CN108034755A - Chain molecular labeling and its application with rice Drought-tolerant gene qLRI9 phases - Google Patents
Chain molecular labeling and its application with rice Drought-tolerant gene qLRI9 phases Download PDFInfo
- Publication number
- CN108034755A CN108034755A CN201810038621.7A CN201810038621A CN108034755A CN 108034755 A CN108034755 A CN 108034755A CN 201810038621 A CN201810038621 A CN 201810038621A CN 108034755 A CN108034755 A CN 108034755A
- Authority
- CN
- China
- Prior art keywords
- rice
- drought tolerance
- drought
- primer pair
- identification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Application the invention discloses the molecular labeling chain with rice Drought-tolerant gene qLRI9 phases and its in rice drought tolerance identification.The present invention utilizes Liang Taoshui, upland rice recombinant inbred lines (RIL) with different genetic backgrounds, successfully navigated on rice Chromosome 9 and the relevant gene loci qLRI9 of rice drought tolerance, its drought-enduring favorable allels is all from drought-enduring parent IAPAR 9, it is chain with molecular labeling RM24598, and identification or the method for aiding in identification rice drought tolerance are provided based on molecular labeling RM24598, available for paddy drought resistance cultivar identification and molecular breeding.
Description
Technical field
The invention belongs to agricultural biotechnology engineering, and in particular to the chain molecule mark with rice Drought-tolerant gene qLRI9 phases
Note and its application.
Background technology
Worldwide generally existing, arid, the cultivated area of semiarid zone have accounted for the whole world and have ploughed Dry land problem
The 42.9% of ground area.The whole world has more than 0.6 hundred million hectares of paddy fields and is subject to drought stress every year according to statistics, thereby results in
Production loss it is very surprising.In recent years, China, which often occurs, involves that scope is wider, long-term arid, and
The arid disaster-stricken time is also increasing year by year, and arid is increasingly becoming the protrusion sex chromosome mosaicism for influencing agricultural production, and has becoming for exacerbation
Gesture, the summation of rice underproduction caused by the underproduction caused by arid is significantly larger than other envirment factors.Water saving cultivation technique
It is the direct method for alleviating shortage of water resources, but in production practices, screens and cultivate drought-enduring, high yield new rice variety,
It is only and fundamentally improves that rice drought tolerance is most effective, most rational approach.
Genetics research shows that rice drought tolerance is a complicated quantitative character, and drought-enduring reaction is related to multiple genes, and
There are obvious reciprocal effects between gene and environment, by traditional breeding method be difficult make rice drought tolerance level have it is very big
Improve.With the development of molecular biology, make to be difficult to identify, economical character easily affected by environment using marker assisted selection
It is possibly realized, which can carry out selection that is accurate, stablizing from generation to generation early, so as to accelerate breeding process, improve breeding efficiency, but
The basis of the technology is that must have excellent target gene and the molecular labeling with its close linkage.
The content of the invention
The technical problem to be solved in the present invention is how fast and accurately to identify rice drought tolerance.In order to solve the technology
Problem, the present invention is using Liang Taoshui, upland rice recombinant inbred lines (RIL) with different genetic backgrounds, in No. 9 dye of rice
Successfully navigated on colour solid and be all from resistance to the relevant gene loci qLRI9 of rice drought tolerance, its drought-enduring favorable allels
Non-irrigated parent IAPAR-9, it is chain with molecular labeling RM24598.The Practical economy molecular labeling RM24598 of based on PCR, can be used for
Rice drought tolerance cultivar identification and molecular breeding.
In order to solve the above-mentioned technical problem, present invention firstly provides identification or the primer of auxiliary identification rice drought tolerance
It is right.
Primer pair provided by the invention is made of primer first and primer second；
The primer first is following (a1) or (a2)：
(a1) single strand dna shown in sequence 1；
(a2) sequence 1 is had by the substitution of one or several nucleotide and/or missing and/or addition and with sequence 1
The single strand dna of identical function；
The primer second is following (a3) or (a4)：
(a3) single strand dna shown in sequence 2；
(a4) sequence 2 is had by the substitution of one or several nucleotide and/or missing and/or addition and with sequence 2
The single strand dna of identical function.
In above-mentioned primer pair, the molar ratio of the primer first and the primer second is 1:1.
In order to solve the above-mentioned technical problem, invention further provides the new application of above-mentioned primer pair.
The present invention provides application of the above-mentioned primer pair in identifying or aiding in identification rice drought tolerance.
Present invention also offers application of the above-mentioned primer pair in the product for preparing identification or auxiliary identification rice drought tolerance.
Present invention also offers application of the above-mentioned primer pair in the strong rice varieties of selection and breeding drought tolerance.
Present invention also offers application of the above-mentioned primer pair in the product for preparing the strong rice varieties of selection and breeding drought tolerance.
Present invention also offers application of the above-mentioned primer pair in rice breeding.
Present invention also offers application of the above-mentioned primer pair in the product of rice breeding is prepared.
In order to solve the above-mentioned technical problem, present invention also offers a kind of side identified or aid in identification rice drought tolerance
Method.
The method of identification provided by the invention or auxiliary identification rice drought tolerance includes the following steps：With the base of rice to be measured
Because group DNA is template, PCR amplification is carried out using above-mentioned primer pair, obtains PCR product；Water to be measured is identified according to the PCR product
The drought tolerance of rice：
If PCR product size is 110bp, rice to be measured is or candidate is the strong rice varieties of drought tolerance；
If PCR product size is 114bp, rice to be measured is or candidate is that rice varieties in drought tolerance or drought tolerance are weak
Rice varieties.
In order to solve the above-mentioned technical problem, present invention also offers a kind of method of the strong rice varieties of selection and breeding drought tolerance.
The method of the strong rice varieties of selection and breeding drought tolerance provided by the invention includes the following steps：With the gene of rice to be measured
Group DNA is template, carries out PCR amplification using above-mentioned primer pair, obtains PCR product；Selection PCR product size is treated for 110bp
Survey rice and carry out breeding.
In the above method, the PCR reaction systems are as follows：10 × PCR buffer (contain Mg2+)1.0μl、10mM dNTP
0.25 μ l of Mixture, 0.25 μ l of 10pM/ μ l primers first, 0.25 μ l of 10pM/ μ l primers second, 0.5U/ μ l Taq polymerase
0.25 μ l, 40ng/ μ l genomic DNAs 1.0 μ l, ddH2O complements to 10 μ l；
The PCR reaction conditions are as follows：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C extend
40s, 36 circulations；72 DEG C of extension 10min.
In order to solve the above-mentioned technical problem, the present invention finally provides a kind of product.
Product provided by the invention is any products of following (b1)-(b3)：
(b1) above-mentioned primer pair；
(b2) PCR reagent containing the primer pair described in (b1)；
(b3) kit containing the primer pair described in (b1) or the PCR reagent described in (b2).
Application of the said goods in following (c1)-(c3) is any falls within protection scope of the present invention：
(c1) identify or aid in identification rice drought tolerance；
(c2) the strong rice varieties of selection and breeding drought tolerance；
(c3) rice breeding.
In above application or method or product, the strong rice varieties of the drought tolerance for leaf roll curvature (leaf amount of crimp
Rank) it is less than 5 rice varieties；Rice varieties in the drought tolerance are equal to 5 for leaf roll curvature (rank of leaf amount of crimp)
Rice varieties；The weak rice varieties of the drought tolerance are more than 5 rice varieties for leaf roll curvature (rank of leaf amount of crimp).
The criterion of the rank of Rice Leaf amount of crimp is as follows：If rice leaf is healthy, the rank of the leaf amount of crimp of the rice
For 1；If rice leaf crimps, leaf turn up it is V-shaped, then the rank of the leaf amount of crimp of the rice be 3；If rice leaf is in
Cup-shaped (takes the shape of the letter U), then the rank of the leaf amount of crimp of the rice is 5；If the limb of rice leaf combines (being in O shapes), the water
The rank of the leaf amount of crimp of rice is 7；If rice leaf crimps completely, the rank of the leaf amount of crimp of the rice is 9.
The present invention has the following advantages compared with prior art and effect：1st, the rice Drought-tolerant gene that the present invention obtains is not
It can stablize expression under same genetic background, it is highly reliable.2nd, by the screening of the molecular labeling with Drought-tolerant gene close linkage,
It can identify and obtain the strong rice varieties of drought tolerance.3rd, molecular labeling of the invention can be used for rice seedling genotype identification and
Selection, obtains the individual for carrying drought-enduring excellent allelic variation, can overcome the shortcomings of cycle is long the time required to conventional breeding methods, training
Bring out strong drought tolerance new rice variety.
The present invention is excavated under different genetic backgrounds using associated Liang Taoshui, upland rice recombinant inbred lines as research colony
Stablize the Drought-tolerant gene site of expression and the molecular labeling with its close linkage, finally in rice genome Chromosome 9
A with drought-enduring relevant gene loci qLRI9 and therewith molecular labeling for close linkage is found on the position of 82.24cM
RM24598, provides fundamental basis for rice molecular marker assisted selection breeding.
Brief description of the drawings
Fig. 1 is the electrophoretic band figure of IAPAR-9/ Qiu Guang colony parents and offspring part single plant in RM24598 sites.P1 and
P2 represents IAPAR-9 and Qiu Guang respectively；1-30 represents randomly selected 30 single plants from colony.
Fig. 2 is the electrophoretic band figure of 241 colony parents of IAPAR-9/ Liao Yan and offspring part single plant in RM24598 sites.
P1 and P2 represents IAPAR-9 and distant salt 241 respectively；1-30 represents randomly selected 30 single plants from colony.
Fig. 3 is the electrophoretic band figure that molecular labeling RM24598 identifies rice varieties drought tolerance.P1 and P2 are represented respectively
IAPAR-9 and distant salt 241；1-10 represents to carry out 10 rice varieties of drought tolerance identification.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples, is commercially available unless otherwise specified.
Quantitative test in following embodiments, is respectively provided with three repeated experiments, and results are averaged.
Rice varieties in following embodiments：Excellent upland rice variety IAPAR-9, excellent high-yield variety autumn light, distant salt 241,
Flower shell winterbourne, big grain sand, Yun Chuanbai, millet morning, the Taibei 8, yellow plate institute, black large space between muscles, Venus No.1, Gui Chao bis- and graceful skin are fragrant
Red glutinous rice is all from national genebank, and the public can obtain from national genebank application and gratuitously.
The acquisition of the molecular labeling of embodiment 1, rice Drought-tolerant gene qLRI9 and its close linkage
First, the positioning of drought-enduring QTL and the acquisition of rice Drought-tolerant gene qLRI9
1st, material to be tested
Excellent upland rice variety IAPAR-9 from Brazil and excellent high-yield variety autumn light are hybridized, obtained through single seed descent
The F comprising 231 strains10Recombinant inbred lines (RIL) are used as target group.
2nd, genotype identification
Material to be tested, clip rice young leaflet tablet, according to Doyle and Dickson are planted in Changping County, Beijing proving ground
(1987) and slightly improved cetyltriethylammonium bromide method (CTAB) carries out the DNA extractions of full-length genome.Filter out expansion
Synergy fruit is good, have polymorphism between parent and is uniformly distributed in base of 178 pairs of SSR primers for target group of 12 linkage groups
Because type is identified.
PCR reaction systems are as follows：10 × PCR buffer (contain Mg2+)1.0μl、10mM dNTP Mixture 0.25μl、
0.25 μ l of 10pM/ μ l primers, 0.25 μ l of 0.5U/ μ l Taq polymerase, 40ng/ μ l genomic DNAs 1.0 μ l, ddH2O
Complement to 10 μ l.
PCR reaction conditions are as follows：94 DEG C of pre-degeneration 5min；94 DEG C denaturation 30s, 55 DEG C annealing 30s, 72 DEG C extension 40s, 36
A circulation；72 DEG C of extension 10min.
Amplified production is separated by electrophoresis with 8% polyacrylamide denaturant gel, and using 260V constant pressure electrophoresis, and silver staining obtains clearly
Clear slug band.
3rd, drought-enduring identification
Tested in 2014 positioned at the progress of agricultural and forest science institute of Ningxia Province (NAAFS) proving ground in Yinchuan.For the weight of examination
Group inbred line population and its parents sowed on April 12nd, 2014, transplanting on May 17,2 repetitions, and order arranges, 2 row areas, often
15 cave of row, this single rice transplanting, rice transplanting specification is 26.7cm × 13.3cm.Arid place is proceeded by tillering stage (after transplanting 38 days)
Reason.Every 7 days in the morning 11 since July 17:00-12:00 investigation is recorded leaf roll curvature and is stopped within 24th to September.Coerced with arid
Compel inferior lobe crimpness as evaluation index, evaluated (table 1) according to following 5 grades of standard scores.By leaf roll curvature (leaf amount of crimp
Rank) less than 5 rice varieties be defined as the strong rice varieties of drought tolerance；By leaf roll curvature (rank of leaf amount of crimp) etc.
Rice varieties in 5 are defined as rice varieties in drought tolerance；Leaf roll curvature (rank of leaf amount of crimp) is more than to 5 rice
Kind is defined as the weak rice varieties of drought tolerance.
Table 1, drought-enduring standard of perfection
| The rank of leaf amount of crimp | Field drought stress leaf amount of crimp | Drought tolerance |
| 1 | Leaf health | It is extremely strong |
| 3 | Start to crimp, leaf is turned up (V-shaped) | By force |
| 5 | Leaf is cup-shaped (taking the shape of the letter U) | In |
| 7 | Limb combines (being in O shapes) | It is weak |
| 9 | Leaf crimps completely | It is extremely weak |
4th, the structure of linkage map and QTL positioning
The structure of recombinant inbred lines genetic linkage maps, the something lost between marking are carried out using 4.0 softwares of IciMapping
Pass distance and (Kosambi et al, 1944) is estimated using Kosambi functions.QTL detections select IciMapping 4.0 soft
Part, the threshold value detected using LOD value 2.5 as QTL.
The positioning result of IAPAR-9/ autumn light recombinant inbred lines shows, positioned at the position of Chromosome 9 82.24cM
It is upper that (table 2) is positioned under multiple environment with drought-enduring relevant gene loci qLRI9, the site and molecular labeling
RM24598 is chain, and allele of the excellent upland rice variety IAPAR-9 from Brazil in the site can improve the drought-enduring of rice
Property (Fig. 1).
The positioning of table 2, drought-enduring QTLqLRI9
| QTL | Linked marker | Genetic distance | LOD value | Colony |
| qLRI9 | RM24598 | 82.24cM | 4.82 | IAPAR-9/ autumn light |
2nd, the verification of qLRI9
1st, material to be tested
Excellent upland rice variety IAPAR-9 from Brazil and distant salt 241 are hybridized, 228 are included through what single seed descent obtained
The F of a strain10Recombinant inbred lines (RIL) are as verification colony.
2nd, genotype identification
Material to be tested, clip rice young leaflet tablet, according to Doyle and Dickson are planted in Changping County, Beijing proving ground
(1987) and slightly improved cetyltriethylammonium bromide method (CTAB) carries out the DNA extractions of full-length genome.Filter out expansion
Synergy fruit is good, have polymorphism between parent and is uniformly distributed in base of 174 pairs of SSR primers for target group of 12 linkage groups
Because type is identified.
PCR reaction systems are as follows：10 × PCR buffer (contain Mg2+)1.0μl、10mM dNTP Mixture 0.25μl、
0.25 μ l of 10pM/ μ l primers, 0.25 μ l of 0.5U/ μ l Taq polymerase, 40ng/ μ l genomic DNAs 1.0 μ l, ddH2O
Complement to 10 μ l.
PCR reaction conditions are as follows：94 DEG C of pre-degeneration 5min；94 DEG C denaturation 30s, 55 DEG C annealing 30s, 72 DEG C extension 40s, 36
A circulation；72 DEG C of extension 10min.
Amplified production is separated by electrophoresis with 8% polyacrylamide denaturant gel, and using 260V constant pressure electrophoresis, and silver staining obtains clearly
Clear slug band.
3rd, drought-enduring identification
Tested in 2014 positioned at the progress of agricultural and forest science institute of Ningxia Province (NAAFS) proving ground in Yinchuan.For the weight of examination
Group self-fertilization family (sff) colony and its parents sowed on April 12nd, 2014, transplanting on May 17,2 repetitions, and order arranges, 2 row areas,
Often 15 cave of row, this single rice transplanting, rice transplanting specification is 26.7cm × 13.3cm.Arid place is proceeded by tillering stage (after transplanting 38 days)
Reason.Every 7 days in the morning 11 since July 17:00-12:00 investigation is recorded leaf roll curvature and is stopped within 24th to September.Coerced with arid
Compel inferior lobe crimpness as evaluation index (with table 1).
4th, the structure of linkage map and QTL positioning
The structure of recombinant inbred lines genetic linkage maps, the something lost between marking are carried out using 4.0 softwares of IciMapping
Pass distance and (Kosambi et al, 1944) is estimated using Kosambi functions.QTL detections select IciMapping 4.0 soft
Part, the threshold value detected using LOD value 2.5 as QTL.
The positioning result of drought-enduring QTL shows that qLRI9 is determined again in 241 recombinant inbred lines of IAPAR-9/ the Liao Dynasty salt
(table 3) is arrived in position, LRIIAPAR-9Represent the average leaf roll curvature of the homozygous plants consistent with parent's IAPAR-9 genotype；LRIDistant salt 241
Represent the average leaf roll curvature of the homozygous plants consistent with parent the Liao Dynasty 241 genotype of salt, qLRI9 can be effectively reduced the arid side of body
Compel lower Rice Leaf crimpness, and drought resistance beneficial gene equally derives from IAPAR-9 (Fig. 2).This shows that qLRI9 is one true
Existing Drought-tolerant gene, and molecular labeling RM24598 can be applied to the drought-enduring molecular labeling of rice really with qLRI9 close linkages
Assisted selection.
The verification of table 3, drought-enduring QTLqLRI9
| QTL | Linked marker | Colony | LRIIAPAR-9 | LRIDistant salt 241 |
| qLRI9 | RM24598 | IAPAR-9/ the Liao Dynasty salt 241 | 4.2 | 5.8 |
3rd, with the molecular labelings of rice Drought-tolerant gene qLRI9 close linkages
Molecular labeling of the invention with rice Drought-tolerant gene qLRI9 close linkages is on rice Chromosome 9
RM24598 molecular labelings, its nucleotide sequence (5 ' → 3 ') is as follows：
Forward primer：AACTCCACATGATTCCACCC (sequence 1)；
Reverse primer：GAGAAGGTGGTTGCAGAAGC (sequence 2).
Embodiment 2, rice drought tolerance identification method
The method of identification rice drought tolerance to be measured provided by the invention is as follows：
1st, the genomic DNA of rice to be measured is extracted, using genomic DNA as template, RM24598 molecular labelings carry out PCR expansions
Increase, obtain PCR product；
PCR reaction systems are as follows：10 × PCR buffer (contain Mg2+)1.0μl、10mM dNTP Mixture 0.25μl、
0.25 μ l of 10pM/ μ l primers, 0.25 μ l of 0.5U/ μ l Taq polymerase, 40ng/ μ l genomic DNAs 1.0 μ l, ddH2O
Complement to 10 μ l.
PCR reaction conditions are as follows：94 DEG C of pre-degeneration 5min；94 DEG C denaturation 30s, 55 DEG C annealing 30s, 72 DEG C extension 40s, 36
A circulation；72 DEG C of extension 10min.
2nd, the drought tolerance of rice to be measured is identified according to PCR product size：
If PCR product size is 110bp, rice to be measured is or candidate is the strong rice varieties of drought tolerance；
If PCR product size is 114bp, rice to be measured is or candidate is that rice varieties in drought tolerance or drought tolerance are weak
Rice varieties；
The strong rice varieties of drought tolerance are less than 5 rice varieties for leaf roll curvature (rank of leaf amount of crimp)；
Rice varieties in drought tolerance are equal to 5 rice varieties for leaf roll curvature (rank of leaf amount of crimp)；
The weak rice varieties of drought tolerance are more than 5 rice varieties for leaf roll curvature (rank of leaf amount of crimp).
The application of embodiment 3, RM24598 molecular labelings in the identification of rice varieties drought tolerance
First, material to be tested
Material to be tested is flower shell winterbourne, big grain sand, Yun Chuanbai, millet morning, the Taibei 8, Huang plate institute, black large space between muscles, Venus one
Number, the fragrant red glutinous rice of Gui Chao bis- and graceful skin.
2nd, drought tolerance is identified
The drought tolerance of the material to be tested in step 1 is identified according to the method in the 3 of 1 step 1 of embodiment.
The results are shown in Table 4.As can be seen from the table：In 10 rice varieties, the Taibei 8 and yellow plate institute leaf roll curvature are equal
It is the weak rice varieties of drought tolerance for 7, Venus No.1 leaf roll curvature is equal to 5, is the rice varieties in drought tolerance, remaining 7
Rice varieties flower shell winterbourne, big grain sand, Yun Chuanbai, millet are early, the black fragrant red glutinous rice leaf roll curvature of large space between muscles, Gui Chao bis- and graceful skin is equal
It is the strong rice varieties of drought tolerance less than 5.
Table 4, genotype and leaf roll curvature qualification result for trying rice varieties
| Rice varieties | PCR product size | Leaf roll curvature | Drought tolerance | |
| 1 | Flower shell winterbourne | 110bp | 3 | By force |
| 2 | Big grain is husky | 110bp | 1 | It is extremely strong |
| 3 | Yun Chuanbai | 110bp | 3 | By force |
| 4 | Millet is early | 110bp | 1 | It is extremely strong |
| 5 | The Taibei 8 | 114bp | 7 | It is weak |
| 6 | Yellow plate institute | 114bp | 7 | It is weak |
| 7 | Black large space between muscles | 110bp | 1 | It is extremely strong |
| 8 | Venus No.1 | 114bp | 5 | In |
| 9 | Osmanthus tide two | 110bp | 1 | It is extremely strong |
| 10 | The fragrant red glutinous rice of graceful skin | 110bp | 1 | It is extremely strong |
3rd, genotype identification
The genomic DNA of material to be tested in extraction step one, using the genomic DNA of acquisition as template, utilizes RM24598
Molecular labeling carries out PCR amplification.The step 1 of PCR reaction systems and PCR reaction conditions with embodiment 2.Amplified production is poly- with 8%
Acrylamide denatured gel is separated by electrophoresis, using 260V constant pressure electrophoresis.
Electrophoresis result is as shown in Figure 3.The PCR product of the Taibei 8 and yellow plate institute (swimming lane 5 and swimming lane 6) expands to obtain big
The small DNA bands for 114bp, are identified according to rice drought tolerance identification method of the invention in embodiment 2, Taibei 8 and
Yellow plate is the weak rice varieties of drought tolerance；Venus No.1 (swimming lane 8) amplification obtains the DNA bands that size is 114bp, according to
Rice drought tolerance identification method of the invention is identified in embodiment 2, and Venus No.1 is the rice varieties in drought tolerance；Remaining
The PCR productions of early, the black fragrant red glutinous rice of large space between muscles, Gui Chao bis- and graceful skin of 7 rice varieties flower shell winterbournes, big grain sand, Yun Chuanbai, millet
Thing expands to obtain the DNA bands that size is 110bp, is carried out according to rice drought tolerance identification method of the invention in embodiment 2
Identification, is the strong rice varieties of drought tolerance.
It can be seen that：The rice drought tolerance identification method and the drought tolerance qualification result in step 2 of the present invention is complete
Unanimously.Illustrate that the rice drought tolerance identification method of the present invention is accurate, reliable.
Sequence table
<110>Institute of Crop Science, Chinese Academy of Agricultural Science
<120>Chain molecular labeling and its application with rice Drought-tolerant gene qLRI9 phases
<160>2
<170>PatentIn version 3.5
<210>1
<211>20
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>1
aactccacat gattccaccc 20
<210>2
<211>20
<212>DNA
<213>Artificial sequence (Artificial Sequence)
<400>2
gagaaggtgg ttgcagaagc 20
Claims (9)
1. identification or the primer pair of auxiliary identification rice drought tolerance, it is made of primer first and primer second；
The primer first is following (a1) or (a2)：
(a1) single strand dna shown in sequence 1；
(a2) have by sequence 1 by the substitution of one or several nucleotide and/or missing and/or addition and with sequence 1 identical
The single strand dna of function；
The primer second is following (a3) or (a4)：
(a3) single strand dna shown in sequence 2；
(a4) have by sequence 2 by the substitution of one or several nucleotide and/or missing and/or addition and with sequence 2 identical
The single strand dna of function.
2. primer pair as claimed in claim 1, it is characterised in that：The molar ratio of the primer first and the primer second is 1:1.
3. application of the primer pair in identifying or aiding in identification rice drought tolerance described in claim 1 or 2；
Or, application of the primer pair described in claim 1 or 2 in the product for preparing identification or auxiliary identification rice drought tolerance.
4. application of the primer pair in the strong rice varieties of selection and breeding drought tolerance described in claim 1 or 2；
Or, application of the primer pair described in claim 1 or 2 in the product for preparing the strong rice varieties of selection and breeding drought tolerance.
5. application of the primer pair described in claim 1 or 2 in rice breeding；
Or, application of the primer pair described in claim 1 or 2 in the product of rice breeding is prepared.
6. a kind of method identified or auxiliary identifies rice drought tolerance, includes the following steps：Using the genomic DNA of rice to be measured as
Template, carries out PCR amplification using the primer pair described in claim 1, obtains PCR product；Identified according to the PCR product to be measured
The drought tolerance of rice：
If PCR product size is 110bp, rice to be measured is or candidate is the strong rice varieties of drought tolerance；
If PCR product size is 114bp, rice to be measured is or candidate is rice varieties in drought tolerance or the weak water of drought tolerance
Rice varieties.
7. a kind of method of the strong rice varieties of selection and breeding drought tolerance, includes the following steps：Using the genomic DNA of rice to be measured as mould
Plate, carries out PCR amplification using the primer pair described in claim 1, obtains PCR product；It is 110bp's to select PCR product size
Rice to be measured carries out breeding.
8. the following any products of (b1)-(b3)：
(b1) primer pair described in claim 1；
(b2) PCR reagent containing the primer pair described in (b1)；
(b3) kit containing the primer pair described in (b1) or the PCR reagent described in (b2).
9. application of the product in following (c1)-(c3) is any described in claim 8：
(c1) identify or aid in identification rice drought tolerance；
(c2) the strong rice varieties of selection and breeding drought tolerance；
(c3) rice breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810038621.7A CN108034755B (en) | 2018-01-16 | 2018-01-16 | Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810038621.7A CN108034755B (en) | 2018-01-16 | 2018-01-16 | Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108034755A true CN108034755A (en) | 2018-05-15 |
| CN108034755B CN108034755B (en) | 2020-05-08 |
Family
ID=62096783
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810038621.7A Expired - Fee Related CN108034755B (en) | 2018-01-16 | 2018-01-16 | Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108034755B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047891A (en) * | 2016-06-27 | 2016-10-26 | 中国农业科学院深圳农业基因组研究所 | Gene QDTY 2.9IR66897B capable of obviously increasing rice reproductive-stage drought tolerance and molecular marker method thereof |
-
2018
- 2018-01-16 CN CN201810038621.7A patent/CN108034755B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047891A (en) * | 2016-06-27 | 2016-10-26 | 中国农业科学院深圳农业基因组研究所 | Gene QDTY 2.9IR66897B capable of obviously increasing rice reproductive-stage drought tolerance and molecular marker method thereof |
Non-Patent Citations (3)
| Title |
|---|
| AZIZA A. ABOULILA: "Marker assisted selection for genetic improvement of drought tolerance in hybrid rice (Oryza sativa L.)", 《INTERNATIONAL JOURNAL OF BIOTECHNOLOGY RESEARCH》 * |
| SUNIL KUMAR VERMA等: "QTL for grain yield under water stress and non-stress conditions over years in rice (Oryza sativa L.)", 《AUSTRALIAN JOURNAL OF CROP SCIENCE》 * |
| 滕胜等: "水稻苗期耐旱性基因位点及其互作的分析", 《遗传学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108034755B (en) | 2020-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103952402B (en) | A kind of SNP site relevant to root system of plant proterties and application thereof | |
| CN105063185B (en) | The close linkage mark of wheat spike length main effect QTL and its application | |
| CN103146691B (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| CN103305510A (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN103320437A (en) | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof | |
| CN105950743B (en) | A kind of rice blast resistance gene Pi9 specific Function molecular labeling and its application | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN104630215A (en) | Series molecular markers closely linked with muskmelon powdery mildew resistant gene Pm-2Fand acquisition method of series molecular markers | |
| CN108588272A (en) | A kind of molecular labeling and its application with Plant Height in Wheat and spike length character main effect QTL compact linkage | |
| CN104498486B (en) | The Indel labelling of anti-cucumber powdery mildew gene pm h and its application | |
| CN105950617A (en) | Molecular marker linked with fusarium oxysporumf.sp.lycopersici synder et hansen resistant gene, obtaining method and application | |
| CN106434944A (en) | Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica | |
| CN106148510A (en) | Resistance gene of rice blast Pi5 specific Function molecular marker and application thereof | |
| CN107674922A (en) | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application | |
| CN107893126A (en) | For identifying SSR molecular marker and the application of Polygonatum germ plasm resource | |
| CN106811462A (en) | Gray leaf spot gene Sm anti-with tomato chain Indel marks and its amplimer and application | |
| CN106755359A (en) | A kind of screening or the method and its dedicated kit of assisting sifting difference plant height wheat | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN109735648A (en) | A kind of method and its dedicated kit for screening different mass of 1000 kernel wheats | |
| CN105961185A (en) | Method for cultivating rice blast-resisting rice variety | |
| CN108330208A (en) | A kind of molecular labeling of detection capsicum cytoplasmic male sterility restoring gene | |
| CN102766625B (en) | Molecular marker of rice major gene bph22 (t) resistant to brown planthoppers and application thereof | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| CN106755355A (en) | A kind of molecular labeling TaSnRK2.3B related to thousand grain weight of wheat and stalk soluble sugar content and its application | |
| CN104711254B (en) | The low-phosphorous responsive genes ZmARF31 of corn INDEL molecular labelings and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200508 Termination date: 20210116 |