leucine zipper, LZ), bHLH domain (bHLH), zinc-finger structural domain, MYB structural domain, AP2/ERF structural domain, same Source abnormal shape domain (HD) etc. (Liu J et al, 1993；Liu L et al, 2010).

Homeotic box (Homeobox, HB) albumen contains typical homeodomain (Homedomain, HD), Mainly containing one section of conservative DNA sequence dna, length 183bp, encode 61 amino acid residues (Mukherjee K et al, 2006).According to the position of homeodomain, with other structures domain be associated with and the features such as gene structure, HB family is divided into HD-Zip, PHD, BELL, WOX, KNOX, DDT and SAWADEE family (F.D.Ariel et al, 2007； A.Bhattacharjee, et al, 2015；K.Mukherjee et al, 2009).Vollbrecht etc. is cloned in corn Be mutated related gene Knotted-1 with corn leaf segment to one, in Knotted-1 there are one section with it is reported homologous different The DNA motif (E.Vollbrecht et al, 1991) of flask very high homology.Gene in KNOX family participates in adjusting leaf development (E.Shani et al, 2009), meristematic activity (E.Belles-Boix, 2006；A.T.Groover, 2006) flower, is participated in The formation (S.P.Venglat et al, 2002) of sequence structure, cell differentiation (J.Du, S.D.Mansfield, et al, 2009； G.Mele, et al, 2003) and promote the basic element of cell division and gibberellin accumulation (T.Sakamoto et al, 2006； F.M.Rosin et al, 2003).Gene in BELLl family and Stem nematode (M.E.Byrne et al, 2003；C.Gomez- Mena et al, 2008), flower development (S.Kanrar et al, 2008；M.Proveniers et al, 2007), embryo occurs It is related with vegetative propagation (N.A.Horst, 2016).In addition, the gene in WOX gene family also assisted in leaf development (M.Dai, 2007；M.Nakata, 2012) it, adjusts meristematic activity (X.Wu et al, 2005), promote cell Proliferation (Y.Hirakawa, 2010) influences the raw crown root hair of embry ogenesis (M.Romera-Branchat et al, 2003), bud of fruit Educate (Y.Zhao et al, 2009) and stress defence capability (S.Cheng et al, 2016).

HD-ZIP family includes four subfamilies I, II, III and IV, and all genes all contain leucine zipper motif, And with other families have similar function (F.D.Ariel et al, 2007；A.Bhattacharjee, et al, 2015；K.Mukherjee et al, 2009).It is reported that in HD-ZIP I subfamily, arabidopsis AtHB1, AtHB3, AtHB13, AtHB20 and AtHB23 have a development effect (T.Aoyama et al, 1995) for adjusting leaf, AtHB4, AtHB6, AtHB7 and AtHB12 can respond abiotic stress (C.A.Dezar et al, 2005；A.S.Olsson et al,2004； E.Soderman et al).In HD-ZIP II subfamily, sunflower HB10 (HAHB10) promotes arabidopsis early flowering (E.C.Rueda et al,2005).In HD-ZIP III, AtHB15 participates in the differentiation of procambia and tracheid (K.Ohashi-Ito et al, 2003), AtPHB and AtPHV directly induce shoot apical meristem development and lateral organ pole Property (S.P.Grigg et al, 2009).In HD-ZIP IV, ATGLABRA2 influence seed oil content (B.Shen et al, 2006).Obviously, work of the member in plant growth and development in addition to HD-ZIP-IV family, in other three HD-ZIP subfamilies It is Chong Die with having the function of with other families.

Currently, research of the HB gene in fruit development and maturation is very few, tomato LeHB-1 is only reported to fruit Mature adjustment effect.This research has carried out building and the gene expression analysis of phylogenetic tree to the HB gene in Peach fruits first Analysis, to filter out candidate gene relevant to fruit maturation.After qRT-PCR is identified, by candidate gene instantaneous conversion to maturation In the Peach fruits of early period, by measure fruit maturity related gene expression and ethylene yield, to its gene function into Row evaluation.Finally, having detected HB gene and Synthesis pathway Gene A CO and ACS with Dual-Luciferase and yeast one-hybrid method Promoter interaction.This research reports the HB gene in Peach fruits for the first time, for point for furtheing elucidate fruit maturation Sub- regulated and control network provides foundation.

Summary of the invention

It is an object of the present invention to provide a kind of transcription factor PpHB.G7 genes for promoting Synthesis pathway, belong to HB family Member, for nucleotide sequence as shown in sequence table SEQ ID NO.1, coding region sequence CDS length is 936bp, encodes 311 ammonia Base acid, the amino acid sequence of coding are sequence table SEQ ID NO.2, isoelectric point 6.09, molecular weight 35.04KD.

The present invention also provides the recombinant expression carriers for containing PpHB.G7 gene of the present invention.

The recombinant expression carrier is preferably the carrier that sets out, the insertion of the PpHB.G7 gene with pCAMBIA1301 Point is between Xbal and HindIII.

The present invention also provides the host strain containing PpHB.G7 gene of the present invention and clone are of the present invention The primer pair of the cDNA sequence of PpHB.G7 gene, upstream primer PpHB.G7-F1 sequence as shown in SEQ ID NO.3, draw by downstream Object PpHB.G7-R1 sequence is as shown in SEQ ID NO.4.

It is a further object of the present invention to provide the applications of the gene.

Promoting the application in peach ethylene synthase including PpHB.G7 gene.

And recombinant expression carrier is promoting the application in peach ethylene synthase.

Transcript profile data phylogenetic tree construction is analyzed and combined by software and qRT-PCR points are carried out to related gene Analysis.

It is analyzed using qRT-PCR technology, PpHB.G7 is related with Synthesis pathway.

PpHB.G7 overexpression vector and silent carrier are constructed, by showing in mediated by agriculture bacillus instantaneous conversion Peach fruits The overexpression and silencing of PpHB.G7 increases separately and reduces PpACS1, the expression and ethylene yield of PpACO1 gene.

PpHB.G7 and PpACS1 are analyzed using dual-luciferase reporter system, the interaction of PpACO1 gene, The result shows that the promoter of PpHB.G7 and PpACS1, PpACO1 gene interacts.

PpHB.G7 is disclosed using yeast one-hybrid analysis, and its table is mediated by the promoter in conjunction with PpACS1 and PpACO1 It reaches.

Compared with the prior art, the present invention has the following advantages and effects:

The discovery of PpHB.G7 gene, to promote the molecular breeding of ethylene synthase to provide new genetic resources, to implement green Agricultural provides new genetic resources, and developing and using for the resource favorably provides the commodity value of Peach fruits, extending fruit shelf life, It advantageously reduces agricultural cost and realizes environmental-friendly.

Detailed description of the invention

Fig. 1 is HB gene family map, and 398 HB genes are divided into two classes I and II, they are respectively 5 groups (A~E) With 2 groups (F and G).Further be divided into 67 clusters in addition to D group, be respectively A1 → A20, B1, B2, C1 → C3, E1 → E13, F1 → F10 and G1 → G19.

Fig. 2A is the thermal map analysis of two South Mountain sweet tea peach, morning sunlight Peach cultivars, and two genes PpHB.G2 and pPHB.G7 are in fruit During expression in during real mature is higher than fruit development, and five gene PpHB.A11, PpHB.E1, PpHB.E12, PpHB.E13 and PpHB.F4 expression during fruit maturation is minimum.

Fig. 2 B is PpHB.A11, PpHB.E12, PpHB.E13 in stone matter hardening (S2), pre-cooked (S3), mature (S4) stage Expression difference is not significant, and other four genes PpHB.G2, PpHB.G7, PpHB.E1, PpHB.F4 and transcript profile are sequenced Data have similar expression pattern.

Fig. 3 is 11 HB genes of HD-ZIP I (G9 → G19) subfamily.

Fig. 4 is 8 HB genes of HD-ZIP II (G1 → G8) subfamily.

The expression quantity that Fig. 5 is PpHB.G7 in 10 Peach cultivars has higher expression fruit maturation is interim.More The expression quantity of PpHB.G2 slightly has difference between fruit maturation early period and ripening fruits phase in number kind.

Fig. 6 A is that clone gene PpHB.G7 of the present invention overexpression and silent carrier pass through Agrobacterium instantaneous conversion respectively and infect Acetate releasing quantity analyzes schematic diagram after Peach fruits.

Fig. 6 B is that clone gene PpHB.G7 of the present invention overexpression and silent carrier pass through Agrobacterium instantaneous conversion respectively and infect The qRT-PCR expression analysis figure of PpHB.G7 and PpACS1, PpACO1 after Peach fruits.Lowercase a, b, c represent P value < 0.05 significant difference.

Fig. 7 A is that dual-luciferase reporter system analyzes clone gene PpHB.G7 to PpACS1, PpACO1 promoter Adjustment effect, PpACS1 and PpACO1 promoter driving LUC gene in protoplasts of Arabidopsis thaliana broken by ultrasonic expression quantity be higher than control Group, lowercase a and b represent the significant difference of P value < 0.05.

Fig. 7 B is the miscellaneous experimental result of yeast list, shows the segment 1 and segment of clone gene PpHB.G7 and PpACS1 promoter 2 interactions.

Fig. 7 C is the miscellaneous experimental result of yeast list, shows the segment 3 and segment of clone gene PpHB.G7 and PpACO1 promoter 4 interactions.

Specific embodiment

The present invention is described in detail below in conjunction with specific embodiment.According to being described below and embodiment, this field Technical staff can determine essential characteristic of the invention, and without departing from the spirit and scope of the invention, can be right The present invention makes various changes and modifications, so that it is applicable in various uses and condition.

The identification of 1 peach of embodiment and other fruit tree HB families

A large amount of HB gene is isolated according to peach genome (the 1st edition), and from rosaceae genome database (GDR； Http:// www.rosaceae.org/) in download its nucleotide and amino acid sequence, amino acid sequence obtained is carried out Screening obtains the member of HB family in peach genome.Simultaneously to pears (Pyrus bretschneideri；http:// Peargenome.njau.edu.cn/), raspberry ((Rubus occidentalis；GDR), strawberry (Fragaria × Ananassa), citrus (Citrus sinensis), grape (Vitis vinifera), papaya (Carica papaya) etc. It is searched in gene pool and downloads all members of HB family.Finally all genes searched out are in National Center for Biotechnology Information (NCBI；Https: //www.ncbi.nlm.nih.gov) its homology is further compared in).

2 sequence of embodiment and phylogenetic tree analysis

It by the amino acid sequence downloading of gene after above-mentioned screening, and is aligned by Culstal X mode, uses software MEGA 6 buildings are based on the phylogenetic tree of million weighted adjacents (NJ).Be separated to 70 HB genes from peach genome, and by it with pears, Hb gene in strawberry, citrus, papaya and grape constructs systematic evolution tree together.The result shows that: 398 HB genes can be divided into Two classes I and II, they have 5 groups (A~E) and 2 groups (F and G) (Fig. 1) respectively.These genes in addition to D group further by It is divided into 67 clusters, is A1 → A20, B1, B2, C1 → C3, E1 → E13, F1 → F10 and G1 → G19 respectively.Sequence alignment in NCBI The result shows that A group includes three family BEL (A1 → A11), KNOX (A12 → A18) and the PHD (A19 and A20) reported in the past. C, D and F group is similar to DDT, SAWDEE and WOX family respectively.E group includes two subfamilies HD-ZIP III and IV, and G group includes HD-ZIP I and II.In addition (the J.Garc í a-Andrade et related to the defense function that ABA and JA is induced of the HB gene in B group al,2011；V.Ramírez,A et al,2009；V.Ramírez,S et al,2009).For the ease of to HB gene in peach The Hb gene that all 70 genes are based in cluster coding name (as shown in table 1), such as G7 cluster is named as by description pPHB.G7。

70 HB gene clusters coding name tables in 1 peach of table

Express spectra of the embodiment 3HB gene in Peach fruits

According to transcript profile data, using Bai Xianglu, early white phoenix, Chi Yuanmi, spring beauty, rosy clouds sunshine 2, rain liquid distilled from honeysuckle flowers or lotus leaves, spring snow, white No. 6 phoenix, lake scape honeydew, rosy clouds sunshine 10 kinds analyze 70 on fruit development period (S1-S3) and mature (S4) delayed early transcription level The expression of gene.The result shows that: two genes PpHB.G2 and PpHB.G7 during fruit maturation in expression be higher than fruit During real development, and five genes PpHB.A11, PpHB.E1, PpHB.E12, PpHB.E13 and PpHB.F4 are in fructescence Between expression it is minimum (Fig. 2A).In order to verify the expression quantity of this 7 genes, this 7 genes are had detected using qRT-PCR technology In the expression of middle oily No. 4 Peach fruits puberties and fructescence.The result shows that PpHB.A11, PpHB.E12, PpHB.E13 is not significant in stone matter hardening (S2), pre-cooked (S3), mature (S4) stage expression difference.And other four genes PpHB.G2, PpHB.G7, PpHB.E1, PpHB.F4 and transcript profile sequencing data have similar expression pattern (Fig. 2 B).Therefore, exist Tetra- genes of PpHB.G2, PpHB.G7, PpHB.E1 and PpHB.F4 may be related with fruit maturation in Peach fruits.

Embodiment 4 verifies PpHB.G7 and participates in fruit maturation

LeHB-1, which has been reported, takes part in the regulation (Z.F.Lin et al, 2008) of Fruit Ripening of Tomato, but HD-ZIP Peach HB gene (G9 → G19) (Fig. 3) in I subfamily is obviously (Fig. 2) uncorrelated to fruit maturation.HD-ZIP II subfamily (Ppa008984m (Fig. 4) may participate in the maturation of Peach fruits by PpHB.G2 (Ppa007421m) and PpHB.G7.In order to further test Demonstrate,prove the relationship of PpHB.G2, PpHB.G7 and Peach fruits maturation, the fruit of prematuration period and mature period to other 10 Peach cultivars QRT-PCR detection has been carried out in fact.Therefore, in all 10 Peach cultivars the expression quantity of PpHB.G7 fruit maturation it is interim have compared with High expression.And PpHB.G2 slightly has difference (figure in most kind expression quantity between fruit maturation early period and ripening fruits 5).The result shows that PpHB.G7 is related with Peach fruits maturation.

Embodiment 5PpHB.G7 Gene Isolation clone and vector construction

1, TIANGEN company (is purchased from, according to kit using the plant total RNA extraction reagent box of polyphenol polysaccharose substance Specification operation) extract RNA from the pulp of peach, the first chain cDNA obtained through reverse transcription is used to expand PpHB.G7 gene complete It is long.It include the above-mentioned primer of 2ul, 17ul ddH in the reaction system of 50ul₂O, 25ul 2 × Buffer, 1ul dNTP, 2ul CDNA template, 1ul high fidelity enzyme (Phanta Super-Fidelity DNA Polymerase) (are purchased from Vazyme company). PCR reaction on eppendor pcr amplification instrument by following procedure complete: 95 DEG C, initial denaturation 3 minutes, 95 DEG C be denaturalized 30 seconds, 60 DEG C annealing 30 seconds, 72 DEG C extended 1 minute, 30 thermal cycles, extended 10 minutes for 72 DEG C after the completion of circulation, 20 DEG C 5 minutes.

2, PCR product returns the purpose band of generation according to AxyPrep DNA gel after 1% agarose gel electrophoresis Receive kit specification operation recycling.PCR product after recovery purifying and XbaI and HindIII double digestion is used to complete PCAMBIA1301 is recombinated by recombinase (purchased from Vazyme company), recombinates system according to one-step cloning recombination kit Specification operation.By recombinant products using thermal shock method (referring to " molecular cloning experiment handbook " third edition, Science Press, 2002) Bacillus coli DH 5 ɑ is converted, is evenly coated on the LB solid plate containing 50mg/L card Na mycin, screening positive clone, picking 6 A positive colony sequencing.Sequencing result shows that the target fragment length that the present invention expands is 936bp, and nucleotides sequence is classified as sequence Shown in list SEQ ID NO.1.By sequence alignment analysis, determine that the sequence is the target gene that the present invention needs.

The building of embodiment 6PpHB.G7 gene overexpression and silent carrier

1, according to the restriction enzyme site on the coding region sequence of the multiple cloning sites of PSAK277 carrier and PpHB.G7 gene point Analysis, selects XbaI and HindIII as restriction endonuclease.Go out to have according to primer principle Primer5.0 software design is typically designed The primer of restriction enzyme site, primer pair sequence are as follows:

PpHB.G7-F1:tttaagcTTAGAGAGAGATGAGTTTTGATGAAG (SEQ ID NO.3)

PpHB.G7-R1:ttttctagaTTTAGCAAGCTGTAGATGGATGGGT (SEQ ID NO.4)

Bacterium solution extraction plasmid is correctly saved as template to be sequenced, and carries out gram containing restriction endonuclease sites gene It is grand.The annealing temperature of PCR amplification is 60 DEG C, and PCR reaction system and amplification program are the same as embodiment 1.PSAK277 carrier is used and two Enzyme (being purchased from NEB company) carries out double digestion, and digestion total system is 50ul: vector plasmid 5ul, CutSmart Buffer buffer 5ul, XbaI and HindIII each 1ul, ddH₂O 38ul.37 DEG C of digestions 3-4 hours are put in, digestion products are cleaned with AxyPrep and tried Agent box is purified.(operating process carries out to specifications).By PCR product and double enzyme digestion product recombination connection after purification, and Bacillus coli DH 5 ɑ is converted, is evenly coated on the LB solid plate containing 50mg/L kanamycins, screening positive clone, matter is extracted Grain carries out digestion and PCR identification, and sequencing result determines no reading frame mutation, obtains the recombinant vector containing Insert Fragment, will It is named as overexpression vector pCAMBIA1301-PpHB.G7.Recombinant plasmid is imported in Agrobacterium EHA105 using freeze-thaw method.

2, it is analyzed according to the restriction enzyme site on the coding region sequence of the multiple cloning sites of TRV carrier and PpHB.G7 gene, choosing KpnI and EcoRI are selected as restriction endonuclease.Design primer method and building TRV-PpHB.G7 silent carrier method are same as above.And it will Silent carrier plasmid is transferred in Agrobacterium GV3101 using electrization.

The primer with restriction enzyme site is designed, primer pair sequence is as follows:

TRV-F2:ACCGAATTCACACCACCCTCAATCCCAAGC (SEQ ID NO.5)

TRV-R2:CTCGGTACCTTTAGCAAGCTGTAGATGGATGGGT (SEQ ID NO.6)

The instantaneous conversion of 7 Peach fruits of embodiment

1, pick them separately the PSAK277-PpHB.G7 containing overexpression vector Agrobacterium single bacterium fall within it is containing kanamycin and sharp In the fluid nutrient medium of the flat resistance of good fortune, the Agrobacterium single bacterium of silent carrier TRV-PpHB.G7 falls within containing spectinomycin and Li Fu It in the fluid nutrient medium of flat resistance, while being control with the Agrobacterium of PSAK277 containing empty carrier and TRV1+TRV2.28 DEG C, 220rpm cultivates 24-48h.Then, each Agrobacterium is expanded to cultivate to OD600 in the triangular flask of the fluid nutrient medium containing 40ml and is 0.8-1.0.Under the conditions of 4 DEG C of centrifuge, 5000g is centrifuged 10 minutes, is abandoned supernatant and is collected bacterium solution, is then resuspended in infected liquid In (MES, pH=5.7,200 μM of acetosyringones of 10mM Mgcl2,10mM), 5000g, be centrifuged 10 minutes, abandon supernatant collect bacterium Liquid, and be repeated once.Finally being suspended with infected liquid, 60rpm shakes 3h per minute for placement TY-200S shaking table (the general sun in Nanjing), stands 1h。

2, it takes above-mentioned each bacterium solution to harvest first 7 days in commodity and injects Peach fruits rosy clouds sunshine 8 with 1ml syringe.All analyses It is all to repeat to obtain by three biology, each biology repeats to include at least four Peach fruits.

The measurement of 8 ethylene of embodiment

(Shenzhen Puli energization scarabaeidae is purchased from using the burst size of each fruit ethylene infected of ethylene detector measurement Skill Co., Ltd).It is small to be independently placed into one 3 liters of vapor tight tank 3 at least six Peach fruits infected at room temperature When, then jar is sealed with cork, conveys gas with hose.After carrying out zero calibration to ethylene detector, probe It is connect with hose to receive the gas of release.The ethylene yield of release is measured, and concentration is shown on a monitor.As the result is shown The burst size for injecting the Peach fruits ethylene of the overexpression vector containing PpHB.G7 is higher than the Peach fruits of injection silent carrier containing PpHB.G7 The burst size (Fig. 6 A) of ethylene, the results showed that PpHB.G7 has the function of promoting ethylene synthase.

Embodiment 9qRT-PCR analyzes the expression of PpHB.G7, PpACS1 and PpACO1 in instantaneous conversion Peach fruits

The pulp for taking bacterium to cover carries out qRT-PCR detection.Using the plant total RNA extraction reagent of polyphenol polysaccharose substance Box (being purchased from TIANGEN company, operate according to kit specification) extract RNA from the peach pulp infected in case 3, through anti- Transcription obtains cDNA.QRT-PCR is carried out in LigthtCycler 480II/96 thermal cycle.Kit is 96 orifice plate Jun You Roche company of LightCycler 480SYBR Green I Master and qPCR provides.QPCR reactant System: SYBR Green I Master 10ul, ddH₂0 4ul, forward primer 2.5ul, reverse primer 2.5ul, cDNA 1ul.Instead Answer program are as follows: 95 DEG C of denaturation 15s, 60 DEG C of annealing 30s, 45 recycle.All analyses have been repeated by three independent biology At.Peach Ppa008668m gene is as reference gene.All primer sequences are all in table 2.QRT-PCR contains in injection as the result is shown The expression quantity of PpACS1 and PpACO1 rises in the pulp of PpHB.G7 overexpression vector, in injection silent carrier containing PpHB.G7 The expression quantity of PpACS1 and PpACO1 declines (Fig. 6 B) in pulp.These results indicate that PpHB.G7 can be by stimulating PpACS1 Synthesis pathway is mediated with the activity of PpACO1.

10 protoplast electrofusion of embodiment and Dual-Luciferase measurement

1, ACS and ACO promoter codon upstream 2000bp sequence is expanded from peach pulp, amplified production is inserted into In PGRILII0800-LUC carrier, and construct two carriers of PGRILII0800-LUC-ACS and PGRILII0800-LUC-ACO. The method of carrier construction is the same as case study on implementation 2.

Amplimer sequence is

PpACS1-F:tgggtaccTGCAGTATGTCCGTTCCTTGGC (SEQ ID NO.7)

PpACS1-R:tcaagcttGGTTCCAAAGAATACTCACACACAAG (SEQ ID NO.8)

PpACO1-F:tgggtaccAAGAGACATATCAGGTGATGAAAGAACG (SEQ ID NO.9)

PpACO1-R:tcaagcttGTGAAGTGGAGTTTGGTGTGG (SEQ ID NO.10)

2, the protoplast extracted in the plant of the daily illumination 8 hours of from 3 to 5 week old.Recombinant plasmid is transferred to primary Plastid dark culture 18 hours.Use Dual-LuciferaseReport analysis system (be purchased from PROMEGA company) is to being transferred to recombination matter The protoplast of grain is handled and (is carried out according to kit specification concrete operations), is carried out carrying out fluorescence intensity inspection with microplate reader It surveys.It is measured in three independent tests, each three biology of test repeat (n=9).The result shows that PpHB.G7 and The promoter of PpACS1, PpACO1 gene interacts, and the LUC gene of pPACS1 and pPACO1 promoter driving is in arabidopsis original Expression quantity is higher than control group (Fig. 7 A) in raw plastid.

11 yeast one-hybrid of embodiment

From cloning the sequence for having cloned 2 treaty 2000bp in ACS and ACO gene promoter in peach pulp.And it will starting Son is divided into small fragment and is separately connected in pAbAi carrier.Meanwhile the full length sequence of isolated PpHB.G7 gene being inserted into In pGADT7 carrier.Yeast one-hybrid (Y1H) detection is carried out using yeast one-hybrid library screening system.The result shows that PpHB.G7 mediates it to express (Fig. 7 B, C) by the promoter in conjunction with PpACS1 and PpACO.A1.All primers arrange in table 2 Out.

2 primer sequence list of table

Bibliography

[1]Giovannoni,J.J.Genetic regulation of fruit development and ripening.Plant Cell 16Suppl.suppl_1(2003):S170.

[2]Xian Li,Changjie Xu,Schuyler S.Korban.Regulatory Mechanisms of Textural Changes in Ripening Fruits.Critical Reviews in Plant Sciences 29.4 (2010):222-243.

[3] the molecular regulation mechanism Botany Gazette 48.5 (2013) of Tian Shiping fruit maturation and aging: 481-488.

[4]Jean‐Marc Lelièvre,Alain Latchè,Brian Jones,Mondher Bouzayen,Jean‐ Claude Pech.Ethylene and fruit ripening.Physiologia Plantarum 101.4(2006): 727-739.

[5] the progress heredity 26.3 (2004) of the bright Transcription Factors in Higher Plants of Yang Zhirong, Wang Xingchun, Li Xi: 403-408..

[6]Liu L,White M J,Macrae T H.Transcription factors and their genes in higher plants functional domains,evolution and regulation.[J].European Journal of Biochemistry,2010,262(2):247-257,Febs Journal 262.2(2010):247-257.

[7] Sun Yu rice HB transcription factor family gene clone and OsHB40, OsHB102 Preliminary Study of Their Function .Diss. Jilin University, 2013

[8] Liu Qiang, Zhang Guiyou " structure and regulating and controlling effect of plant transcription factor " Science Bulletin 45.14 (2000): 1465-1474.

[9]Jingdong Liu,Thomas E.Wilson,Jeffrey Milbrandt."Identifying DNA- Binding Sites and Analyzing DNA-Binding Domains Using a Yeast Selection System."Methods5.2(1993):125–137.

[10]Mukherjee,K,and T.R.Bürglin."MEKHLA,a novel domain with similarity to PAS domains,is fused to plant homeodomain-leucine zipper III proteins."Plant Physiology 140.4(2006):1142-1150.

[11]F.D.Ariel,P.A.Manavella,C.A.Dezar,R.L.Chan,The true story of the HD-Zip family,Trends Plant Sci.12(2007)419-426.

[12]A.Bhattacharjee,R.Ghangal,R.Garg,M.Jain,Genome-wide analysis of homeobox gene family in legumes:identification,gene duplication and expression profiling,Plos One 10(2015)e0119198.

[13]K.Mukherjee,L.Brocchieri,T.R.Burglin,A comprehensive classification and evolutionary analysis of plant homeobox genes, Mol.Biol.Evol.26(2009)2775-2794.

[14]E.Vollbrecht,B.Veit,N.Sinha,S.Hake,The developmental gene Knotted-1is a member of a maize homeobox gene family,Nature 350(1991)241-243

[15]E.Shani,Y.Burko,L.Ben-Yaakov,Y.Berger,Z.Amsellem,A.Goldshmidt, E.Sharon,N.Ori,Stage-specific regulation of Solanum lycopersicum leaf maturation by class 1KNOTTED1-LIKE HOMEOBOX proteins,Plant Cell 21(2009)3078- 3092.

[16]E.Belles-Boix,O.Hamant,S.M.Witiak,H.Morin,J.Traas,V.Pautot,KNAT6: an Arabidopsis homeobox gene involved in meristem activity and organ separation,Plant Cell 18(2006)1900-1907.

[17]A.T.Groover,S.D.Mansfield,S.P.DiFazio,G.Dupper,J.R.Fontana, R.Millar,Y.Wang,The Populus homeobox gene ARBORKNOX1reveals overlapping mechanisms regulating the shoot apical meristem and the vascular cambium, Plant Mol.Biol.61(2006)917-932.

[18]S.P.Venglat,T.Dumonceaux,K.Rozwadowski,L.Parnell,V.Babic, W.Keller,R.Martienssen,G.Selvaraj,R.Datla,The homeobox gene BREVIPEDICELLUS is a key regulator of inflorescence architecture in Arabidopsis,Proc Natl Acad Sci USA 99(2002)4730-4735.

[19]J.Du,S.D.Mansfield,A.T.Groover,The Populus homeobox gene ARBORKNOX2regulates cell differentiation during secondary growth,Plant J.60 (2009)1000-1014

[20]G.Mele,N.Ori,Y.Sato,S.Hake,The knotted1-like homeobox gene BREVIPEDICELLUS regulates cell differentiation by modulating metabolic pathways,Genes Dev,17(2003)2088-2093.

[21]T.Sakamoto,H.Sakakibara,M.Kojima,Y.Yamamoto,H.Nagasaki,Y.Inukai, Y.Sato,M.Matsuoka,Ectopic expression of KNOTTED1-like homeobox protein induces expression of cytokinin biosynthesis genes in rice,Plant Physiol.142 (2006)54-62.

[22]F.M.Rosin,J.K.Hart,H.T.Horner,P.J.Davies,D.J.Hannapel, Overexpression of a knotted-like homeobox gene of potato alters vegetative development by decreasing gibberellin accumulation,Plant Physiol.132(2003) 106-117.

[23]M.E.Byrne,A.T.Groover,J.R.Fontana,R.A.Martienssen,Phyllotactic pattern and stem cell fate are determined by the Arabidopsis homeobox gene BELLRINGER,Dev.130(2003)3941-3950.

[24]C.Gomez-Mena,R.Sablowski,ARABIDOPSIS THALIANA HOMEOBOX GENE1establishes the basal boundaries of shoot organs and controls stem growth,Plant Cell 20(2008)2059-2072

[25]S.Kanrar,M.Bhattacharya,B.Arthur,J.Courtier,H.M.Smith,Regulatory networks that function to specify flower meristems require the function of homeobox genes PENNYWISE and POUND-FOOLISH in Arabidopsis,Plant J.54(2008) 924-937.

[26]M.Proveniers,B.Rutjens,M.Brand,S.Smeekens,The Arabidopsis TALE homeobox gene ATH1 controls floral competency through positive regulation of FLC,Plant J.52(2007)899-913.

[27]N.A.Horst,A.Katz,I.Pereman,E.L.Decker,N.Ohad,R.Reski,A single homeobox gene triggers phase transition,embryogenesis and asexual reproduction,Nat.Plants 2(2016)15209.

[28]M.Dai,Y.Hu,Y.Zhao,H.Liu,D.X.Zhou,A WUSCHEL-LIKE HOMEOBOX gene represses a YABBY gene expression required for rice leaf development,Plant Physiol.144(2007)380-390.

[29]M.Nakata,N.Matsumoto,R.Tsugeki,E.Rikirsch,T.Laux,K.Okada,Roles of the middle domain-specific WUSCHEL-RELATED HOMEOBOX genes in early development of leaves in Arabidopsis,Plant Cell 24(2012)519-535.

[30]X.Wu,T.Dabi,D.Weigel,Requirement of homeobox gene STIMPY/WOX9 for Arabidopsis meristem growth and maintenance,Curr.Biol.15(2005)436-440.

[31]Y.Hirakawa,Y.Kondo,H.Fukuda,TDIF peptide signaling regulates vascular stem cell proliferation via the WOX4 homeobox gene in Arabidopsis, Plant Cell 22(2010)2618-2629.

[32]M.Romera-Branchat,J.J.Ripoll,M.F.Yanofsky,S.Pelaz,The WOX13 homeobox gene promotes replum formation in the Arabidopsis thaliana fruit, Plant J.73(2013)37-49.

[33]Y.Zhao,Y.Hu,M.Dai,L.Huang,D.X.Zhou,The WUSCHEL-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice,Plant Cell 21(2009)736-748.

[34]S.Cheng,D.X.Zhou,Y.Zhao,WUSCHEL-related homeobox gene WOX11increases rice drought resistance by controlling root hair formation and root system development,Plant Signal Behav.11(2016)e1130198.

[35]T.Aoyama,C.H.Dong,Y.Wu,M.Carabelli,G.Sessa,I.Ruberti,G.Morelli, N.H.Chua,Ectopic expression of the Arabidopsis transcriptional activator Athb-1 alters leaf cell fate in tobacco,Plant Cell 7(1995)1773-1785.

[36]C.A.Dezar,G.M.Gago,D.H.Gonzalez,R.L.Chan,Hahb-4,a sunflower homeobox-leucine zipper gene,is a developmental regulator and confers drought tolerance to Arabidopsis thaliana plants,Transgenic Res.14(2005)429-440

[37]A.S.Olsson,P.Engstrom,E.Soderman,The homeobox genes ATHB12 and ATHB7 encode potential regulators of growth in response to water deficit in Arabidopsis,Plant Mol.Biol.55(2004)663-677.

[38]E.Soderman,M.Hjellstrom,J.Fahleson,P.Engstrom,The HD-Zip gene ATHB6in Arabidopsis is expressed in developing leaves,roots and carpels and up-regulated by water deficit conditions,Plant Mol.Biol.40(1999)1073-1083.

[39]E.C.Rueda,C.A.Dezar,D.H.Gonzalez,R.L.Chan,Hahb-10,a sunflower homeobox-leucine zipper gene,is regulated by light quality and quantity,and promotes early flowering when expressed in Arabidopsis,Plant Cell Physiol.46 (2005)1954-1963.

[40]K.Ohashi-Ito,H.Fukuda,HD-zip III homeobox genes that include a novel member,ZeHB-13(Zinnia)/ATHB-15(Arabidopsis),are involved in procambium and xylem cell differentiation,Plant Cell Physiol.44(2003)1350-1358.

[41]S.P.Grigg,C.Galinha,N.Kornet,C.Canales,B.Scheres,M.Tsiantis, Repression of apical homeobox genes is required for embryonic root development in Arabidopsis,Curr.Biol.19(2009)1485-1490.

[42]B.Shen,K.W.Sinkevicius,D.A.Selinger,M.C.Tarczynski,The homeobox gene GLABRA2 affects seed oil content in Arabidopsis,Plant Mol.Biol.60(2006) 377-387.

[43]]C.Gu,L.Wang,W.Wang,H.Zhou,B.Ma,H.Zheng,T.Fang,C.Ogutu, S.Vimolmangkang,Y.Han,Copy number variation of a gene cluster encoding endopolygalacturonase mediates flesh texture and stone adhesion in peach, J.Exp.Bot.67(2016)1993-2005.

[44]J.García-Andrade,V.Ramírez,V.Flors,P.Vera,Arabidopsis ocp3 mutant reveals a mechanism linking ABA and JA to pathogen-induced callose deposition,Plant J.67(2011)783-794.

[45]V.Ramírez,A.Coego,A.López,A.Agorio,V.Flors,P.Vera,Drought tolerance in Arabidopsis is controlled by the OCP3 disease resistance regulator,Plant J.58:(2009a)578-591.

[46]V.Ramírez,S.Van der Ent,J.García-Andrade,A.Coego,C.M.Pieterse, P.Vera,OCP3 is an important modulator of NPR1-mediated jasmonic acid- dependent induced defenses in Arabidopsis,BMC Plant Biol.10(2009b)199.

Sequence table

<110>Jiangsu Province Agriculture Science Institute

<120>peach transcription factor PpHB G7 gene, albumen, its recombinant expression carrier and application

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 936

<212> DNA

<213>flowering peach (Prunus persica)

<400> 1

atgagttttg atgaagcttg taacaccggc cttggtctca gtctaggctg ccgtgacagc 60

ccagatcatg accatacaaa tttgcaggct cctcctgatc atcatcatca ccatcaccaa 120

aacacgtaca agaacaagca aatacagttg aaatatgatc acctattgcc ttctcttacg 180

ctcggcccat cggctgcttc aaagattgag gaggccgagt ccactgattt gcaccaggca 240

gtagccgcac aggaacagga ctcttctccc tgcagcggcg ccttttcatc tttttctaac 300

tcgtcaagtt tcaagaggga cagagagttg ggaggtgaag agatagaggt agaggtagag 360

gtagaggtag aggtagagga agagagagtg gtgaatatta cttcctcaag agcaagcgag 420

gagttatatg aacaagatca tgagggcagc cccagaaaga agctcaggct ttcaaaagaa 480

caatctgcca ctttggaaga cagcttcaga gaacacacca ccctcaatcc caagcaaaag 540

caagacctgg caagaaagct aaatctacgg ccgcgacaag tggaagtctg gttccaaaac 600

aggagggcca ggaccaagtt gaagcaaact gaagcggatt gtgagttgtt gaaaaagtgt 660

tgtgagacgc tgaaagaaga gaacagaagg ctacacaagg agctgcaaga gctcaagtta 720

atgaaacaaa cggcaacagc agcagcagca gtaccaccct tttacatgca gtttccaaca 780

gccactctca ccatgtgccc ttcttgtgag aaaatctgca acggcggtga ccaccataat 840

catcatgggt cgtcgacgag ttcttttttg attggatcga agccggctca cttgatcttc 900

aaccccttta gcacccatcc atctacagct tgctaa 936

<210> 2

<211> 311

<212> PRT

<213>flowering peach (Prunus persica)

<400> 2

Met Ser Phe Asp Glu Ala Cys Asn Thr Gly Leu Gly Leu Ser Leu Gly

1 5 10 15

Cys Arg Asp Ser Pro Asp His Asp His Thr Asn Leu Gln Ala Pro Pro

20 25 30

Asp His His His His His His Gln Asn Thr Tyr Lys Asn Lys Gln Ile

35 40 45

Gln Leu Lys Tyr Asp His Leu Leu Pro Ser Leu Thr Leu Gly Pro Ser

50 55 60

Ala Ala Ser Lys Ile Glu Glu Ala Glu Ser Thr Asp Leu His Gln Ala

65 70 75 80

Val Ala Ala Gln Glu Gln Asp Ser Ser Pro Cys Ser Gly Ala Phe Ser

85 90 95

Ser Phe Ser Asn Ser Ser Ser Phe Lys Arg Asp Arg Glu Leu Gly Gly

100 105 110

Glu Glu Ile Glu Val Glu Val Glu Val Glu Val Glu Val Glu Glu Glu

115 120 125

Arg Val Val Asn Ile Thr Ser Ser Arg Ala Ser Glu Glu Leu Tyr Glu

130 135 140

Gln Asp His Glu Gly Ser Pro Arg Lys Lys Leu Arg Leu Ser Lys Glu

145 150 155 160

Gln Ser Ala Thr Leu Glu Asp Ser Phe Arg Glu His Thr Thr Leu Asn

165 170 175

Pro Lys Gln Lys Gln Asp Leu Ala Arg Lys Leu Asn Leu Arg Pro Arg

180 185 190

Gln Val Glu Val Trp Phe Gln Asn Arg Arg Ala Arg Thr Lys Leu Lys

195 200 205

Gln Thr Glu Ala Asp Cys Glu Leu Leu Lys Lys Cys Cys Glu Thr Leu

210 215 220

Lys Glu Glu Asn Arg Arg Leu His Lys Glu Leu Gln Glu Leu Lys Leu

225 230 235 240

Met Lys Gln Thr Ala Thr Ala Ala Ala Ala Val Pro Pro Phe Tyr Met

245 250 255

Gln Phe Pro Thr Ala Thr Leu Thr Met Cys Pro Ser Cys Glu Lys Ile

260 265 270

Cys Asn Gly Gly Asp His His Asn His His Gly Ser Ser Thr Ser Ser

275 280 285

Phe Leu Ile Gly Ser Lys Pro Ala His Leu Ile Phe Asn Pro Phe Ser

290 295 300

Thr His Pro Ser Thr Ala Cys

305 310

<210> 3

<211> 34

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

tttaagctta gagagagatg agttttgatg aagc 34

<210> 4

<211> 34

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

ttttctagat ttagcaagct gtagatggat gggt 34

<210> 5

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

accgaattca caccaccctc aatcccaagc 30

<210> 6

<211> 34

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

ctcggtacct ttagcaagct gtagatggat gggt 34

<210> 7

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

tgggtacctg cagtatgtcc gttccttggc 30

<210> 8

<211> 34

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

tcaagcttgg ttccaaagaa tactcacaca caag 34

<210> 9

<211> 36

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

tgggtaccaa gagacatatc aggtgatgaa agaacg 36

<210> 10

<211> 29

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

tcaagcttgt gaagtggagt ttggtgtgg 29

Claims (8)

1. peach transcription factor PpHB.G7 gene, nucleotide sequence is as shown in SEQ ID NO.1.

2. the albumen of peach transcription factor PpHB.G7 gene coding described in claim 1, amino acid sequence such as SEQ ID Shown in NO.2.

3. the recombinant expression carrier containing PpHB.G7 gene described in claim 1.

4. recombinant expression carrier according to claim 3, it is characterised in that: it with pCAMBIA1301 is to set out carrier, right It is required that the insertion point of the 1 PpHB.G7 gene is between Xbal and HindIII.

5. the host strain containing PpHB.G7 gene described in claim 1.

6. cloning the primer pair of PpHB.G7 gene cDNA sequence described in claim 1, upstream primer PpHB.G7-F1 sequence is such as Shown in SEQ ID NO.3, downstream primer PpHB.G7-R1 sequence is as shown in SEQ ID NO.4.

7. PpHB.G7 gene described in claim 1 is promoting the application in ethylene synthase.

8. recombinant expression carrier as claimed in claim 3 is promoting the application in ethylene synthase.