CN108034755B - Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof - Google Patents
Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof Download PDFInfo
- Publication number
- CN108034755B CN108034755B CN201810038621.7A CN201810038621A CN108034755B CN 108034755 B CN108034755 B CN 108034755B CN 201810038621 A CN201810038621 A CN 201810038621A CN 108034755 B CN108034755 B CN 108034755B
- Authority
- CN
- China
- Prior art keywords
- rice
- drought
- drought tolerance
- qlri9
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker linked with a rice drought-enduring gene qLRI9 and application thereof in rice drought-enduring identification. The invention utilizes two sets of paddy and upland rice recombinant inbred line populations (RIL) with different genetic backgrounds to successfully position a gene locus qLRI9 related to the drought tolerance of rice on the No. 9 chromosome of the rice, wherein the drought-tolerant favorable allele of the gene is from a drought-tolerant parent IAPAR-9 and linked with a molecular marker RM24598, and the invention provides a method for identifying or assisting in identifying the drought tolerance of the rice based on the molecular marker RM 245998, and can be used for the identification of drought-resistant varieties of the rice and molecular breeding.
Description
Technical Field
The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker linked with a rice drought-enduring gene qLRI9 and application thereof.
Background
The problem of land drought is ubiquitous in the world, and the cultivated land area of arid and semi-arid regions accounts for 42.9 percent of the global cultivated land area. It is statistically significant that over 0.6 billion hectares of rice growing areas are subject to drought stress annually throughout the world, and the resulting yield losses are quite dramatic. In recent years, drought with a wide spread and a long duration often occurs in China, the number of years of drought disasters also increases year by year, the drought gradually becomes a prominent problem affecting agricultural production and has an aggravation tendency, and yield reduction of rice caused by drought is far greater than the sum of yield reduction caused by other environmental factors. The water-saving cultivation technology is a direct method for relieving water resource shortage, but in production practice, the method is the most effective and reasonable way for fundamentally improving the drought resistance of rice by screening and cultivating a new drought-resistant and high-yield rice variety.
Genetic research shows that the drought tolerance of rice is a complex quantitative character, drought tolerance reaction relates to a plurality of genes, obvious interaction effect exists between the genes and the environment, and the drought tolerance level of the rice is difficult to be greatly improved by the traditional breeding method. With the development of molecular biology, it is possible to adopt molecular assisted breeding for agronomic traits that are difficult to identify and susceptible to environment, and the technology can perform accurate and stable selection in early generation, thereby accelerating breeding process and improving breeding efficiency, but the technology is based on the need of having excellent target genes and molecular markers closely linked with the target genes.
Disclosure of Invention
The invention aims to solve the technical problem of how to quickly and accurately identify the drought tolerance of rice. In order to solve the technical problem, the invention utilizes two sets of paddy and upland rice recombinant inbred line populations (RILs) with different genetic backgrounds to successfully position a gene locus qLRI9 related to the drought tolerance of rice on a No. 9 chromosome of the rice, wherein the drought-tolerant favorable allele of the gene locus qLRI9 is from a drought-tolerant parent IAPAR-9 and is linked with a molecular marker RM 24598. The PCR-based practical economical molecular marker RM24598 can be used for identification of drought-resistant varieties of rice and molecular breeding.
In order to solve the technical problems, the invention firstly provides a primer pair for identifying or assisting in identifying the drought tolerance of the rice.
The primer pair provided by the invention consists of a primer A and a primer B;
the primer A is (a1) or (a 2):
(a1) a single-stranded DNA molecule shown in sequence 1;
(a2) a single-stranded DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 1 and has the same function as the sequence 1;
the primer B is (a3) or (a 4):
(a3) a single-stranded DNA molecule shown in sequence 2;
(a4) and (b) a single-stranded DNA molecule obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 2 and having the same function as the sequence 2.
In the primer pair, the molar ratio of the primer A to the primer B is 1: 1.
In order to solve the technical problems, the invention also provides a new application of the primer pair.
The invention provides application of the primer pair in identification or auxiliary identification of drought tolerance of rice.
The invention also provides application of the primer pair in preparation of products for identifying or assisting in identifying drought tolerance of rice.
The invention also provides application of the primer pair in breeding of rice varieties with strong drought tolerance.
The invention also provides application of the primer pair in preparation of products for breeding rice varieties with strong drought resistance.
The invention also provides application of the primer pair in rice breeding.
The invention also provides application of the primer pair in preparation of rice breeding products.
In order to solve the technical problems, the invention also provides a method for identifying or assisting in identifying the drought tolerance of the rice.
The method for identifying or assisting in identifying the drought tolerance of the rice comprises the following steps of: taking the genome DNA of the rice to be detected as a template, and carrying out PCR amplification by adopting the primer pair to obtain a PCR product; and identifying the drought tolerance of the rice to be detected according to the PCR product:
if the size of the PCR product is 110bp, the rice to be detected is or is selected as a rice variety with strong drought tolerance;
if the size of the PCR product is 114bp, the rice to be detected is or is selected as a rice variety with drought tolerance or a rice variety with weak drought tolerance.
In order to solve the technical problems, the invention also provides a method for breeding the rice variety with strong drought tolerance.
The method for breeding the rice variety with strong drought tolerance provided by the invention comprises the following steps: taking the genome DNA of the rice to be detected as a template, and carrying out PCR amplification by adopting the primer pair to obtain a PCR product; and selecting the rice to be tested with the PCR product of 110bp for breeding.
In the above method, the PCR reaction system is as follows: 10 XPCR buffer (containing Mg)2+) 1.0. mu.l, 10mM dNTPMixture 0.25. mu.l, 10 pM/. mu.l primer A0.25. mu.l, 10 pM/. mu.l primer B0.25. mu.l, 0.5U/. mu.l Taq polymerase 0.25. mu.l, 40 ng/. mu.l genomic DNA 1.0. mu.l, ddH2O is complemented to 10 mu l;
the PCR reaction conditions were as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 40s, for 36 cycles; extension at 72 ℃ for 10 min.
In order to solve the technical problem, the invention finally provides a product.
The product provided by the invention is any one of the following products (b1) - (b 3):
(b1) the above primer pair;
(b2) PCR reagents comprising the primer set of (b 1);
(b3) a kit comprising the primer set of (b1) or the PCR reagent of (b 2).
The application of the product in any one of the following (c1) - (c3) also belongs to the protection scope of the invention:
(c1) identifying or assisting in identifying the drought tolerance of the rice;
(c2) breeding rice varieties with strong drought tolerance;
(c3) and (5) breeding rice.
In the above application or method or product, the rice variety with strong drought tolerance is a rice variety with less than 5 leaf curl (leaf curl level); the rice variety in drought tolerance is a rice variety with leaf curl (the grade of leaf curl degree) equal to 5; the rice variety with weak drought tolerance is a rice variety with the leaf curl (the grade of the leaf curl degree) larger than 5. The criterion for the rank of the degree of rice leaf curling was as follows: if the rice leaves are healthy, the grade of the leaf curl degree of the rice is 1; if the rice leaves are curled and the leaves are folded into a V shape, the leaf curling degree of the rice is 3; if the rice leaf is cup-shaped (U-shaped), the leaf curl degree of the rice is 5 grade; if the leaf edges of the rice leaves are combined (in an O shape), the leaf curl degree of the rice is 7; when the rice leaf is completely curled, the degree of leaf curling of the rice is rated as 9.
Compared with the prior art, the invention has the following advantages and effects: 1. the drought-resistant gene of the rice obtained by the invention can be stably expressed under different genetic backgrounds and has strong reliability. 2. Through the screening of the molecular marker closely linked with the drought-enduring gene, the rice variety with strong drought tolerance can be identified and obtained. 3. The molecular marker of the invention can be used for identifying and selecting the genotype of rice in the seedling stage, obtaining individuals carrying excellent drought tolerance allelic variation, overcoming the defects of long time period and the like required by the conventional breeding method, and cultivating a new rice variety with strong drought tolerance.
The invention uses two sets of correlated paddy and upland rice recombinant inbred lines as research groups, excavates drought-tolerant gene loci stably expressed under different genetic backgrounds and molecular markers tightly linked with the drought-tolerant gene loci, and finally discovers a gene locus qLRI9 related to drought tolerance and a molecular marker RM24598 tightly linked with the gene locus on the chromosome 82.24cM position of a rice genome, thereby providing a theoretical basis for rice molecular marker-assisted selective breeding.
Drawings
FIG. 1 is an electrophoretogram of IAPAR-9/autumn light population parent and progeny part individual plant at RM24598 locus. P1 and P2 represent IAPAR-9 and autumn light, respectively; 1-30 represent 30 individuals randomly selected from the population.
FIG. 2 is an electrophoretogram of IAPAR-9/Liaoliu salt 241 parental strain and progeny part single strain at RM24598 site. P1 and P2 represent IAPAR-9 and Liaoning salt 241, respectively; 1-30 represent 30 individuals randomly selected from the population.
FIG. 3 is an electrophoretic spectrum diagram of molecular marker RM24598 for identifying drought tolerance of rice variety. P1 and P2 represent IAPAR-9 and Liaoning salt 241, respectively; 1-10 represent 10 rice varieties for drought tolerance identification.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the quantitative tests in the following examples, three replicates were set up and the results averaged.
The rice varieties in the following examples: the excellent dry rice variety IAPAR-9, the excellent high-yield variety autumn light, Liaosalty 241, flower shell dry rice, large-grain sand, Yunchuan white, Xiaozao, Taibei No. 8, Huangban institute, black big rice, Jinxing No. one, Guichao No. two and Manpidxiang red glutinous rice are all from the national germplasm bank, and the public can apply from the national germplasm bank and obtain the excellent dry rice variety IAPAR-9 for compensation.
Example 1 acquisition of Rice drought tolerance Gene qLRI9 and its closely-linked molecular marker
Positioning of drought-enduring QTL and obtaining of rice drought-enduring gene qLRI9
1. Test material
Crossing good dry rice variety IAPAR-9 from Brazil with good high-yield variety in autumn light, and obtaining F containing 231 strains by single seed crossing method10The recombinant inbred line population (RIL) serves as the mapping population.
2. Genotyping
Test materials are planted in a Beijing Changping test base, young leaves of rice are cut, and whole genome DNA extraction is carried out according to Doyle and Dickson (1987) and a slightly modified cetyl triethyl ammonium bromide method (CTAB). 178 pairs of SSR primers which have good amplification effect, have polymorphism among parents and are uniformly distributed in 12 linkage groups are screened out for identifying the genotypes of the positioned groups.
The PCR reaction system is as follows: 10 XPCR buffer (containing Mg)2+) 1.0. mu.l, 10mM dNTP mix 0.25. mu.l, 10 pM/. mu.l primer 0.25. mu.l, 0.5U/. mu.l Taq polymerase 0.25. mu.l, 40 ng/. mu.l genomic DNA 1.0. mu.l, ddH2Make up to 10. mu.l of O.
The PCR reaction conditions were as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 40s, for 36 cycles; extension at 72 ℃ for 10 min.
And separating the amplification product by 8% polyacrylamide denaturing gel electrophoresis, performing 260V constant-voltage electrophoresis, and performing silver staining to obtain a clear marking band.
3. Drought tolerance identification
The test was conducted in 2014 at the test base of the National Academy of Agriculture and Forestry (NAAFS) of ningxia, located in yinchuan. The tested recombinant inbred line population and the parents thereof are sown in 2014 at 4, 12 and 5 months and are transplanted at 17 days, the steps are repeated for 2 times and are arranged in sequence, 2 rows of regions are arranged, 15 holes are formed in each row, the single-line rice transplanting is carried out, and the rice transplanting specification is 26.7cm multiplied by 13.3 cm. Drought treatment was started at the tillering stage (38 days after transplantation). Leaf curliness was recorded by investigation at 11:00-12:00 am every 7 days from 7 months and 17 days until 9 months and 24 days. Leaf curliness under drought stress was used as an evaluation index, and evaluation was performed in 5 grades according to the following criteria (table 1). Defining the rice variety with the leaf curl (the grade of the leaf curl) less than 5 as the rice variety with strong drought tolerance; defining the rice variety with the leaf curl (the grade of the leaf curl) equal to 5 as the rice variety in drought tolerance; the rice variety having a leaf curl (the grade of the degree of leaf curl) of more than 5 was defined as a rice variety having weak drought tolerance.
TABLE 1 drought tolerance identification criteria
| Grade of leaf curl | Leaf curl degree under field drought | Drought tolerance | |
| 1 | Leaf health | Extremely strong | |
| 3 | The beginning of curling and the leaf turning up (V-shaped) | |
|
| 5 | The leaves are cup-shaped (U-shaped) | In | |
| 7 | Leaf edge joint (in O shape) | Weak (weak) | |
| 9 | Complete leaf curl | Extremely weak |
4. Construction of linkage map and QTL positioning
The Ichimapping 4.0 software is used for constructing the genetic linkage map of the recombinant inbred line population, and the genetic distance between markers is estimated by a Kosambi function (Kosambi et al, 1944). IciMapping 4.0 software is selected for QTL detection, and an LOD value of 2.5 is used as a threshold value of the QTL detection.
The location result of IAPAR-9/autumn light recombinant inbred line population shows that the gene locus qLRI9 which is located at the position of the No. 9 chromosome 82.24cM and is related to drought tolerance is located under a plurality of environments (Table 2), the locus is linked with a molecular marker RM24598, and the allele of the IAPAR-9 of the good upland rice variety from Brazil at the locus can improve the drought tolerance of rice (figure 1).
TABLE 2 location of drought-enduring QTLqLRI9
| QTL | Linkage marker | Genetic distance | LOD value | Group of people |
| qLRI9 | RM24598 | 82.24cM | 4.82 | IAPAR-9/autumn light |
Verification of qLRI9
1. Test material
F containing 228 strains obtained by crossing IAPAR-9 of good upland rice variety from Brazil with Liaoliu salt 241 and single-seed-culture method10The recombinant inbred line population (RIL) was used as the validation population.
2. Genotyping
Test materials are planted in a Beijing Changping test base, young leaves of rice are cut, and whole genome DNA extraction is carried out according to Doyle and Dickson (1987) and a slightly modified cetyl triethyl ammonium bromide method (CTAB). 174 pairs of SSR primers which have good amplification effect, have polymorphism among parents and are uniformly distributed in 12 linkage groups are screened out for identifying the genotypes of the positioned groups.
The PCR reaction system is as follows: 10 XPCR buffer (containing Mg)2+) 1.0. mu.l, 10mM dNTP mix 0.25. mu.l, 10 pM/. mu.l primer 0.25. mu.l, 0.5U/. mu.l Taq polymerase 0.25. mu.l, 40 ng/. mu.l genomic DNA 1.0. mu.l, ddH2Make up to 10. mu.l of O.
The PCR reaction conditions were as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 40s, for 36 cycles; extension at 72 ℃ for 10 min.
And separating the amplification product by 8% polyacrylamide denaturing gel electrophoresis, performing 260V constant-voltage electrophoresis, and performing silver staining to obtain a clear marking band.
3. Drought tolerance identification
The test was conducted in 2014 at the test base of the National Academy of Agriculture and Forestry (NAAFS) of ningxia, located in yinchuan. The tested recombinant inbred line population and the parents thereof are sown in 2014 at 12 days at 4 months, transplanted at 17 days at 5 months, repeated for 2 times, sequentially arranged, and transplanted in 2 rows with 15 holes in each row, and the specification of single-line transplanting is 26.7cm multiplied by 13.3 cm. Drought treatment was started at the tillering stage (38 days after transplantation). Leaf curliness was recorded by investigation at 11:00-12:00 am every 7 days from 7 months and 17 days until 9 months and 24 days. Leaf curliness under drought stress was used as an evaluation index (see Table 1).
4. Construction of linkage map and QTL positioning
The Ichimapping 4.0 software is used for constructing the genetic linkage map of the recombinant inbred line population, and the genetic distance between markers is estimated by a Kosambi function (Kosambi et al, 1944). IciMapping 4.0 software is selected for QTL detection, and an LOD value of 2.5 is used as a threshold value of the QTL detection.
The positioning result of drought-tolerant QTL shows that qLRI9 is positioned again in the IAPAR-9/Liaoling salt 241 recombinant inbred line population (Table 3), and LRIIAPAR-9Represents the mean leaf curl of homozygous plants consistent with the parental IAPAR-9 genotype; LRILiaoshi salt 241The mean leaf curliness of a homozygous plant consistent with the parent Liaosalin 241 genotype is shown, qLRI9 can effectively reduce the leaf curliness of rice under drought stress, and the drought resistance favorable genes are also derived from IAPAR-9 (figure 2). This shows that qLRI9 is a true drought-tolerant gene, and the molecular marker RM24598 is indeed closely linked with qLRI9, and can be applied to rice drought-tolerant molecular marker-assisted selective breeding.
TABLE 3 verification of drought tolerance QTLqLRI9
| QTL | Linkage marker | Group of people | LRIIAPAR-9 | LRILiaoshi salt 241 |
| qLRI9 | RM24598 | IAPAR-9/Liaoning salt 241 | 4.2 | 5.8 |
Thirdly, molecular markers closely linked with the rice drought-enduring gene qLRI9
The molecular marker closely linked with the drought-enduring gene qLRI9 of the rice is an RM24598 molecular marker located on the No. 9 chromosome of the rice, and the nucleotide sequence (5 '→ 3') is as follows:
a forward primer: AACTCCACATGATTCCACCC (SEQ ID NO: 1);
reverse primer: GAGAAGGTGGTTGCAGAAGC (SEQ ID NO: 2).
Example 2 identification method of drought tolerance of Rice
The method for identifying the drought tolerance of the rice to be detected comprises the following steps:
1. extracting the genome DNA of the rice to be detected, and carrying out PCR amplification by using the genome DNA as a template and the RM24598 molecular marker to obtain a PCR product;
the PCR reaction system is as follows: 10 XPCR buffer (containing Mg)2+) 1.0. mu.l, 10mM dNTP mix 0.25. mu.l, 10 pM/. mu.l primer 0.25. mu.l, 0.5U/. mu.l Taq polymerase 0.25. mu.l, 40 ng/. mu.l genomic DNA 1.0. mu.l, ddH2Make up to 10. mu.l of O.
The PCR reaction conditions were as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 40s, for 36 cycles; extension at 72 ℃ for 10 min.
2. Identifying the drought tolerance of the rice to be detected according to the size of the PCR product:
if the size of the PCR product is 110bp, the rice to be detected is or is selected as a rice variety with strong drought tolerance;
if the size of the PCR product is 114bp, the rice to be detected is or is selected as a rice variety with drought tolerance or a rice variety with weak drought tolerance;
the rice variety with strong drought tolerance is a rice variety with the leaf curl (the grade of the leaf curl degree) less than 5;
the rice variety in drought resistance is a rice variety whose leaf curl (the grade of leaf curl degree) is equal to 5;
the rice variety with weak drought resistance is a rice variety with leaf curl (the grade of leaf curl degree) more than 5.
Example 3 application of RM24598 molecular marker in identification of drought tolerance of rice variety
First, test materials
The tested materials are flower shell dry rice, large grain sand, Yunchuan white, millet early, Taibei No. 8, Huangban institute, Heibaogu, Jinxing No. one, Guichao No. two and Manpidxiang red glutinous rice.
Second, drought tolerance identification
The drought tolerance of the test material in step one was identified as in step one, step 3, example 1.
The results are shown in Table 4. As can be seen from the table: among 10 rice varieties, the leaf curliness degrees of Taipei No. 8 and Huangban are both 7 rice varieties with weak drought resistance, the leaf curliness degree of Venus aureus No. 5 is the rice variety with the weak drought resistance, and the other 7 rice varieties have the leaf curliness degrees of Huahuxerogu, Dasha, Yunchuan white, Xiaozao, Heidao, Guichao No. two and Manpidxiang red glutinous rice less than 5 and are all rice varieties with strong drought resistance.
TABLE 4 genotype and leaf curl identification results for the tested rice varieties
| Variety of rice | Size of PCR product | Degree of leaf | Drought tolerance | ||
| 1 | Flower shell | 110bp | 3 | |
|
| 2 | Large | 110bp | 1 | Extremely strong | |
| 3 | Yunchuan Bai (white wine) | |
3 | |
|
| 4 | Millet | 110bp | 1 | Extremely strong | |
| 5 | Taibei No. 8 | |
7 | Weak (weak) | |
| 6 | Yellow | 114bp | 7 | Weak (weak) | |
| 7 | | 110bp | 1 | Extremely strong | |
| 8 | |
|
5 | In | |
| 9 | Guichao No. two | |
1 | Extremely strong | |
| 10 | Manpi fragrant red | 110bp | 1 | Extremely strong |
Third, genotype identification
And (3) extracting the genomic DNA of the test material in the step one, taking the obtained genomic DNA as a template, and carrying out PCR amplification by utilizing an RM24598 molecular marker. The PCR reaction system and the PCR reaction conditions were the same as in step 1 of example 2. The amplification product was separated by 8% polyacrylamide gel electrophoresis using a 260V constant voltage electrophoresis.
The electrophoresis results are shown in FIG. 3. PCR products of Taipei No. 8 and yellow plates (Lane 5 and Lane 6) are amplified to obtain DNA bands with the size of 114bp, and the DNA bands are identified according to the method for identifying the drought tolerance of the rice in the embodiment 2, wherein the Taipei No. 8 and the yellow plates are rice varieties with weak drought tolerance; the DNA band with the size of 114bp is obtained by amplifying the Jinxing I (Lane 8), and the identification is carried out according to the identification method of the drought tolerance of the rice in the embodiment 2, wherein the Jinxing I is a rice variety with the drought tolerance; PCR products of the other 7 rice varieties, namely, Huahudrought paddy, large-grained sand, Yunchuan white, millet early, black paddy, Guichao No. two and Manpidxiang red glutinous rice, are amplified to obtain DNA bands with the size of 110bp, and the DNA bands are all rice varieties with strong drought resistance after being identified according to the method for identifying the drought resistance of the rice in the embodiment 2.
It can thus be seen that: the method for identifying the drought tolerance of the rice is completely consistent with the result of identifying the drought tolerance in the second step. The method for identifying the drought tolerance of the rice is accurate and reliable.
Sequence listing
<110> institute of crop science of Chinese academy of agricultural sciences
<120> molecular marker linked with rice drought-resistant gene qLRI9 and application thereof
<160>2
<170>PatentIn version 3.5
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
aactccacat gattccaccc 20
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gagaaggtgg ttgcagaagc 20
Claims (2)
1. A method for identifying or assisting in identifying drought tolerance of rice comprises the following steps: taking the genome DNA of rice to be detected as a template, and carrying out PCR amplification by adopting a primer pair consisting of a sequence 1 and a sequence 2 to obtain a PCR product; and identifying the drought tolerance of the rice to be detected according to the PCR product:
if the size of the PCR product is 110bp, the rice to be detected is or is selected as a rice variety with strong drought tolerance; if the size of the PCR product is 114bp, the rice to be detected is or is selected as a rice variety with drought tolerance or a rice variety with weak drought tolerance.
2. A method for breeding a rice variety with strong drought tolerance comprises the following steps: taking the genome DNA of rice to be detected as a template, and carrying out PCR amplification by adopting a primer pair consisting of a sequence 1 and a sequence 2 to obtain a PCR product; and selecting the rice to be detected with the PCR product size of 110bp for drought-enduring breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810038621.7A CN108034755B (en) | 2018-01-16 | 2018-01-16 | Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810038621.7A CN108034755B (en) | 2018-01-16 | 2018-01-16 | Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108034755A CN108034755A (en) | 2018-05-15 |
| CN108034755B true CN108034755B (en) | 2020-05-08 |
Family
ID=62096783
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810038621.7A Expired - Fee Related CN108034755B (en) | 2018-01-16 | 2018-01-16 | Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108034755B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047891A (en) * | 2016-06-27 | 2016-10-26 | 中国农业科学院深圳农业基因组研究所 | Gene QDTY 2.9IR66897B capable of obviously increasing rice reproductive-stage drought tolerance and molecular marker method thereof |
-
2018
- 2018-01-16 CN CN201810038621.7A patent/CN108034755B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047891A (en) * | 2016-06-27 | 2016-10-26 | 中国农业科学院深圳农业基因组研究所 | Gene QDTY 2.9IR66897B capable of obviously increasing rice reproductive-stage drought tolerance and molecular marker method thereof |
Non-Patent Citations (3)
| Title |
|---|
| Marker assisted selection for genetic improvement of drought tolerance in hybrid rice (Oryza sativa L.);Aziza A. Aboulila;《International Journal of Biotechnology Research》;20150430;第3卷(第3期);第46页右栏第3段和表3 * |
| QTL for grain yield under water stress and non-stress conditions over years in rice (Oryza sativa L.);Sunil Kumar Verma等;《Australian Journal of Crop Science》;20141231;第8卷(第6期);第916-926页 * |
| 水稻苗期耐旱性基因位点及其互作的分析;滕胜等;《遗传学报》;20021231;第29卷(第3期);第235-240页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108034755A (en) | 2018-05-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105385697B (en) | Sesame inflorescence finite basis is because of Sidt1 and its SNP marker | |
| CN103952402B (en) | A kind of SNP site relevant to root system of plant proterties and application thereof | |
| Foroni et al. | Identification of ‘Sorrento’walnut using simple sequence repeats (SSRs) | |
| CN108486276B (en) | Pepper maturity SNP molecular marker and application thereof | |
| CN101138313A (en) | Maize inbred line resistant to MRDV bred by using molecule making | |
| Xu et al. | Fine mapping a QTL for carbon isotope composition in tomato | |
| Maulana et al. | Sorghum landrace collections from cooler regions of the world exhibit magnificent genetic differentiation and early season cold tolerance | |
| CN105219858B (en) | Grain Weight in Common Wheat gene TaGS5 3A single nucleotide polymorphisms and its application | |
| CN104711254B (en) | The low-phosphorous responsive genes ZmARF31 of corn INDEL molecular labelings and its application | |
| CN110607388A (en) | Wheat stripe rust resistant gene related SNP molecular marker in adult stage, primer and application thereof | |
| CN107586874A (en) | For identifying primer pair and its application of capsicum yellow flower pesticide character | |
| CN109762928B (en) | Molecular marker related to melon vine length and application of molecular marker in identification of melon vine length characters | |
| CN108690883B (en) | Molecular marker RMD7 for assisting in identifying soybean powdery mildew resistance of soybean to be detected | |
| KR20220007592A (en) | Powdery Mildew Resistant Capsicum Plants | |
| CN104946630B (en) | Disease-resistant linkage molecular marker for cucumber target spot disease and special primer and application thereof | |
| CN111635958B (en) | Molecular marker linked with rice cold-resistant gene qSF12 and application thereof | |
| CN108034755B (en) | Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof | |
| CN113943732A (en) | SNP (Single nucleotide polymorphism) marker related to heat resistance of cucumber in adult stage, primer group, kit and application | |
| CN105624277B (en) | Method for obtaining molecular marker closely linked with tobacco plant height development character | |
| JP2018057374A (en) | Xanthomonas resistant Brassica oleracea plants | |
| CN110643728B (en) | Method for improving breeding efficiency of poplar crossbreeding | |
| Jaldhani et al. | Present status and future prospects of drought tolerance in rice | |
| CN108504770B (en) | CAPS marker closely linked with cowpea rust-resistant gene and application thereof | |
| CN105385772B (en) | Primer for screening wheat leaf rust resistance QTL and its application | |
| CN112575101A (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200508 Termination date: 20210116 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |