CN101138313A - Maize inbred line resistant to MRDV bred by using molecule making - Google Patents

Abstract

The present invention discloses a corn inbred method for selecting the anti-rough dwarf disease corns which utilizes the molecule marking at the rough dwarf disease resistance points of corns, i.e. the molecule marks on the three points from the inbred rough dwarf disease resistant corns are applied for rough dwarf disease resistant corns breeding and gene pyramiding breeding. The rough dwarf disease resistant and rough dwarf disease sensing corns are taken as the materials for building and separating the groups; the closely linked molecule marks of umc1656, bnlg2191, umc1401, umc1666, bnlg1823 and umc1268 of three rough dwarf disease resistant gene points are used for auxiliary choice; plants with three or two disease resistant gene points are taken as the chosen material for backcrossing and inbreeding; with the comprehensive choice and homozygosis, the high-quality inbred corns of the high property of rough dwarf disease resistance are obtained.

Description

Utilize the corn inbred line of the anti-rough dwarf disease of molecular selection

Technical field

The invention belongs to corn breeding and plant biological engineering field, specifically, relate to a kind of method of corn inbred line of the anti-rough dwarf disease of molecular selection that utilizes MRDV resistance site.

Background technology

The progress of MRDV:

1, MRDV harm and pathogenic factor

(Maize Rough Dwarf Disease MRDD) is a kind of virus disease of serious harm Maize Production to MRDV.The symptom of MRDV is that transparent dotted line point is arranged between the thready pulse of spire Zhong Mai both sides, and later transparent point increases gradually, produces the wax projection that thickness differs on the vein of leaf back, and hand has been touched tangible harsh feeling; The diseased plant plant stunts, and internode shortens; The leaf look dark green; The short wide plumpness of blade, stiff standing upright often has gauffer; Female tassel depauperation, severe patient can not be solid.

MRDV was found in Italy first in 1949, after this in south American countries such as European countries such as France and Argentina in various degree generation was arranged all.1954 first in the Xinjiang of China south, the western MRDV of finding in Gansu.Since the seventies in last century, MRDV in North China, the some areas in northwest and northeast cause that large tracts of land is ruined kind or total crop failure, become the important disease of Maize Production.So far China has reported 13 of province's municipalizations that MRDV took place.According to incomplete statistics in 1996, national MRDV onset area 2,330,000 hm ², 40,000 hm have no harvest ², the general diseased plant rate about 40%, average 10%～30% in grave illness district.2006, the provinces and regions large tracts of land took place MRDV in Shandong, Hebei etc. again, causes greater loss.

MRDV poison (maize rough dwarf virus, MRDV), (rice black-streaked dwarf virus RBSDV) is three kinds of cause of diseases that can cause MRDV of hitherto reported for Mal de R í o Cuarto virus (MRCV) and rice black-streaked dwarf virus.Wherein MRDV poison and Mal de R í o Cuarto virus are respectively the cause of diseases of Europe and South America MRDV.These three kinds of viruses all belong to second group that the Reoviridae Fijivirus belongs to.The three is closely similar at viral particle morphology, host range, vector, serology and aspects such as genome electrophoresis and sequence.They are all propagated by plant hopper, all are confined to phloem after infecting plant.In China, once there was arguement for the MRDV cause of disease.Gong ancestral an ancient egg-shaped, holed wind instrument was similar to the rice black-streaked dwarf virus that the sixties, the East China took place with electron microscopic observation to Baoding, Hebei province MRDV cause of disease form and size in 1981, and complete viral diameter 70-75nm removes housing diameter 65nm.Calendar year 2001, Chinese scholar has reported successively that according to the genome sequence column information of viral isolates the cause of disease that causes the Chinese maize rough dwarf disease is rice black-streaked dwarf virus rather than MRDV poison.Under equal conditions carry out relatively qualification result of biology and molecular biology according to Baoding and Wuhan MRDV separator and Zhejiang black streaked dwarf virus of rice separator, show its host range and correlation, main host plants symptom, amboceptor insect and pass the disease characteristic, the cause of disease form is all identical, the nucleotide of three's genomic fragment S7-S10 and the autoploidy of amino acid sequence are respectively 94.0%～99.0% and 96.3%～100%, very near with the affiliation of Japanese RBSDV, far away slightly with the relation of Italian MRDV.2003, imperial court's brightness etc. was finished the genome complete sequence determination and the function prediction analysis of RBSDV Hubei corn separator, proves that further China's MRDV and black streaked dwarf virus of rice cause of disease are all RBSDV.

In China, RBSDV is mainly propagated by Homoptera insect small brown rice planthopper (Laodelphax striatellus Fallen).RBSDV propagates without soil, seed, pollen, grafting and branches and leaves friction.Small brown rice planthopper belongs to the temperate zone insect, and is widely distributed in China, and more with North China winter wheat district and the generation of middle and lower reach of Yangtze River rice district, the optimum temperature of growing is 15～28 ℃.It takes place to be subjected to from generation to generation geographical and weather restricts, and algebraically took place progressively increased to for 8 generations by 3 generations in China from north orientation south in 1 year.The host of small brown rice planthopper is mainly gramineous plants, and the most suitable host is paddy rice, wheat etc.Corn, millet, Chinese sorghum etc. are non-suitable living host, and adult is got food thereon, but seldom lay eggs and hatch.Small brown rice planthopper does not have poisonous insect and inhales juice obtain poison on the plant that has infected RBSDV, obtains the shortest 1h of malicious required time, and majority is 24～48h.Obtaining the required temperature of poison minimum is about 8 ℃.Follow the back phase of virus in polypide was generally 3～35 days.Under the thermophilic condition, the phase of following back raises with temperature and shortens, and when 24 ℃ of mean temperature of air, the shortest 2h can pass poison, and 48h can fully pass poison.Small brown rice planthopper can not pass poison after having poisonous insect band poison all the life, but can not be delivered to the next generation through ovum.At " wheat-corn " growing area, the first generation small brown rice planthopper band poisonous insect of taking place on the wheat plant is the main source of infection that causes MRDV popular.Its disease cycle process is: first generation striatellus imago was got to eat on overwintering host and was obtained poison spring, then to the milpa migration, formed the peak of migrating during the harvesting wheat, the MRDV onset peak occurred in about about 21 days behind the migration peak.2nd, 3,4 generation small brown rice planthopper transfer wheatland and limit, field weeds, pass poison and also in wheat seeding or thick grass, survive the winter.

Establishing in large scale crossbreed not disease-resistant or the resistance difference is the major reason that causes MRDV popular.Liu Zhizeng etc. have carried out the evaluation of rough dwarf disease resistance to 96 parts of corn inbred lines and by 136 hybrid combinations of these inbred line assembly.The result shows, in the inbred line of identifying major part show as susceptible or in anti-, it is high anti-to have only 6 inbred lines to show as, and does not find immunization type.In hybrid combination, sense or high sense during the crossbreed overwhelming majority of production usefulness shows as, as tuck in single No. 2, tuck in single 12, Yedan No.13, tuck in single 19 and beautiful No. 3 of west etc., they are main breeds of the MRDV district occurred frequently nineties in last century.

2, the genetic analysis of evaluation of the disease resistance of MRDV and resistance

The classification of relevant MRDV degree of being in a bad way has many reports, but standard is not the same, lack unified degree of being in a bad way grade scale and disease resistance evaluation criterion, the complexity that this has reflected the MRDV symptom has caused the difficulty of disease-resistant gene Position Research to a certain extent.

1986, the auspicious grade of old xun, one of the Eight Diagrams was divided into the 0-4 level with plant height, female tassel shape, loose powder situation, leaf symptom etc. with the degree of being in a bad way of MRDV.1996, Liu Zhizeng etc. were divided into 0～3 grade according to plant height and leaf symptom with diseased plant.1998, Zhang Huikong etc. carried out sample analysis to 256 MRDV diseased plants, according to the single-strain grain weight loss, had formulated 6 grades of grade scales.2005, Miao Hongqin was a foundation with the classical symptom of disease, had formulated 5 grades of grade scales.2006, Lu Yingui is by the mensuration to plant height and single plant yield after 3 corn varieties infection such as agricultural university 108, Zheng Dan 958 and moral jade 18 MRDV, set up MRDV severity grade scale by the ratio of diseased plant and healthy tree plant height, promptly detecting the plant height of plant and the ratio of healthy tree plant height was respectively 1,4/5,2/3,1/2,1/3 o'clock, the sick level of corresponding plant is followed successively by 0,1,2,3,4 grade, and the production loss rate of 0-4 level plant is followed successively by 0,25%, 50%, 75% and 100%.

In recent years, some scholars have carried out the work that the anti-rough dwarf disease of corn variety is identified successively.These work mainly are to identify by field natural occurrence, and artificial infection is identified also a small amount of report.In conjunction with the work that the rough dwarf disease resistance is identified, the genetic development research of MRDV resistance is also carried out simultaneously.Nineteen ninety-five, Guo Qitang etc. identify by field corn rough dwarf disease resistance, find to have tangible resistance difference between kind and inbred line.Do not find diseased plant too single morning 12, and too 9101 * too 9102 diseased plant rate are 4.7%, and Jin Sui 47 * D358 is 9.6%, and capital single 901 is 11.8%, and A343 * pellet 340 is 17%.185 parts of inbred lines have been observed, the material of wherein high anti-(incidence of disease is less than 10%) has 9 parts: Ji 8, combine 3, middle yellow 64, GY237 etc., and find that the choosing from different germplasm materials is that disease resistance is widely different, disease-resistant system is respectively 70% and 55% in offspring of pioneer colony and the offspring's of subtropics colony the choosing system, and wherein high anti-material accounts for more than 30%; MRS (U.S. crossbreed) selects the high disease-resistant system of based material to account for 9.7%, and 5003 19 parts derive and only have 1 part to be disease-resistant in being.Disease resistance analysis by to the hybrid combination of inbred line preparation draws the inbred line disease resistance offspring is had significant heritability.Basso etc. have carried out Analysis of Combining Ability in four class natural occurrence districts to the MRDV resistance, detect the performance that dominant effect and additive effect significantly restrict resistance, and the general combining ability of inbred line is occupied larger specific gravity in inherent cause.1996, Liu Zhizeng etc. have carried out anti-rough dwarf disease to 96 parts of inbred lines and 136 parts of hybrid combinations to be identified, the most of inbred line performance of result susceptible or in anti-, have only 6 parts of materials performances high anti-.The disease resistance of external germplasm is better than domestic germplasm generally.The crossbreed disease-resistant variety of production usefulness is seldom felt in the overwhelming majority performance or high sense.Closely related in crossbreed disease resistance and the parents' disease resistance, the disease resistance major part of hybrid combination seldom has super close phenomenon to occur, and infers that the MRDV resistance is a quantitative character between parents.Lu Yingui etc. have carried out the rough dwarf disease resistance to 69 parts of corn inbred lines of 78 parts of anti-MRDV recombinant inbred strain materials introducing from the U.S. and domestic seed selection to be identified naturally in the Baoding.The result shows, in the material of introducing, 2 parts of performances are high anti-, and 6 parts of performances are anti-, and 5 parts anti-in showing as, and demonstrated rough dwarf disease resistance preferably.No high anti-material in 69 parts of inbred lines at home; 178, P138,901141,9138, Shen 137 performances are anti-, neat 319,87-1, combine 3, Ji 35, obtain in Tang and 2379 performances anti-.Result of the test illustrates that also being selected from the inbred line resistance that the U.S. 78599 is does very well.Wang Anle etc. utilize 6 inbred lines to analyze the effect of directed recurrent selection to the anti-rough dwarf disease improvement of corn, think that the anti-rough dwarf disease proterties of corn is a quantitative character, and the additive effect of minor-polygene account for larger specific gravity in trait expression.

For this viroids venereal disease of MRDV evil, a situation arises has obvious differently in different year and different regions disease, carries out the plant disease resistance and identify that naturally difficulty is bigger.Therefore, it is necessary to set up MRDV artificial infection authenticate technology.The artificial infection technology can guarantee the cause of disease of MRDV and the continuity and the repeatability of disease resistance evaluation work reliably.1998, Wang Anle etc. utilize net canopy control small brown rice planthopper to pass poison, and 50 corn inbred lines have been carried out the rough dwarf disease resistance identified, be the incidence that parameter is investigated each material with the plant height, calculate disease-resistant index, obtained identifying stable, reliable result than natural occurrence.2005, residence of a high official pad equality was carried out the inoculation of net cage group by being with malicious small brown rice planthopper.The result shows that this inoculation method can realize the large batch of artificial infection of scale in conjunction with plantlet of transplant.

Using disease-resistant variety is the method for preventing and treating the time saving and energy saving economical and efficient of virus disease, and has avoided the pollution of agricultural chemicals to environment.Therefore, the inbred line and the crossbreed of screening and cultivation high-resistance corn rough dwarf disease have great importance from corn germ plasm resource.In recent years, China corn breeding person has carried out resistance screening work, has identified the inbred line of some high-resistance corn rough dwarf diseases, as P20, P138, neat 319 etc.The breeder of academy of agricultural sciences, Hebei is used to be material from 78599 of the U.S., selects the inbred line 90110 of high-resistance corn rough dwarf disease.Utilizing existing disease-resistant germ plasm resource cultivation high-yield disease resisting inbred line and crossbreed is urgent problem in China's agricultural production.And traditional breeding way length not only consuming time, need great amount of manpower and material resources, and be limited by disease resistance and identify factors such as difficulty, produce effects slowly.Utilize molecular biology method, the enantiopathy gene carries out molecular labeling location, not only can in depth study the disease-resistant genetic development and the disease-resistant mechanism of rough dwarf disease, for the clone of disease-resistant gene lays the foundation, and can shorten breeding time greatly by molecular marker assisted selection, improve breeding efficiency.

3, MRDV disease-resistant gene Position Research

Maize diseases is the key factor that influences Maize Production, adopts molecular labeling to carry out disease-resistant gene mark and the existing extensive work of Position Research in recent ten years.At present, the existing mostly report of the disease-resistant gene of external important maize diseases or QTL Position Research is as leaf blight, helminthosporium maydis, wilt disease, gray leaf spot, common rust, southern rust, ear rot, head smut, dew bacterium disease, corn short mosaic disease, mosaic of sugarcane, maize mosaic, corn stripe disease, corn yellow dwarf, corn spot stripe and altitude sickness viral disease.Chinese scholar utilizes domestic corn material to locate a collection of disease-resistant gene, and as corn short mosaic disease, leaf blight, banded sclerotial blight, southern rust and stem rot etc., but the research of relevant MRDV disease-resistant gene yet there are no report both at home and abroad.

According to the report of enantiopathy gene location, can find some problems: 1) utilize different hybrid combination may obtain different positioning results; 2) under different environment, carry out the disease resistance evaluation and may obtain different positioning results; 3) different Q TL mapping population type may influence the QTL positioning result; 4) evaluation of antagonism characteristic of disease is the vital factor that influences gene location.The accurate evaluation difficulty of milpa rough dwarf disease resistance is big.The MRDV artificial infection identification system that the applicant laboratory is set up and the fluorescence quantitative RT-RCR detection technique of cause of disease can identify accurately, reliably that whether the plant in the segregation population falls ill.

In this laboratory, identify two kinds of methods naturally by artificial infection evaluation and field, to tucking in the F that 478 hybridization obtain by anti-inbred line 90110 of height and high sense inbred line ₂Colony, BC ₁Colony and part recombinant inbred lines have carried out the disease resistance evaluation, have obtained the qualification result of good reproducibility, and this has laid solid foundation for the location of resistant gene.In order to find the molecular labeling chain with the MRDV resistant gene apace, the applicant has carried out the SSR-BSA analysis.The DNA mixed in equal amounts of the disease-resistant plant of 15 strain F2 is formed the anti-pond of F2, and the DNA mixed in equal amounts of the typical disease plant of 10 strain F2 is formed F2 sense pond; 15 strain BC ₁The DNA mixed in equal amounts of disease-resistant plant form BC ₁Anti-pond, 15 strain BC ₁The DNA mixed in equal amounts of typical disease plant form BC ₁The sense pond.Detect F with the SSR mark that makes up molecular marker linkage maps ₂Anti-pond and F ₂The sense pond, and then be used in F ₂Anti-pond and F ₂Show polymorphic SSR mark between the sense pond and detect BC ₁Anti-pond and sense pond.For at BC ₁Anti-pond and sense show polymorphism and and F between the pond ₂The corresponding to mark of polymorphism between anti-pond and the sense pond determines that tentatively this mark may be chain with resistant gene.The result has 4 SSR to be marked at F ₂Anti-pond and the sense pond between, BC ₁Anti-pond and sense all show polymorphism between the pond, and at BC ₁Anti-pond and sense between the pond polymorphic with its at F ₂Anti-pond and sense polymorphic consistent between the pond.These four are labeled as: the umc1656 (bin6.02 district) on No. 6 chromosome, umc1401 (bin7.02 district) on No. 7 chromosome, bnlg1823 (bin8.07 district) and umc1268 (bin8.07 district) on No. 8 chromosome, wherein bnlg1823 and umc1268 are adjacent marks.Be about to MRDV resistance site (gene) Mrdd1 and navigated to the bin6.02 district, the Mrdd2 site has been navigated to the bin7.02 district, Mrdd3 has navigated to the bin8.07 district.Because these 4 marks lay respectively on 6,7,8 chromosomes, further analysis draws and may have 3 the disease-resistant sites of MRDV, i.e. Mrdd1, Mrdd2 and Mrdd3 in the inbred line 90110 at least.

On above working foundation, 150 F that identify through disease resistance have been detected ₂The genotype of individual plant.By being divided between more disease-resistant site and each the SSR mark, 3 disease-resistant gene sites have been navigated on the chromosome from ratio.When the Mrdd1 site is located, 21 F ₂Individual plant is not inconsistent in the genotype and the plant phenotype in Mrdd1 site (promptly judges that from the genotype in this site plant should be susceptible type, but plant shows tangible disease resistance, this is owing to the MRDV resistance is to be determined by multiple gene, the resistant gene in other site has determined the disease resistance of plant probably) be eliminated, have 129 F altogether ₂The data of individual plant are used for the coseparation analysis (table 1) of Mrdd1 site and near its mark.In 5 SSR marks on selected No. 6 chromosomes, umc1656 is the mark nearest with the Mrdd1 site, between the two to be divided into from ratio be 98.1%.According to being divided between Mrdd1 site and 5 the SSR marks from ratio, the Mrdd1 site is navigated between mark umc1656 and the bnlg2191, the genetic distance in the F2 molecular marker linkage maps between umc1656 and the bnlg2191 is 4.5cM.

Table 1, F ₂The coseparation analysis in Mrdd1 site in the colony ^a

Mark and site	Mrdd1	Umc1006	umc1083	umc1656	bnlg2191
						umc1006 umc1083 umc1656	87.9％ 89.6％ 98.1％	97.7％ 89.2％	91.7％

bnlg2191 umc1595

97.6％ 92.3％

85.1％ 80.2％

87.9％ 83.5％

95.8％ 91.3％

95.7％

^aChoose near 5 SSR marks of Mrdd1 site and detected 150 F ₂Individual plant, 129 strain F ₂The data of individual plant are used for coseparation analysis.

When Mrdd2 site, location, 24 F ₂The data of individual plant have 126 F altogether because they are not inconsistent in the genotype in Mrdd2 site and plant phenotype is eliminated ₂The data of individual plant are used for the coseparation analysis (table 2) of Mrdd2 site and near its mark.Among 4 SSR marks on selected No. 7 chromosomes, umc1401 is the mark nearest with the Mrdd2 site, between the two to be divided into from ratio be 94.5%.According to being divided between Mrdd2 site and this 4 SSR marks, the Mrdd2 site is navigated between mark umc1401 and the umc1666, at F from ratio ₂Genetic distance in the molecular marker linkage maps between umc1401 and the umc1666 is 11.1cM.

Table 2, F ₂The coseparation analysis in Mrdd2 site in the colony ^a

Mark and site	Mrdd2	umc1695	umc1401	umc1666
					umc1695 umc1401 umc1666 umc2141	84.6％ 94.5％ 93.3％ 87.7％	89.6％ 78.4％ 72.2％	88.6％ 82.6％	93.8％

^aChoose near 4 SSR marks of Mrdd2 site and detected 150 F ₂Individual plant, 126 strain F ₂The data of individual plant are used for coseparation analysis.

When Mrdd3 site, location, 24 F ₂The data of individual plant are not because they are inconsistent in the genotype in Mrdd3 site and plant phenotype is eliminated.Have 126 F altogether ₂The data of individual plant are used for the coseparation analysis (table 3) of Mrdd3 site and near its mark.Among 5 SSR marks on selected No. 8 chromosomes, bnlg1823 is the mark nearest with the Mrdd3 site, between the two to be divided into from ratio be 97.8%.According to being divided between Mrdd3 site and this 5 SSR marks, the Mrdd3 site is navigated between mark bnlg1823 and the umc1268, at F from ratio ₂Genetic distance in the molecular marker linkage maps between bnlg1823 and the umc1268 is 5.8cM.

Table 3, F ₂The coseparation analysis in Mrdd3 site in the colony ^a

Mark and site	Mrdd3	umc1728	umc2014	bnlg1823	umc1268
						umc1728 umc2014 bnlg1823 umc1268 umc1032	78.8％ 89.8％ 97.8％ 94.3％ 88.0％	91.0％ 81.3％ 73.2％ 69.3％	90.0％ 85.1％ 77.3％	93.8％ 84.4％	91.1％

^aChoose near 5 SSR marks of Mrdd3 site and detected 150 F ₂Individual plant, 126 strain F ₂The data of individual plant are used for coseparation analysis.

4, crop molecular mark present Research

In crop breeding, effective choice method is directly to select according to the genotype of plant, molecular labeling appear as that this direct selection provides may.Molecular marker assisted selection (MAS) thus can carry out accurate, stable selection to target gene in generation early and quicken breeding process, improve breeding efficiency.The key of this technology is to detect with the excavation of the closely linked dna molecular marker of Main Agronomic Characters and high flux.In recent years, the various countries scholar has identified the molecular labeling of a series of economical characters of paddy rice, wheat, corn, cotton, Soybean and Other Crops, and this lays a good foundation for MAS.Wu behaves etc., Moreau etc., Berloo etc. deliver method and the influence factor that many pieces of research papers have been set forth MAS respectively with Hospital etc., and this enforcement for MAS provides theoretical support.MAS comprises that it is foreground selection (foreground seleetion) and to the selection (background selection) of genetic background that target gene is followed the tracks of.The reliability of foreground selection depends primarily on the chain tightness degree between mark and the target gene.If only with a mark target gene is selected, when requiring to select accuracy to reach more than 90%, then the recombination fraction of mark and target gene is less than 5%.If target gene is followed the tracks of selection, can improve the selection accuracy greatly with the both sides adjacent marker.Background is selected can accelerate genetic background resume speed, shortening the breeding cycle and alleviate chain burden.Tanksley etc. draw by computer simulation analysis, adopt MAS only to need for 3 generations can make hybrid return to genotype near recurrent parent.At present, MAS uses in the breeding practice of chief crops such as paddy rice, wheat, corn and has obtained bigger progress, mainly comprises gene transfer, gene pyramiding and quantitative character MAS.The International Rice Research Institute utilizes 4 to contain different bacterial blight of rice resistant genes (xa4, xa5, xa13, xa21) near-isogenic line and carry out the polymerization of resistant gene, and the strain of the resistant gene that is produced accumulation has higher resistance level and the anti-spectrum wider to pathogen than the strain that contains single resistant gene.Chen Sheng etc. are donor material with IRBB21, utilize 4 to carry out the auxiliary improvement of molecular labeling with the closely linked molecular labeling of Xa21 to ' bright extensive 63 ', have obtained bacterial blight-resisting ' bright extensive 63 '.Xue Qing is medium, Huang Tingyou etc., Peng Yingcai etc., virgin naval etc., Cao Liyong etc., Luo Yanchang etc. are respectively by hybridization with backcross, the binding molecule marker assisted selection, this gene is imported in the different parental rices, select the new restorer line and the male sterile line of a collection of bacterial blight-resisting, and further combo bred association excellent 218, in disease-resistant hybrid rice such as excellent 8220, the state rice of excellent 218, II No. 1 newly make up.In addition, aspect such as, blast resisting pest-resistant in paddy rice has also obtained certain progress.The molecular marker assisted selection work that with the corn is material is less relatively, but achieves striking.American scholar some quantitative trait locus bit transitions that corn is relevant with output have arrived in the inbred lines such as B73 and Mo17, improve more than 15% by the yield increased crossbreed of the crossbreed of these inbred line assembly.Utilization such as Zhang Shihuang and the closely linked molecular labeling of opaque-2 gene have carried out the molecular marker assisted selection of high-quality protein maize, set up the economical and practical high-quality protein maize molecular mark new system of a cover.A large amount of theoretical researches and breeding practice have proved that molecular marker assisted selection is the developing direction of plant breeding technique.

In general, the molecular marker assisted selection breeding is more obvious for the selection effect that is subjected to the less qualitative character of such environmental effects that those effects by controlled by multiple genes, serious complex character affected by environment are compared to single-gene control.MRDV is exactly the complex character that a kind of disease resistance is identified difficulty, no matter the conventional breeding method is to identify or identify disease resistance by artificial infection by field natural occurrence, in anti-rough dwarf disease inbred line of seed selection and crossbreed all be waste time and energy produce effects not good.Use the efficient that molecular marker assisted selection is expected to improve the rough dwarf disease breeding for disease resistance.Have not yet to see the report that adopts molecular marker assisted selection to cultivate anti-rough dwarf disease corn inbred line.

Summary of the invention

The present invention depends on 2 basic research works: 1) tucking in 478 with the key inbred line of China corn of height sense MRDV be female parent, is male parent structure mapping population with the inbred line 90110 of high-resistance corn rough dwarf disease, gets its F ₂150 individual plants make up molecular marker linkage mapses.In the mark of 278 performance polymorphisms, there are 271 marks to be divided in 10 linkage groups.This collection of illustrative plates covers corn gene group (length overall) 2164.3cM, and average distance is 7.98cM between mark, has formed inbred line and has tucked in 478 * 90110 molecular labeling locking frame figure, is applicable to the positioning analysis of corn major gene resistance location and QTL.In this work, in order accurately to judge milpa rough dwarf disease resistance, at first utilize solarium colony inoculation method to study the influence of the developmental stage (leaf age) of corn, the insect density of inoculating and inoculation duration respectively to rough dwarf disease artificial infection identification result, and utilize ELISA and real-time RT-PCR to identify cause of disease, analyzed the viral level in the different plants, set up stable MRDV artificial infection identification system, in conjunction with field nature qualification result, to F in the mapping population ₂The disease resistance of individual plant has been carried out reliable evaluation.2) tuck in 478 and the F that makes up of inbred line 90110 hybridization with inbred line ₂Colony and BC ₁Colony is as target group, Mrdd1 site, disease-resistant site is positioned in the zone of 4.5cM between the umc1656 of bin6.02 and the bnlg2191, the Mrdd2 site is positioned in the zone of 11.1cM between the umc1401 of bin7.02 and the umc1666, the Mrdd3 site is positioned in the zone of 5.8cM between the bnlg1823 of bin8.07 and the umc1268, and verifies with recombinant inbred lines.In addition, determined that by association analysis anti-rough dwarf disease genetic locus is from 90110 in the colony of " tucking in 478 * 90110 ".

Vegetable material of the present invention

The high anti-inbred line 90110 of MRDV, susceptible inbred line tuck in 478,488 and the inbred line, DH4866, the DH9942 that derive from, tuck in 502, tuck in 515, the F of the superior corn inbred line of sense MRDV such as lucky 853, Zheng 58 and middle breeding material and sense rough dwarf disease corn inbred line and inbred line 90110 structures _2-6Plant, F _2-4BC _1-3Plant.F _2-6Plant represents to feel the rough dwarf disease corn inbred line and high anti-inbred line 90110 is hybridized the back selfings plant in 2～6 generations, F _2-4BC _1-3Plant represent to feel rough dwarf disease corn inbred line and high anti-inbred line 90110 hybridization back selfing algebraically be 2～4 and with the backcross plant in 1～3 generation of sense rough dwarf disease inbred line (recurrent parent).When obtaining hybrid F1,90110 and sense rough dwarf disease inbred line all can be used as female parent or male parent.When backcrossing, sense rough dwarf disease inbred line can be used as male parent, also can be used as female parent.

The plant disease resistance is identified

The plant disease resistance is identified and is adopted artificial infection evaluation and field natural occurrence to identify the strategy that combines.Reported method (2006) such as adopting Wang Fei is identified in artificial infection, 15 small brown rice planthopper inoculations of promptly every strain two leaf stage milpa, seed stage 5 days.The poison source is the typical MRDV disease plant in field.15 strains are identified in each genotype inoculation, establish 3 repetitions.At plant blossom phase investigation incidence.The natural occurrence expert evidence generally May early and middle ten days sow at twice, more weeds are arranged around the sample plot.In disease resistance is identified, be disease-resistant contrast, tuck in 478 and be the contrast of sense rough dwarf disease with inbred line 90110.In identify naturally in the field, general every each genotype 30 strain that repeat to plant.Arrange by district's group at random the test region is set.The long 4.0m of row plants 15 strains, line-spacing 75cm, and the test region is use of insecticide not, does not weed a garden, and water and fertilizer management carries out routinely.Investigate incidence in flowering stage.The incidence of disease is disease-resistant material in 0～10.0% strain, and the incidence of disease is susceptible inbred line in 10.1%～100% selfing.Can utilize real-time RT-PCR to identify cause of disease, analyze the viral level of different plants, determine qualification result.Viral level measure to adopt fluorescence quantitative RT-RCR to detect, and gets plant and goes up a slice most and open up leaf entirely and extract RNA, adopts the TRIZOL kit to extract.Program and method according to reports such as Wang Fei are carried out reverse transcription and quantitative RT-PCR detection (Wang Fei etc., 2006).

The SSR mark and the primer sequence thereof in MRDV resistance site

The SSR mark in the Mrdd1 site on No. 6 chromosome is got umc1656, bnlg2191 and umc1656, and the SSR mark in the Mrdd2 site on No. 7 chromosome is got umc1401 and umc1666, and the SSR mark of the Mrdd3 on No. 8 chromosome is got bnlg1823 and umc1268.

Used SSR labeled primer sequence is detected in table 4, MRDV resistance site

The SSR mark	Primer sequence
		umc1656	AGTTTTGACCGCGCAAAAGTTA GTACGAGCAGGCCATTAACCC
bnlg2191	CAGGTGGTGCAGAGTTTCACAT AAGGTGGAGGATGACTCCAAGAT

umc1595	GCTGCTGGTCTACAACCTCTTGTT CGCTTGAAATGGAAAGGTAGAAAG
		umc1401	CTCTGGTCCATCCTCATCGACT TCTCTTGATCACATATCGATCCCA
umc1666	TTATTGCCCTCCCTGTTCTTGTT ACCTTGACGCAGCAATCCTC
		bnlg1823	TGTGACTCCATACCGCACAT CTCATCATGTTGTACATGGCG
umc1268	ACGAACAACCTAGCACAGTCCTAAA CAAGGCGGTTACCAAGTTTACATC

The primer sequence that provides according to MaizeGDB synthesizes SSR primer (table 4).

Markers for Detection

Get 3 leaf phases or the pustulation period plant an amount of blade, extract DNA with the CTAB method.

The SSR reaction system is: 10 * PCR buffer solution (does not contain Mg ²⁺) 1.0 μ l, MgCl ₂(25mM) 0.6 μ l, primer I (50ng/ μ l) 0.7 μ l, primer I I (50ng/ μ l) 0.7 μ l, dNTP (10mM each) 0.1 μ l, Taq archaeal dna polymerase (5U/ μ l) 0.06 μ l, dna profiling (20ng/ μ l) 2.5 μ l, aseptic double-distilled water 4.34 μ l add up to 10 μ l.

SSR reaction condition: PCR is reflected on the Biometra 96 hole grads PCR instrument and carries out, and program is: 95 ℃ of pre-sex change, 5 minutes; 95 ℃ of sex change, 30 seconds; Anneal 65 ℃ 30 seconds; Extend 72 ℃, 1 minute; After this, each cycle annealing temperature reduces by 1 ℃ of (being reduced to 55 ℃), totally 11 circulations; Then: 95 ℃ of sex change, 30 seconds; Anneal 55 ℃ 30 seconds; Extend 72 ℃, 1 minute; Circulate 30 times; Excessively extend 72 ℃, 8 minutes.

(acrylamide: electrophoretic separation methylene diacrylamide=19: 1), argentation detects the SSR amplified production through 6% polyacrylamide gel.

From segregation population, select anti-rough dwarf disease individuality

Selection to target gene is called foreground selection.The reliability of foreground selection depends primarily on tightness degree chain between mark and target gene.If only with a mark target gene is selected, then the chain of mark and target gene must very closely just can reach higher accuracy.Suppose that certain mark seat (M/m) and target gene seat (Q/q) are chain, recombination fraction is r.At F ₂In generation, by the probability (being the accuracy that individual plant is selected) that selectable marker gene type M/M obtains target gene type Q/Q be: p=(1-r) ²According to this formula, select accuracy to descend rapidly with the increase of recombination fraction.If require to select accuracy to reach more than 90%, then the recombination fraction between molecular labeling and target gene should be less than or equal to 5%.If with two adjacent marks of both sides target gene is selected simultaneously, can improve the accuracy of selection greatly.Suppose to have two mark seats (M1/m1 and M2/m2) to lay respectively at the both sides of target gene seat (Q/q), be respectively r1 and r2 with the recombination fraction of target gene, the genotype in F1 generation is M1QM2/m1qm2.So, the marker gene type that F1 produces is that the gamete of M1M2 has two types, and a kind of target allelomorph (M1QM2) that comprises is parental type, and another kind comprises non-target allelotype (M1qM2), for double cross is remodeled.Because the probability that double crossing over takes place is very low, so the remodel ratio of gamete of double cross is very little.So, in the offspring, come select target allelomorph Q by following the tracks of M1 and M2 simultaneously, accuracy is inevitable very high.Between single cross is changed under the glitch-free situation, at F2 be: p=(1-r for the probability that obtains target gene type Q/Q by selectable marker gene type M1M2/M1M2 ₁) ²(1-r ₂) ²/ [(1-r ₁) (1-r ₂)+r ₁r ₂].Thus formula as can be known, under the fixing situation of the map distance between two marks, r ₁=r ₂(that is target gene just in time the mid point between two marks) is the worst situation, and selection accuracy at this moment is minimum.In the present invention, the SSR mark umc1656 of Mrdd1 both sides and the map distance between the bnlg2191 are 4.5cM; The umc1401 of Mrdd2 both sides and the map distance between the umc1666 are in the zone of 11.1cM; The bnlg1823 of Mrdd3 both sides and the map distance between umc1268 are 5.8cM.Respectively Mrdd1, Mrdd2 and Mrdd3 are selected with these 6 marks, the minimum separately selection accuracy that obtains disease-resistant homozygous genotype is about 95.5%, 88.9% and 94.2%; The selection accuracy of the minimum that to obtain two disease-resistant sites be homozygous genotype is respectively 84.9% (Mrdd1 and Mrdd2), 90.0% (Mrdd1 and Mrdd3) and 83.7% (Mrdd2 and Mrdd3).In actual conditions, between changing, single cross generally always has the phase mutual interference, and this makes that the probability of double crossing over is littler, thereby the accuracy that double labelling is selected is higher than above-mentioned minimum theoretical expected value.In addition, heredity any two RIL or plant from 90110 disease-resistant site, under general onset condition, show resistance to MRDV.

In the present invention, 3 rough dwarf disease resistances of corn site lays respectively on 6,7, No. 8 chromosome, the individual ratio that has 3 or 2 resistance sites in segregation population changes because of the type of segregation population, therefore, the efficient of utilizing molecular marker assisted selection to cultivate anti-rough dwarf disease corn inbred line also depends on the technology path of selection.According to the hereditary law of segregation,, can select BC for use if only want to improve the rough dwarf disease resistance of certain good inbred line ₁F ₁Colony is the initial selection generation, and the individual ratio that has the resistance site of 3 heterozygosis is 12.5%, and the individual ratio that has the resistance site of 2 heterozygosis is 37.5%.3 generations of continuous backcross then,, utilize 6 SSR marks of both sides, 3 disease-resistant sites to detect simultaneously, then BC if per generation is the parent with the individuality in the resistance site that has 3 heterozygosis ₄F ₁Plant basic identical with recurrent parent (contain recurrent parent genetic material 96.9%), in 1 generation of selfing then, is to BC ₄F ₂Plant carries out strict disease resistance identifies, therefrom selects the good high-combining ability inbred line of comprehensive proterties that has 3 rough dwarf disease resistance sites.If except the rough dwarf disease resistance that improves certain good inbred line, also wish other proterties of this inbred line of improvement, can select F for use ₂Be initial selection generation, F ₂Having 3 in the colony isozygotys or the individuality in heterozygosis resistance site is 42%.Be the parent with the individuality that has 3 resistance sites then, in 2～3 generations of continuous backcross, 1～2 generation of selfing again, obtain to conform with the new good inbred line of breeding goal.In this process, BC ₁F ₂Individuality＞12.5% that has 3 resistance sites in the colony; At BC ₃F ₂The individuality that has 3 resistance sites in the colony also＞12.5%, the recurrent parent genetic material ratio average out to 87.5% of selected plant; At BC ₄F ₂The individuality that has 3 resistance sites in the colony also＞12.5%, the recurrent parent genetic material ratio average out to 93.8% of selected plant.In order to keep the high-combining ability of recurrent parent, the filial generation of susceptible inbred line and 90110 generally to be carried out for 3～4 generations backcross, in per generation, be aided with molecular marker assisted selection.

Because MRDV resistance site has 3, can select 2 kinds of programs when carrying out molecular marker assisted selection for use: 1) only select the individuality that has 3 resistance sites; 2) can select to have the individuality in 2 resistance sites, allow different selected materials hybridization during near recurrent parent, thereby obtain to have the anti-rough dwarf disease material in 3 resistance sites in tree characteristics.

In general, select by utilizing these 6 SSR marks to carry out genotype, in per generation, all can be selected the high anti-rough dwarf disease defect individual of (having 3 resistance sites), and workload is little.

The basic operation process:

1) maize elite inbred line with the sense rough dwarf disease is a recurrent parent, and 90110 is the resistant gene donor parents, hybridizes and backcrosses or selfing, sets up segregation population (as BC ₁F ₁, BC ₁F ₂, BC ₁F ₃, BC ₂F ₂, BC ₁F ₁* BC ₁F ₁, BC ₁F ₁* BC ₁F ₂Deng).

2) seed of plantation segregation population, at seedling 3 leaves during the phase, extracting single-strain blade DNA is template, primer with SSR mark umc1656, bnlg2191, umc1401, umc1666, bnlg1823 and umc1268 carries out pcr amplification respectively, the polyacrylamide gel electrophoresis that product is carried out through 6% separates, argentation detects the banding pattern of amplified production, selects the individuality that has 3 disease-resistant sites or 2 disease-resistant sites and is kept.

3) the selected plant back of growing up carries out according to the seed selection program that bagging is backcrossed or selfing, and carries out preferably according to the comprehensive proterties of plant.The plant seed that optimizes broadcasts at flowerpot or molecular marker assisted selection of future generation is carried out in the field and plant is preferred.

4) it is preferred the offspring of preferred plant to be continued plantation and molecular marker assisted selection and plant, no longer obviously separates up to tree characteristics.In 1～2 generation of selfing, obtain the good inbred line of high anti-rough dwarf disease then.

5) to having the selected material in 2 disease-resistant sites, if 1 disease-resistant site difference wherein, can be by a phase mutual cross polyase 13 disease-resistant site.From filial generation, adopt molecular marker assisted selection to obtain to have the individuality in 3 disease-resistant sites then, again 1～2 generation of latter's selfing is obtained the good inbred line of high anti-rough dwarf disease.

6) the basicly stable strain system of proterties is carried out artificial infection and field natural occurrence evaluation, carry out the preferred and combining ability test of economical character, determine the using value of the good inbred line of high-resistance corn rough dwarf disease.

If target inbred line other proterties except that the MRDV resistance trait of seed selection are same as samsara inbred line (susceptible good inbred line), can be from BC ₁F ₁Colony starts with, and adopts continuous backcross transformation strategy improvement inbred line.In backcrossing from generation to generation, each carries out molecular marker assisted selection.Like this, from hybridization, generally just can reach re-set target by 5～6 generations.

The genetic background of Different Cross Combinations can produce certain influence to the molecular marker assisted selection effect, and in different hybrid combination, promptly difference can appear in the molecular labeling of gene under different genetic backgrounds.Therefore, when setting up a plurality of hybrid combination, the donor of target gene all selects inbred line 90110 to be advisable.Like this, the general and target gene close linkage of the molecular labeling that has searched out is applicable to the different segregation populations of selected same target gene.In the minority segregation population,, then can utilize near the molecular labeling of these SSR marks if changing appears in some molecular labeling availabilities.In the present invention, operation scheme determines that the availability to guarantee existing molecular labeling to greatest extent is a prerequisite.

Description of drawings

The susceptible milpa phenotype of Fig. 1.

The BSA of Fig. 2 SSR mark umc1656, umc1401, bnlg1823 and umc1268 analyzes.

The sample of swimming lane 1-9 is respectively: 90110, tuck in 478, F ₁, F ₂Anti-pond, F ₂Sense pond, 90110, tuck in 478, BC ₁Anti-pond and BC ₁The sense pond.

Embodiment

Example 1: the 478 excellent improvement of tucking in of cultivating anti-MRDV are

With tuck in 478 or its improvement be acceptor and recurrent parent, be the donor in disease-resistant gene site with inbred line 90110, mainly the foreground selection by target gene obtains excellent improvement system.

Program one:

1) is that female parent, 90110 is that male parent is hybridized to tuck in 478, produces F ₁Plant.This step can 1 year 1～April in the greenhouse or Hainan finish.

2) F ₁The plant selfing produces F ₂Seed.This step was finished in northern China 1 year 5～August.

3) the F2 seed is broadcast in flowerpot, plant 3 leaves extract leaf DNA during the phase, primer with SSR mark umc1656, bnlg2191, umc1401, umc1666, bnlg1823 and umc1268 carries out pcr amplification respectively, product is separated through 6% polyacrylamide gel electrophoresis, argentation detects the banding pattern of amplified production, selects individuality 20～30 strains that have 3 disease-resistant sites and is transplanted to big Tanaka.This step can be finished in northern China or Hainan 1 year 9～October.

4) selected plant is taken out male back bagging and tucks in 478 and backcross, and strictness carries out the field observation record, eliminates weak plant according to the comprehensive proterties of plant before the results.Carry out species test, preferred after the fruit ear results.10～15 fruit ears of general reservation.This step can year January in October, first to the second in the greenhouse or Hainan finish.

5) the different B C that selects and remain ₁F ₂Seed is broadcast and carry out Markers for Detection (same F in flowerpot ₂Generation), will be selected in plantlet of transplant then to big Tanaka growth, plant is taken out male back bagging and tucks in 478 and backcross and produce BC ₂F ₂Seed.Strictness carry out plant and fruit ear preferred.General keep 4～5 on the fruit ear that has 3 disease-resistant site plant, or have totally 10 on the fruit ear in 3 or 2 disease-resistant sites.If plant type is more, the more fruit ear of can selecting and remain.This step was finished in northern China 1 year 3～June, and seedling stage, plant preferably grew in the greenhouse, was transplanted to plastic tunnel after the detection.

6) with BC ₂F ₂Seed is broadcast and carry out molecular marker assisted selection (same F in flowerpot ₂The generation) and plant preferred.Selected plant with tuck in 478 baggings and backcross and produce BC ₃F ₂Seed.General keep 4～5 on the fruit ear that has 3 disease-resistant site plant, or have totally 10 on the fruit ear in 3 or 2 disease-resistant sites.This step can be finished in northern China 1 year 7～October.

7) with BC ₃F ₂Seed is broadcast and is proceeded molecular marker assisted selection (same F in the field ₂Generation), carries out the competition of comprehensive proterties, and take out male back bagging and tuck in 478 and backcross and produce BC plant to going into roguing system ₄F ₂Seed.General reservation fruit ear number is close with the previous generation.Tree characteristics is neat in this system of strain from generation to generation, but notable difference can occur between strain system.Simultaneously, will go into the part plant and the good hybridization between selfed lines (comprise with recurrent parent hybridization excellent heterotic inbred line is arranged) of roguing system, the preparation hybrid seed is prepared combining ability test.This step can year March in November, second to the second in the greenhouse or Hainan finish.

8) carrying out step 6) or 7) time, can hybridize the selected material that has 2 disease-resistant sites.The selected plant that is used to hybridize is a disease-resistant site difference, and the best difference of proterties is little each other.3 disease-resistant sites can be aggregated in the genotype by hybridization, and tree characteristics changes less.From filial generation, adopt molecular marker assisted selection to obtain to have the individuality in 3 disease-resistant sites then.

9) in 1～2 generation of plant selfing that will have 3 disease-resistant sites, obtain the inbred line of isozygotying in disease-resistant site, and to plant carry out that strict disease resistance is identified, comprehensive proterties competition and combining ability test, select the good inbred line of the high anti-rough dwarf disease that conforms with breeding objective.This step was carried out in northern China the 3rd year 4～September, also can repeat once in northern China the 4th year 4～September.

In this program, add generation by greenhouse and Hainan plantation, comprehensive proterties is selected and the same conventional breeding of combining ability test.The high anti-rough dwarf disease of the inbred line that selects can be variant with recurrent parent on some proterties.

Program two:

1) be that female parent, 90110 is that paternal hybrid produces F to tuck in 478 ₁Plant.This step can 1 year 1～April in the greenhouse or Hainan finish.

2) F ₁Plant with tuck in 478 and backcross and produce BC ₁F ₁Seed.This step was finished in northern China 1 year 5～August.

3) the BC1F1 seed is broadcast in flowerpot, plant 3 leaves extract leaf DNA during the phase, primer with SSR mark umc1656, bnlg2191, umc1401, umc1666, bnlg1823 and umc1268 carries out pcr amplification respectively, product is carried out 6% polyacrylamide gel electrophoresis separation, argentation detects the banding pattern of amplified production, selects to have 3 individual 6 strains in disease-resistant site and be transplanted to big Tanaka.This step can be finished in northern China 1 year 9～October.

4) selected plant is taken out male back bagging and tucks in 478 and backcross, and strictness carries out the field observation record, eliminates weak plant according to the comprehensive proterties of plant before the results.Carry out species test, preferred after the fruit ear results.General about 3 on the fruit ear that keeps.This step can year February in October, first to the second in the greenhouse or Hainan finish.

5) the BC that selects from different fruit ears ₂F ₁Seed is broadcast and carry out molecular marker assisted selection (with BC1F1 generation) in flowerpot, will be selected in plant (about 5～8 strains) then and be transplanted to big Tanaka's growth, and plant is taken out male back and tucks in 478 and backcross and produce BC ₃F ₁Seed.And carry out plant and fruit ear preferred.General 3～5 on the fruit ear that has 3 disease-resistant site plant that keeps.This step was finished in northern China 1 year 3～June, and seedling stage, plant strain growth was better than the greenhouse most, transplanted in plastic tunnel then.

6) with BC ₃F ₁Seed broadcast in flowerpot, carry out molecular marker assisted selection (with BC1F1 generation) and plant preferred.Selected plant with tuck in 478 and backcross and produce BC ₄F ₁Seed.The basic neat and consistent of tree characteristics of this from generation to generation same strain system, but prepare the seed (inbred line of selecting for use and recurrent parent have excellent hybrid vigour) of combining ability test the same period.3 on the fruit ear of generally selecting and remain and having 3 disease-resistant site plant.This step was finished in northern China 1 year 6～October.

7) with BC ₄F ₁Seed is broadcast and is proceeded molecular marker assisted selection (with BC1F1 generation) in the field, will have the plant selfing in 3 disease-resistant sites then.Several 3～5 of the fruit ear of generally selecting and remain.This step can in March, 3 in November, second to the in the greenhouse or Hainan finish.。

8) with BC ₄F ₂Plant (plant that has 3 disease-resistant sites) is 1 generation of selfing again, obtains the inbred line of isozygotying in rough dwarf disease resistance site.Carry out combining ability test the same period, and plant is carried out the disease resistance evaluation and comprehensive proterties competition of strictness, acquisition conforms with the good inbred line of the high anti-rough dwarf disease of breeding objective.This inbred line is basic identical in recurrent parent.

Example 2: that cultivates anti-MRDV tucks in 502 excellence improvement system

With tuck in 502 or its improvement be acceptor and recurrent parent, be the donor in disease-resistant gene site with inbred line 90110, mainly the foreground selection by target gene obtains excellent improvement system.Relatively poor because of tucking in 502 disease resistances, carrying out the multiple characters improvement is preferred embodiments.

Program one:

1) be that female parent, 90110 is that paternal hybrid produces F to tuck in 502 ₁Plant.This step can 1 year 1～April in the greenhouse or Hainan finish.

2) F ₁The plant selfing produces F ₂Seed.This step was finished in northern China 1 year 5～August.

3) the F2 seed is broadcast in flowerpot, plant 3 leaves extract leaf DNA during the phase, primer with SSR mark umc1656, bnlg2191, umc1401, umc1666, bnlg1823 and umc1268 carries out pcr amplification respectively, product is separated through 6% polyacrylamide gel electrophoresis, argentation detects the banding pattern of amplified production, selects individuality 30～50 strains that have 3 disease-resistant sites and is transplanted to big Tanaka.This step can be finished in northern China or Hainan 1 year 9～October.

4) selected plant is taken out male back bagging and tucks in 502 and backcross, and strictness carries out the field observation record, eliminates weak plant according to the comprehensive proterties of plant before the results.Carry out species test, preferred after the fruit ear results.Generally select and remain about 20 on fruit ear.This step can year January in October, first to the second in the greenhouse or Hainan finish.

5) the select and remain BC of fruit ear ₁F ₂Seed is broadcast and carry out molecular marker assisted selection (same F in flowerpot ₂Generation), will be selected in plantlet of transplant then to big Tanaka growth, plant is taken out male back and tucks in 502 and backcross and produce BC ₂F ₂Seed.And carry out plant and fruit ear preferred.General totally 40 on the fruit ear that has 3 or 2 disease-resistant sites that keeps.If plant type is more, the more fruit ear of can selecting and remain.This step was finished in northern China 1 year 3～June, and seedling stage, plant preferably grew in the greenhouse, transplanted in plastic tunnel then.

6) with BC ₂F ₂Seed is broadcast and is carried out molecular marker assisted selection (same F in the field ₂Generation).Selected plant with tuck in 502 and backcross and produce BC ₃F ₂Seed.It is preferred to carry out plant and fruit ear simultaneously, general 20 on the fruit ear that has 3 or 2 disease-resistant sites that keeps.This step was finished in northern China 1 year 7～October.

7) with BC ₃F ₂Seed is broadcast and is proceeded molecular marker assisted selection (same F in the field ₂Generation), carry out the competition of comprehensive proterties to going into roguing system.The tree characteristics that this from generation to generation same strain is is more neat.But between strain system notable difference can be arranged.Selected plant is taken out male back and tucks in 502 and backcross and produce BC ₄F ₂Seed.General reservation fruit ear number is close with the previous generation.Simultaneously, will go into the part plant and the good hybridization between selfed lines (comprise with recurrent parent excellent heterotic inbred line is arranged) of roguing system, the preparation hybrid seed is prepared combining ability test.This step can year March in November, second to the second in the greenhouse or Hainan finish.

8) carrying out step 6) or 7) time, can hybridize the selected material that has 2 disease-resistant sites.The selected plant that is used to hybridize should be a disease-resistant site difference, and proterties difference is less to each other, 3 disease-resistant sites can be aggregated in the genotype by hybridization.From filial generation, adopt molecular marker assisted selection to obtain to have the plant in 3 disease-resistant sites then.

9) in 1～2 generation of plant selfing that will have 3 disease-resistant sites, obtain the inbred line of isozygotying in disease-resistant site, and to plant carry out that strict disease resistance is identified, comprehensive proterties competition and combining ability test, select the good inbred line of the high anti-rough dwarf disease that conforms with breeding objective.This step was carried out in northern China in 4～September of third and fourth year.

Program two:

1) be that female parent, 90110 is that paternal hybrid produces F to tuck in 502 ₁Plant.This step can 1 year 1～April in the greenhouse or Hainan finish.

2) F ₁The plant selfing produces F ₂Seed.This step was finished in northern China 1 year 5～August.

3) F ₂The plant selfing produces F ₃Plant.This step can year February in October, first to the second in the greenhouse or Hainan finish.

4) F ₃Seed is broadcast in the field, seedling stage and flowering stage carries out strictness according to economical character and eliminates.Leaf DNA is extracted in plant pollination back, primer with SSR mark umc1656, bnlg2191, umc1401, umc1666, bnlg1823 and umc1268 carries out pcr amplification respectively, the polyacrylamide gel electrophoresis that product is carried out through 6% separates, argentation detects the banding pattern of amplified production, selects individuality 50～60 strains that have 3 disease-resistant sites or 2 disease-resistant sites and tucks in 502 and backcross.Eliminate weak plant according to the comprehensive proterties of plant before the results, carries out species test then, about 30 on the fruit ear selected and remain.This step can be finished in northern China 1 year 3～June.

4) the select and remain BC of fruit ear ₁F ₃Seed is broadcast and is carried out molecular marker assisted selection (same F in the field ₃Generation), will be selected in plantlet of transplant then to big Tanaka growth, plant is taken out male back bagging and tucks in 502 and backcross and produce BC ₂F ₃Seed.And carry out plant and fruit ear preferred.General keep 8～10 on the fruit ear that has 3 disease-resistant site plant, or have totally 10～15 on the fruit ear in 3 or 2 disease-resistant sites.If plant type is more, the more fruit ear of can selecting and remain.This step can be finished in northern China 1 year 7～October.

6) with BC ₂F ₃Seed is broadcast and is carried out preferred (the same F of molecular marker assisted selection and plant in the field ₃Generation).Selected plant with tuck in 502 and backcross and produce BC ₃F ₃Seed.General keep 8～10 on the fruit ear that has 3 disease-resistant site plant, or have totally 10～15 on the fruit ear in 3 or 2 disease-resistant sites.This step in March, 3 in November, second to the in the greenhouse or Hainan finish.

7) with BC ₃F ₃Seed is broadcast and is proceeded molecular marker assisted selection (same F in the field ₃Generation), carries out the competition of comprehensive proterties, and take out male back and tuck in 502 and backcross and produce BC plant to going into roguing system ₄F ₃Seed.Generally the select and remain fruit ear number and the previous generation is close.The tree characteristics that this from generation to generation same strain is is more neat, but between strain system notable difference can be arranged.Simultaneously, will go into the part plant and the good hybridization between selfed lines (comprise with recurrent parent excellent heterotic inbred line is arranged) of roguing system, the preparation hybrid seed is prepared combining ability test.This step can be finished in northern China the 3rd year 4～September.

8) carrying out step 6) or 7) time, can hybridize the selected material that has 2 disease-resistant sites.The selected plant that is used to hybridize should be a disease-resistant site difference, and proterties difference is less to each other.3 disease-resistant sites can be aggregated in the genotype by hybridization, from filial generation, adopt molecular marker assisted selection to obtain to have the plant in 3 disease-resistant sites then.

9) will have 1 generation of plant selfing in 3 disease-resistant sites, and partly or entirely be isozygotied in anti-rough dwarf disease site.This step can in February, 4 in November, the 3rd to the in the greenhouse or Hainan finish.

10) plant that will have 3 disease-resistant sites again 1 generation of selfing obtain the inbred line of isozygotying in disease-resistant site, and to plant carry out that strict disease resistance is identified, comprehensive proterties competition and combining ability test, select the good inbred line of the high anti-rough dwarf disease that conforms with breeding objective.This step was carried out in northern China the 4th year 4～September.

Example 3: the excellent inbred line of cultivating anti-MRDV

With good inbred line DH4866 and Zheng 58 is acceptor and recurrent parent, is the donor of disease-resistant gene with inbred line 90110, mainly obtains to have the excellence improvement system of different characteristics by the foreground selection of target gene.Step is as follows:

1) is respectively father, hybridization of female parent with DH4866 and Zheng 58, produces F ₁Seed.This step can 1 year 1～April in the greenhouse or Hainan finish.

2) F ₁The plant selfing produces F ₂For seed, from F ₂Selfing generation F selects the superior in the plant ₃For seed, generally be controlled at 30～40 fruit ears.This step was finished in northern China and/or Hainan 1 year 5～December.

3) F ₃The plant selfing of selecting the superior produces F ₄For seed, 40～60 on results fruit ear.This step 1 year 1～April in the greenhouse or Hainan finish.

4) with F ₄Broadcast in the field for seed, field observation is carried out in strictness, and plant is divided into class DH4866 type, class Zheng's 58 types and osculant, selects good plant 20～30 strains respectively with 90110 hybridization, produces series " F _4-n* 90110 " seed (F _4-nRepresent n F ₄Individuality, n can be 1,2,3----X).This step was finished in northern China 1 year 5～September.

5) with " F _4-n* 90110 " seed is broadcast in the field, and the plant offspring of class DH4866 type and class Zheng 58 types selects the superior respectively and F _4-n(the n value is identical, promptly gets specific " F _4-n* 90110 " F of combined parent strain _4-nThe self progeny is a recurrent parent) backcross, produce serial BC ₁" F _4-n* 90110 " seed.The selfing of osculant plant filial generation produces F ₂" F _4-n* 90110 " seed.Every combination backcross 3 fringes or selfing 20 fringes.This step in March, 3 in October, second to the in the greenhouse or Hainan finish.

6) with BC ₁" F _4-n* 90110 " and F ₂" F _4-n* 90110 " seed is broadcast at flowerpot; extract 3 leaf phase plant leaf DNA; the primer with SSR mark umc1656, bnlg2191 umc1401, umc1666, bnlg1823 and umc1268 carries out pcr amplification respectively; product is separated through 6% polyacrylamide gel electrophoresis; argentation detects the banding pattern of amplified production; select individuality 5～10 strains that have 3 disease-resistant sites from each backcross population, select individuality 30～40 strains that have 3 disease-resistant sites from each inbreeding population, be transplanted to grown in field then and eliminate weak plant.Selected plant and its parent F ₄Plant the self progeny backcross, and eliminate weak plant according to the comprehensive proterties of plant before results.Carry out species test, preferred after the fruit ear results.General every BC ₁" F _4-n* 90110 " or F ₂" F _4-n* 90110 " the selected plant of the colony fruit ear of backcrossing is selected and remain 3～5.This step was finished in northern China the 3rd year 4～September.

7) select and remain the seed of fruit ear broadcast in flowerpot, proceed molecular marker assisted selection (same step 6) will be selected in plantlet of transplant then to big Tanaka's growth, and plant is taken out male back bagging and recurrent parent is backcrossed, and carry out plant and fruit ear preferred.General every BC ₂" F _4-n* 90110 " or BC ₁F ₂" F _4-n* 90110 " the selected plant offspring's of colony the fruit ear of backcrossing is selected and remain 2～5.If plant type is more, the more fruit ear of can selecting and remain.This step in February, 4 in October, the 3rd to the in the greenhouse or Hainan finish.

8) previous generation the is selected and remain seed of fruit ear is broadcast and is carried out molecular marker assisted selection (same step 6) in the field.Selected plant and recurrent parent are backcrossed, and it is preferred to carry out plant and fruit ear simultaneously, general every BC ₃" F _4-n* 90110 " or BC ₂F ₂" F _4-n* 90110 " colony selects and remain, and 2-5 is individual altogether for the fruit ear that has 3 or 2 disease-resistant sites.This step was finished in northern China the 4th year 4～September.

9) previous generation the is selected and remain seed of fruit ear is broadcast and is proceeded molecular marker assisted selection in the field (same step 6) is carried out the competition of comprehensive proterties to going into roguing system, and plant carried out strict disease resistance identify.The selected plant self-fertility that has 3 anti-rough dwarf disease sites.Generally the select and remain fruit ear number and the previous generation is close.Simultaneously, will go into the part plant and good hybridization between selfed lines (comprise with DH4866 or Zheng 58 excellent heterotic inbred line is arranged) the preparation seed of roguing system, prepare combining ability test.The tree characteristics that this from generation to generation same strain is is more neat.But but difference is obvious between strain system.This step can be finished in Hainan in February, 5 in October, the 4th to the.

10) when carrying out step 8), can hybridize the selected material that has 2 disease-resistant sites.The selected plant that is used to hybridize should be a disease-resistant site difference, and proterties difference is less each other.By hybridization 3 disease-resistant sites are aggregated in the genotype, from filial generation, adopt molecular marker assisted selection to obtain to have the individuality in 3 disease-resistant sites then.

11) plant that will have 3 disease-resistant sites in 1～2 generation of selfing, obtain the inbred line of isozygotying again, carry out simultaneously that combining ability test, disease resistance are identified, comprehensive proterties is preferred, finally select the good inbred line of the high anti-rough dwarf disease that conforms with breeding objective, wherein the part inbred line has DH4866 or Zheng's 58 excellent specific property and high anti-rough dwarf disease.This step was finished in northern China between the 4～September in the 5th, six year.

Claims (10)

1. the method for the corn inbred line of the anti-rough dwarf disease of molecular selection that utilizes MRDV resistance site, it is characterized in that: corn inbred line and middle breeding material thereof with anti-rough dwarf disease and sense rough dwarf disease make up segregation population, utilize and the closely linked molecular labeling umc1656 in MRDV resistant gene site, bnlg2191, umc1401, umc1666, bnlg1823 and umc1268 carry out assisted Selection, selection in conjunction with comprehensive proterties, selecting the plant that has 3 or 2 disease-resistant sites backcrosses and selfing, by number generation selection, obtain the maize elite inbred line of high anti-rough dwarf disease.

2. method according to claim 1 is characterized in that: the inbred line of anti-MRDV comprises 90110,178, P138; The inbred line of sense MRDV comprise tuck in 478,488 and the inbred line, DH4866, the DH9942 that derive from, tuck in 502, tuck in 515,7922, lucky 853, Zheng's 58 good inbred lines; Middle breeding material has between the anti-rough dwarf disease inbred line, between the sense rough dwarf disease inbred line and the hybrid that hybridization produces between anti-rough dwarf disease inbred line and the sense rough dwarf disease inbred line and hybrid through continuous selfing or/and the RIL or the near-isogenic line of the generation of backcrossing.

3. method according to claim 1 is characterized in that: segregation population comprises the F that anti-rough dwarf disease inbred line and the continuous selfing of sense rough dwarf disease hybridization between selfed lines offspring produce _2-6Colony, filial generation selfing are in conjunction with the F that backcrosses and produce _2-4BC _1-3Colony, and BC ₁F ₁, BC ₁F ₁* BC ₁F ₁, BC ₁F ₁* BC ₁F ₂Colony; Wherein: F _2-6Refer to 2～6 generations of selfing; F _2-4BC _1-3Refer to 2 generation～4 generations of selfing, backcrossed for 1 generation～3 generation with recurrent parent.

4. method according to claim 1, it is characterized in that: be used for MRDV resistant gene site assisted Selection SSR be marked with umc1656, bnlg2191 and the umc1656 molecular labeling on the chromosome No. 6, bnlg1823 and umc1268 molecular labeling on umc1401 and the umc1666 molecular labeling on No. 7 chromosome, No. 8 chromosome.

5. according to claim 1 or 4 described methods, it is characterized in that: be chosen as the master with prospect when MRDV resistant gene site is selected, promptly the select target gene loci is selected in conjunction with background simultaneously; Foreground selection is selected target gene simultaneously with two adjacent marks of target gene both sides, or only with a closely linked mark target gene is selected.

6. according to claim 1,2 or 3 described methods, it is characterized in that: when obtaining hybrid F1, anti-rough dwarf disease plant and sense rough dwarf disease plant all can be as female parent or male parents; When backcrossing, sense rough dwarf disease inbred line is as male parent or female parent.

7. method according to claim 1 or 5, it is characterized in that: if per generation is the parent with the individuality in the resistance site that has 3 heterozygosis, utilize 6 SSR marks of both sides, 3 disease-resistant sites to carry out assisted Selection simultaneously, 3 generations of continuous backcross, select economical character to be same as 1～2 generation of BC4F1 plant selfing of recurrent parent, obtain the good high-combining ability inbred line of isozygotying in rough dwarf disease resistance site of comprehensive proterties.

8. method according to claim 1 or 5 is characterized in that: be basic material with certain good selfing, improveing its rough dwarf disease resistance and other proterties, selecting F for use ₂Or F ₃For the initial selection generation, to select the individuality that has 3 resistance sites and backcross and selfing, number generation selection back acquisition conforms with the new inbred line of breeding goal; Another approach is to select to have the individuality in 2 resistance sites in segregation population, allow the close selected material hybridization of proterties during near recurrent parent in tree characteristics, acquisition has the elite clone of the anti-rough dwarf disease in 3 resistance sites, and 1～3 generation of selfing obtains the good inbred line of high anti-rough dwarf disease then.

9. according to claim 1,4 or 5 described methods, it is characterized in that: with the sense rough dwarf disease maize elite inbred line tuck in 478 or its derivation be to be acceptor and recurrent parent, the corn inbred line 90110 of high anti-rough dwarf disease is the resistant gene donor parents, sets up segregation population; Carry out pcr amplification with the primer of SSR mark umc1656, bnlg2191, umc1401, umc1666, bnlg1823 and umc1268 respectively and detect 3 leaf phase seedlings, select and have 3 disease-resistant site plant and backcross, and carry out preferably according to the comprehensive proterties of plant, the seed of selecting excellent plant carry out molecular marker assisted selection of future generation and plant preferred, continuous backcross 1～2 generation of selfing after 3 generations, obtain the maize elite inbred line of high anti-rough dwarf disease.

10. according to claim 1,4 or 5 described methods, it is characterized in that: the maize elite inbred line with the sense rough dwarf disease tucks in 515, Zheng 58 or lucky 853 is acceptor and recurrent parent, the inbred line 90110 of high anti-rough dwarf disease is the resistant gene donor parents, sets up segregation population; Carry out pcr amplification with the primer of SSR mark umc1656, bnlg2191, umc1401, umc1666, bnlg1823 and umc1268 respectively and detect 3 leaf phase seedlings, select and have 3 disease-resistant site plant and carry out selfing or backcross, and carry out preferably according to the comprehensive proterties of plant, the seed of selecting excellent plant carry out molecular marker assisted selection of future generation and plant preferred, by 1～3 generation of 2～3 generations of selfing, continuous backcross, in 1～2 generation of selfing, obtain the good inbred line of high anti-rough dwarf disease again.

Images