CN109706266B - Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof - Google Patents
Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof Download PDFInfo
- Publication number
- CN109706266B CN109706266B CN201910186568.XA CN201910186568A CN109706266B CN 109706266 B CN109706266 B CN 109706266B CN 201910186568 A CN201910186568 A CN 201910186568A CN 109706266 B CN109706266 B CN 109706266B
- Authority
- CN
- China
- Prior art keywords
- cabbage
- epidermal
- molecular marker
- epidermal hair
- identifying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker for identifying the existence of cabbage epidermal hair, a development method and application thereof, the invention discloses a molecular marker bol, trichome-CAPS.02 for identifying the existence of cabbage epidermal hair, which has a nucleotide sequence shown as SEQ ID No.1, the molecular marker is closely related to cabbage epidermal hair characters, and discloses a primer corresponding to the molecular marker, wherein a forward primer has a nucleotide sequence shown as SEQ ID No.2, a reverse primer has a nucleotide sequence shown as SEQ ID No.3, the invention also discloses a development method of the molecular marker, and discloses application of the molecular marker in cabbage breeding, the heterozygous and homozygous genotypes in the cabbage epidermal hair segregation population can be identified accurately on a large scale, so that the progeny selection is more targeted, the cabbage genetic breeding efficiency is improved, and the land space occupied by the breeding is reduced.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker for identifying existence of cabbage epidermal hair, and a development method and application thereof.
Background
The plant epidermal hair is developed from epidermal cells and is positioned between the plant epidermal layer and the environment, and a natural physical barrier is provided for plants. Some epidermal hairs defend against biological attack by secreting repellents, alkaloids, or toxic substances, protecting plants from herbivores, insects, and infection by pathogens. In the aspect of resisting abiotic stress, the epidermal hair not only can reduce freezing, ultraviolet damage, mechanical damage and the like, but also can reduce water loss and excessive accumulation and loss of heat in the plant body.
In brassica species, epidermal hairs are widely present in chinese cabbage, mustard, brassica napus and several wild cabbages, whereas at present all cultivated cabbages are of the non-epidermal-hair type, such as common head cabbage, cauliflower, broccoli, collard, cabbage, brussels sprouts and the like. One wild type (b.incana) has a remarkable ability to resist biotic stress, and the wild cabbage has a remarkable feature that it is covered with epidermal hair throughout the body and has a remarkable ability to resist diseases and insects. Therefore, the wild cabbage resource is utilized to cultivate the cultivated cabbage with the epidermal hair, and the method has positive significance for improving the disease and insect resistance, drought resistance and freezing injury resistance of the cultivated cabbage and reducing the pesticide application amount and cost input.
The mechanism of epidermal hair formation in the model plant Arabidopsis thaliana is basically elucidated, and more than 30 genes have been confirmed to be involved in epidermal hair formation and development. Wherein, GL1, TTG1 and GL3 jointly form a trimer complex activator GL1-GL3-TTG1, which promotes expression of GL2 gene, and further regulates and controls development of epidermal hair. In contrast to the above positive regulators, TRY is the major negative regulator in Arabidopsis that regulates epidermal hair development, and interacts with the terminus of GL3 and binds to bHLH protein competitively with GL1 to form the TRY-GL3-TTG1 complex, thereby inhibiting epidermal hair development. At present, BrTTG1 has been confirmed to be a regulator of cabbage epidermal hair formation by the map-based cloning technique. Meanwhile, the nucleotide polymorphism of the BrGL1 gene is also related to the epidermal hair of cabbage leaves, but the gene for controlling the epidermal hair of wild cabbage is not reported yet.
At present, in genetic breeding aiming at cabbage epidermal hair traits, a traditional crossbreeding method is still adopted, and the breeding method is low in efficiency and large in occupied land space.
Disclosure of Invention
In order to solve the technical problems, the invention discloses a molecular marker bol, trichome-CAPS.02 for identifying the existence of cabbage epidermal hair, wherein the molecular marker is closely related to the character of the cabbage epidermal hair, the invention also discloses a development method of the molecular marker, and discloses application of the molecular marker in cabbage breeding.
The invention is realized by the following technical scheme:
a molecular marker Bol.trichome-CAPS.02 for identifying the existence of cabbage epidermal hair has a nucleotide sequence shown as SEQ ID No. 1.
AAACCTCTCCAACAAAGCCCACTCTCTCTTTCTCTCTAGATACAAGATAGTATAATAAAAGAGTTTGCCACCTCTCTTCTCTGCTCTCTCTTCAGTTTCTCATACTTTCCTCTTCCACCTCCATTGATGGATTCAACGTATCGACGTCAGCGTCACAACTCTGAAGGTCCATCTCATATAATGTGTTTGATTAGCTTATTACATATGCATGCTCTTTCTTCATAACCATATTTTATTTCCTTTGGACATAGTCAATAGTCATCGTGTTTAGCTGAAGTTCATGTTATCATATATTATATTTCCCTAATTAACCAGACTCTTCGTAGCCTTAATTATCACATATATGTAGTTACGCGATTGTGAATAAACACACCAATAACAAACTTCGTAGCCTTTTATTATATATATAGCCCTAATTGTATTTACGTGAATGTGAAATAAGTATTTACGAGCAGAGATGAGATCAAGAAGGACATGAGATTATTACATACGTAGCGATTAGCAAAAGAGAATATAAAAATATTGGAGCAAAAAGTAAAAGTTTTGTGTTGTTTTTGATAAATGCAGAAGTGTGTAGCGTAAAGTGG
The total length of the molecular marker is 587bp, the SNP appears at 157bp, the underlined shows that the SNP is SNP, the kale without hair is A, the kale with hair is G, the enzyme cutting site is between 131-.
A primer of a molecular marker Bol.trichome-CAPS.02 for identifying the existence of cabbage epidermal hair comprises a forward primer having a nucleotide sequence (5'-AAACCTCTCCAACAAAGCCCA-3') shown as SEQ ID No.2 and a reverse primer having a nucleotide sequence (5'-CCACTTTACGCTACACACTTC-3') shown as SEQ ID No. 3.
The development method of the molecular marker Bol.trichome-CAPS.02 for identifying the existence of cabbage epidermal hair comprises the following steps:
1) crossing a wild cabbage with hairs B1Generation, F1Selfing to obtain F2Generation plant, 1063F2(containing 149 clones F2 and 914 individuals F2:3778 of the family members) have no wool, 285 have wool, and the separation ratio (3: 1) is satisfiedChi-square value＝1.628，P＞0.05，The chi fang test is not obvious and accords with the genetic segregation rule of 3:1 Law of law) The epidermal hair of the wild cabbage is controlled by a recessive monogene;
2) using 149 clones F2Constructing a cabbage genetic linkage map (Mei et al,2013, TAG 126: 549-Surd 556) in the population, and positioning the epidermal hair gene to a section of 4.3cM (17.56MB) interval on a cabbage C01 chromosome;
3) from F2Selecting 50 individuals without and with epidermal hair in the population, carrying out whole genome re-sequencing on the parents and the extreme mixed pool, identifying a differential hot spot region obviously related to the cabbage epidermal hair character by adopting a delta (SNP-index) method according to a Takagi method and the like (Takagi et al,2013, Plant J74: 174-183), and finally positioning the cabbage epidermal hair character in a 1.04Mb interval on a cabbage C01 chromosome by combining a QTL positioning result;
4) through homologous comparison with arabidopsis thaliana and gene annotation information, a candidate gene BolTRY-l is found in the interval, the gene has similar functions with the arabidopsis thaliana regulation epidermal hair gene AthTRY, and qRT-PCR analysis shows that F2The expression level of the candidate gene BolTRY-l in the population is obviously higher than that of the hairless plants (Mei et al, 2017, TAG130: 1953-;
5) CDS of the Brussels sprouts and the Brussels sprouts-l genes are further cloned, and the CDS sequences of the Brussels sprouts and the Brussels sprouts have SNP when the CDS sequences are compared.
The invention also provides a cabbage variety identification method for the presence of skin hair, which comprises the following steps:
(1) taking cabbage DNA to be identified as a template, amplifying a molecular marker bol, trichome-CAPS.02, wherein primers are nucleotide sequences shown as SEQ ID No.2 and SEQ ID No. 3;
(2) carrying out enzyme digestion on the amplified product by using restriction enzyme HinfI, and carrying out gel electrophoresis after enzyme digestion to obtain five specific bands of 271-bp, 185-bp, 158-bp, 131-bp and 27-bp;
(3) cabbage plants with four specific bands of 271-bp, 158-bp, 131-bp and 27-bp are homozygous hairy individuals, cabbage plants with three bands of 271-bp, 185-bp and 131-bp are homozygous unhaired plants, and cabbage plants with five specific bands are heterozygous individuals.
The invention also provides application of the molecular marker Bol.trichome-CAPS.02 for identifying the existence of cabbage epidermal hair in cabbage breeding.
The invention also provides application of the molecular marker Bol.trichome-CAPS.02 for identifying the existence of cabbage epidermal hair in breeding cabbage varieties with different epidermal hair properties.
The invention also provides application of the molecular marker primer in cabbage breeding.
The invention also provides application of the molecular marker primer in breeding cabbage varieties with different epidermal hair characters.
The invention also provides application of the cabbage variety identification method in cabbage breeding.
The invention also provides application of the cabbage variety identification method in breeding cabbage varieties with different epidermal hair properties.
Compared with the prior art, the invention has the following advantages and beneficial effects:
1. the molecular marker bol, trichome-CAPS.02 for identifying the existence of cabbage epidermal hair is closely related to the cabbage epidermal hair character, can be applied to cabbage molecular assisted breeding, realizes large-scale accurate identification of heterozygous and homozygous genotypes in a cabbage epidermal hair segregation population, enables progeny selection to be more targeted, improves cabbage genetic breeding efficiency, and reduces land space occupied by breeding;
2. the method for identifying cabbage variety with or without surface coat utilizes the primer of molecular marker bol, trichome-CAPS.02 closely related to cabbage surface coat character, and utilizes restriction enzyme HinfI to make enzyme digestion and electrophoresis so as to attain the goal of identifying cabbage genotype.
Drawings
The accompanying drawings, which are included to provide a further understanding of the embodiments of the invention and are incorporated in and constitute a part of this application, illustrate embodiment(s) of the invention and together with the description serve to explain the principles of the invention. In the drawings:
FIG. 1 is a field epidermal hair character map of two parents of cabbage of the present invention.
The upper panel of FIG. 2 is the map of the mapping result of the cabbage epidermal hair BSA trait of the present invention, and the lower panel is the enlarged view of chromosome C01, and the candidate gene is located at 14.43 Mb.
FIG. 3 is a schematic diagram showing the restriction sites of the restriction enzyme HinfI and primers used in the molecular marker of the present invention (C01 is a wild cabbage parent, C41 is a wild cabbage parent, the sequence following F is a forward primer sequence, the sequence following R is a reverse primer sequence, ATG is an initiation codon, white bold letters are SNP sites, a white line-covering sequence is a base sequence recognizable to HinfI, black inverted triangle represents a restriction site, the middle base is indicated by an ellipsis mark)
FIG. 4 is a schematic diagram showing the detection of the molecular marker of the present invention in hairy and unhaired cabbage (M represents marker, C01 represents the parent of hairy cabbage, C41 represents the parent of unhaired cabbage, F1Representative of hybrid F1)。
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples and accompanying drawings, and the exemplary embodiments and descriptions thereof are only used for explaining the present invention and are not meant to limit the present invention.
Example 1
The invention relates to a development method of a molecular marker Bol.trichome-CAPS.02 for identifying the existence of cabbage epidermal hair, which comprises the following steps:
1) one part of hairless cabbage is usedHybridization with a wild cabbage with hairs B.incana to yield F1Generation, F1Selfing again and planting in field to obtain 1063F2Generation plant (containing 149 clones F)2Population and 914 individuals F2:3Family) at F2At the fourth to fifth leaf stage of the plant, the presence or absence of epidermal hair was observed by naked eye, F2778 of the generation plants have no hair, 285 have hair, and the separation ratio of 3:1 is met (the chi-square value is 1.628, and P is more than 0.05), which indicates that the epidermal hair of the wild cabbage is controlled by a recessive single gene;
2) using 149 clones F2Constructing a cabbage genetic linkage map (Mei et al,2013, TAG 126: 549-Surd 556) in the population, and positioning the epidermal hair gene to a section of 4.3cM (17.56MB) interval on a cabbage C01 chromosome;
3) from F2Selecting 50 individuals without and with epidermal hair in the population, performing whole genome re-sequencing on the parents and the extreme mixed pool, identifying a differential hot spot region which is obviously related to the cabbage epidermal hair character by adopting a delta (SNP-index) method according to a Takagi method and the like (Takagi et al,2013, Plant J74: 174 and 183), and finally positioning the cabbage epidermal hair character in a 1.04Mb interval on a cabbage C01 chromosome by combining a QTL positioning result, wherein the QTL positioning result is shown in figure 2;
4) through homologous comparison with arabidopsis thaliana and gene annotation information, a candidate gene BolTRY-l is found in the interval according to corresponding function annotation and the existing literature related to plant epidermal hair, the gene has similar function with an arabidopsis thaliana regulation epidermal hair gene AthTRY, and qRT-PCR analysis shows that F2The expression level of the candidate gene BolTRY-l in the population is obviously higher than that of the hairless plants (Mei et al, 2017, TAG130: 1953-;
5) furthermore, CDS of the Brussels sprouts and the Brussels sprouts-l genes are cloned, and the CDS sequences of the Brussels sprouts and the Brussels sprouts have SNP when the CDS sequences are compared.
6) Based on the upstream and downstream sequences of the SNP site, primers were designed to amplify the SNP site, as shown in FIG. 3, the forward primer sequence was 5'-AAACCTCTCCAACAAAGCCCA-3', the reverse primer sequence was 5'-CCACTTTACGCTACACACTTC-3', and the amplified fragment size was 587-bp. Based on the SNP type and the adjacent sequence, HinfI was determined as a restriction enzyme capable of discriminating the base type.
Example 2
The invention relates to an application process of a molecular marker Bol.trichome-CAPS.02 for identifying whether cabbage epidermal hairs exist or not in breeding cabbage varieties with different epidermal hair characters, which comprises the following specific steps:
(1) taking DNA of leaves of a cabbage single plant at a seedling stage as a template, amplifying a molecular marker Bol.trichome-CAPS.02, wherein primers are nucleotide sequences shown as SEQ ID No.2 and SEQ ID No. 3;
(2) treating the PCR amplification product with 2.5U restriction enzyme HinfI at 37 deg.c for 1 hr every 10ul, and electrophoresing the enzyme digested product with 4% agarose gel to obtain five specific bands of 271-bp, 185-bp, 158-bp, 131-bp and 27-bp;
(3) as shown in figure 4, the cabbage plants with four specific bands of 271-bp, 158-bp, 131-bp and 27-bp are homozygous hairy individuals, the cabbage plants with three bands of 271-bp, 185-bp and 131-bp are homozygous hairless plants, the cabbage plants with five specific bands are heterozygous individuals, the current generation shows hairless, the offspring is separated and can be reserved for further breeding selection, and the aim of cultivating and identifying the hairy cabbage is finally achieved.
Example 3
The invention relates to an application process of a molecular marker Bol.trichome-CAPS.02 for identifying whether cabbage epidermal hair exists in backcross breeding, which comprises the following steps:
as shown in figure 1, F produced by crossing disease-resistant kale C41 and kale C01 as parents1Backcrossing with C41 was continued to give 80 parts of BC1F1Backcross population is used as research material to carry out backcross breeding research from transferring hairy characters (single invisible genes) to disease-resistant hairy-free cabbage C41. Among them, 80 parts of the material showed hairless, and the molecular marker developed in example 1 was used for genotyping, the procedure was as follows:
1) with 80 parts of BC1F1DNA of leaves at the seedling stage of the backcross population is taken as a template;
2) PCR amplification was performed using the following primers:
the sequence of the forward primer is 5'-AAACCTCTCCAACAAAGCCCA-3', the sequence of the reverse primer is 5'-CCACTTTACGCTACACACTTC-3', and the size of the amplified fragment is 587-bp;
3) and (3) PCR reaction system: the total volume is 10ul, and the specific components are as follows:
| composition (I) | Volume of |
| ddH2O | 6.7μL |
| 10×TaqBuffer (containing Mg)2+) | 1.0μL |
| dNTPs(10Mm) | 0.2μL |
| Forward primer (50 ng/. mu.L) | 0.5μL |
| Reverse primer (50 ng/. mu.L) | 0.5μL |
| Taqase(5U/μL) | 0.1μL |
| DNA template (50 ng/. mu.L) | 2.0μL |
| Total volume | 10.0μL |
4) PCR amplification procedure: 5min at 94 ℃, 45s at [94 ℃, 45s at 55 ℃, 1min at 72 ℃ and x 35 cycle, 10min at 72 ℃. After the operation is finished, the product is stored at 4 ℃.
5) Enzyme digestion of PCR amplification products: treating every 10 μ l with 2.5U of restriction enzyme HinfI at 37 deg.C for 1 h;
6) after the enzyme digestion product is separated by 4 percent agarose gel electrophoresis, 38 parts of materials with three specific bands of 271-bp, 185-bp and 131-bp appear, and the homozygous hairless plant is presumed; 42 parts of materials with five specific bands of 271-bp, 185-bp, 158-bp, 131-bp and 27-bp are presumed to be heterozygous genotype plants, and the proportion of the two is close to 1: 1.
7) randomly selecting 5 parts (without hair) of the material with the three specific bands of 271-bp, 185-bp and 131-bp and 5 parts (without hair) of the material with the five specific bands of 271-bp, 185-bp, 158-bp, 131-bp and 27-bp in the step 6), selfing and planting the materials in a field, and investigating the epidermal hair property of the next generation of plants, wherein the results show that the phenotypes of the offspring of the three band materials are all hairless, do not separate and are consistent with the representative type of the plant, namely the previous generation is a homozygous hairless plant; shows that the phenotype of 5 offspring with the material has the separation phenomenon of the epidermal hair character, namely the offspring is a heterozygous genotype plant.
The identification result shows that in the backcross breeding of the transferred cabbage epidermal hair, through functional marker identification and screening, the material with five specific bands of 271-bp, 185-bp, 158-bp, 131-bp and 27-bp is kept as a heterozygous single plant, and is continuously backcrossed with the recurrent parent C41 for the second time, and the work load can be reduced by 50% in each generation theoretically. At the same time, with the aid of molecular marker-assisted selection, in backcross breeding of transferred single stealth genes (such as the epidermal hair gene in this study), BC could be obtained in only 5 years3F2Traditional backcross breeding takes 8 years (more than 3 years of F)1Selfing to produce F2) Obviously shortening the breeding period and accelerating the breeding process.
The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are merely exemplary embodiments of the present invention, and are not intended to limit the scope of the present invention, and any modifications, equivalent substitutions, improvements and the like made within the spirit and principle of the present invention should be included in the scope of the present invention.
Sequence listing
<110> university of southwest
<120> molecular marker for identifying existence of cabbage epidermal hair, and development method and application thereof
<140> 201910186568X
<141> 2019-03-19
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 587
<212> DNA
<213> Artificial sequence (1)
<220>
<221> misc_feature
<222> (157)
<223> r = a or g
<400> 1
aaacctctcc aacaaagccc actctctctt tctctctaga tacaagatag tataataaaa 60
gagtttgcca cctctcttct ctgctctctc ttcagtttct catactttcc tcttccacct 120
ccattgatgg attcaacgta tcgacgtcag cgtcacract ctgaaggtcc atctcatata 180
atgtgtttga ttagcttatt acatatgcat gctctttctt cataaccata ttttatttcc 240
tttggacata gtcaatagtc atcgtgttta gctgaagttc atgttatcat atattatatt 300
tccctaatta accagactct tcgtagcctt aattatcaca tatatgtagt tacgcgattg 360
tgaataaaca caccaataac aaacttcgta gccttttatt atatatatag ccctaattgt 420
atttacgtga atgtgaaata agtatttacg agcagagatg agatcaagaa ggacatgaga 480
ttattacata cgtagcgatt agcaaaagag aatataaaaa tattggagca aaaagtaaaa 540
gttttgtgtt gtttttgata aatgcagaag tgtgtagcgt aaagtgg 587
Claims (7)
1. A molecular marker Bol.trichome-CAPS.02 for identifying the existence of cabbage epidermal hair is characterized in that the nucleotide sequence is shown as SEQ ID No. 1.
2. The method for developing a molecular marker bol, trichome-caps.02 for identifying the presence of cabbage epidermal hairs as claimed in claim 1, comprising the steps of:
1) crossing a wild cabbage with hairs B1Generation, F1Selfing to obtain F2Plant generation according to F2Determining the gene type for controlling the epidermal hair character of the wild cabbage according to the separation ratio of the hairless character to the hairless character in the generation plant;
2) using F2Clone F in generational plants2Constructing a cabbage genetic linkage map by the population, and positioning an epidermal hair gene to a section of 4.3cM interval on a cabbage C01 chromosome;
3) from F2Selecting plants without and with the same number of epidermal hairs from the population, performing whole genome re-sequencing on the parent and the extreme mixed pool, identifying a differential hot spot region which is obviously related to the cabbage epidermal hair character by adopting a delta (SNP-index) method according to methods such as Takagi and the like, and finally positioning the cabbage epidermal hair character in a 1.04Mb interval on a cabbage C01 chromosome by combining a QTL positioning result;
4) through homologous comparison with arabidopsis thaliana and gene annotation information, a candidate gene BolTRY-l is found in the interval, the gene has similar functions with the arabidopsis thaliana regulation epidermal hair gene AthTRY, and qRT-PCR analysis shows that F2The expression level of the candidate gene BolTRY-l in the population in hairless plants is obviously higher than that of hairless plants;
5) CDS of the Brussels sprouts and the Brussels sprouts-l genes are further cloned, and the CDS sequences of the Brussels sprouts and the Brussels sprouts have SNP when the CDS sequences are compared.
3. The method for identifying the cabbage variety with or without skin hair is characterized by comprising the following steps:
(1) taking cabbage DNA to be identified as a template, amplifying a molecular marker, wherein the nucleotide sequence of a primer is shown as SEQ ID No.2 and SEQ ID No. 3;
(2) carrying out enzyme digestion on the amplified product by using restriction enzyme HinfI, and carrying out gel electrophoresis after enzyme digestion to obtain five specific bands of 271-bp, 185-bp, 158-bp, 131-bp and 27-bp;
(3) cabbage plants with four specific bands of 271-bp, 158-bp, 131-bp and 27-bp are homozygous hairy individuals, cabbage plants with three bands of 271-bp, 185-bp and 131-bp are homozygous unhaired plants, and cabbage plants with five specific bands are heterozygous individuals.
4. Use of the molecular marker bol.trichome-caps.02 for identifying the presence of cabbage epidermal hairs as claimed in claim 1 in genetic breeding of cabbage epidermal hairs.
5. Use of the molecular marker bol, trichome-caps.02 for identifying the presence of cabbage epidermal hairs as claimed in claim 1 in breeding cabbage varieties with the presence of epidermal hairs.
6. Use of the cabbage variety identification method according to claim 3 for genetic breeding for the presence or absence of cabbage coat hairs.
7. Use of the cabbage variety identification method according to claim 3 for breeding cabbage varieties having epidermal hair.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910186568.XA CN109706266B (en) | 2019-03-12 | 2019-03-12 | Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910186568.XA CN109706266B (en) | 2019-03-12 | 2019-03-12 | Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109706266A CN109706266A (en) | 2019-05-03 |
| CN109706266B true CN109706266B (en) | 2022-04-01 |
Family
ID=66266640
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910186568.XA Active CN109706266B (en) | 2019-03-12 | 2019-03-12 | Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706266B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164502A (en) * | 2017-06-15 | 2017-09-15 | 西南大学 | The molecular labeling being closely related and its application are whether there is with cabbage leaves epidermal hair |
-
2019
- 2019-03-12 CN CN201910186568.XA patent/CN109706266B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164502A (en) * | 2017-06-15 | 2017-09-15 | 西南大学 | The molecular labeling being closely related and its application are whether there is with cabbage leaves epidermal hair |
Non-Patent Citations (5)
| Title |
|---|
| A GLABRA1 ortholog on LG A9 controls trichome number in the Japanese leafy vegetables Mizuna and Mibuna (Brassica rapa L. subsp. nipposinica L. H. Bailey): evidence from QTL analysis;Yaichi Kawakatsu et al;《J Plant Res》;20171231;第130卷;第539-550页 * |
| Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae;Naghabushana K. Nayidu et al;《PLOS ONE》;20140430;第9卷(第4期);e95877 * |
| Role of TRIPTYCHON in trichome patterning in Arabidopsis;Martina Pesch et al;《BMC plant biology》;20111231;第11卷;第1-14页 * |
| The biochemical composition and transcriptome of cotyledons from Brassica napus lines expressing the AtGL3 transcription factor and exhibiting reduced flea beetle feeding;Margaret Gruber et al;《BMC Plant Biology》;20181231;第18卷(第64期);第1-19页 * |
| 植物表皮毛研究进展;张继伟等;《植物学报》;20181231;第53卷(第5期);第726-737页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109706266A (en) | 2019-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cheema et al. | A novel bacterial blight resistance gene from Oryza nivara mapped to 38 kb region on chromosome 4L and transferred to Oryza sativa L. | |
| Ho et al. | The root‐knot nematode resistance gene (Mi) in tomato: construction of a molecular linkage map and identification of dominant cDNA markers in resistant genotypes | |
| Francia et al. | Two loci on chromosome 5H determine low-temperature tolerance in a ‘Nure’(winter)בTremois’(spring) barley map | |
| JP5281392B2 (en) | Elite event A5547-127 and methods and kits for identifying the event in biological samples | |
| CN100372929C (en) | Glufosinate tolerant rice | |
| Pecrix et al. | Ten broad spectrum resistances to downy mildew physically mapped on the sunflower genome | |
| Mehlenbacher et al. | RAPD markers linked to eastern filbert blight resistance in Corylus avellana | |
| EP1250461A2 (en) | Methods and kits for identifying elite event gat-zm1 in biological samples | |
| AU2001235414A1 (en) | Methods and kits for identifying elite event GAT-ZM1 in biological samples | |
| JP2014522661A (en) | Method for detecting soybean event pDAB9582.881419.1 | |
| CN107619881A (en) | A kind of and SSR marker chain No. 0, No. 1 biological strain resistant gene Bs_t of tobacco black shank and its application | |
| US11578339B2 (en) | Transgenic corn event MON95275 and methods for detection and uses thereof | |
| AU2020233660B2 (en) | Disease resistance loci in onion | |
| Watanabe et al. | Development of a high-density linkage map and chromosome segment substitution lines for Japanese soybean cultivar Enrei | |
| Vikal et al. | Mapping of bacterial blight resistance gene xa8 in rice (Oryza sativa L.) | |
| RU2717017C2 (en) | Molecular markers for blackleg resistance gene rlm2 in brassica napus and methods of use thereof | |
| CN108588264B (en) | Molecular marker and primer for identifying cabbage clubroot disease resistance and application of molecular marker and primer | |
| CN109706266B (en) | Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof | |
| Goto et al. | Mapping of bacterial blight resistance gene Xa11 on rice chromosome 3 | |
| CN115725604A (en) | Rice white leaf and white ear gene wlp3 and application thereof in stress resistance and yield increase of rice | |
| CN106701895A (en) | Haplotype relating to drought resistance of zea mays l. and molecular marker thereof | |
| CN111393516B (en) | Tobacco eISFiso 4E-T mutant and application thereof in cultivation of tobacco with virus resistance | |
| US10793918B2 (en) | Molecular markers for blackleg resistance in canola and methods of using the same | |
| CN108034755B (en) | Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof | |
| CN109777883B (en) | Specific primer of codominant molecular marker of tomato yellow leaf curl virus Ty-2 resistance gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |