CN109706266A - Identify wild cabbage epidermal hair whether there is or not molecular labeling and its development approach and application - Google Patents
Identify wild cabbage epidermal hair whether there is or not molecular labeling and its development approach and application Download PDFInfo
- Publication number
- CN109706266A CN109706266A CN201910186568.XA CN201910186568A CN109706266A CN 109706266 A CN109706266 A CN 109706266A CN 201910186568 A CN201910186568 A CN 201910186568A CN 109706266 A CN109706266 A CN 109706266A
- Authority
- CN
- China
- Prior art keywords
- wild cabbage
- cabbage
- epidermal hair
- molecular labeling
- wild
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of molecular biology, more particularly to a kind of identification wild cabbage epidermal hair whether there is or not molecular labeling and its development approach and application, the present invention disclose it is a kind of identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02, with the nucleotide sequence as shown in SEQ ID No.1, the molecular labeling is closely related with wild cabbage epidermal hair character, and disclose primer corresponding with the molecular labeling, forward primer has the nucleotide sequence as shown in SEQ ID No.2, reverse primer has the nucleotide sequence as shown in SEQ ID No.3, invention additionally discloses the development approaches of the molecular labeling, and application of the molecular labeling in wild cabbage breeding is disclosed, heterozygosis and homozygosis in wild cabbage epidermal hair segregating population can be precisely identified on a large scale Genotype makes progeny selection have more specific aim, improves the efficiency of wild cabbage genetic breeding, and reduces the soil space of breeding occupancy.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to it is a kind of identification wild cabbage epidermal hair whether there is or not molecular labeling
And its development approach and application.
Background technique
Plant epidermal hair, between plant epidermis layer and environment, provides one from epidermal cell development for plant
The natural physical barriers in road.Some epidermal hairs defend biological infestation by secretion expellant, alkaloid or noxious material, make to plant
Object is from a vegetarian animal, the injury of insect and the infection of pathogen.In terms of resisting abiotic stress, epidermal hair not only can be with
Mitigate freezing, ultraviolet damage and mechanical damage etc., and the loss of plant internal water and the excessive accumulation of heat can be reduced
And loss.
In rape species, epidermal hair is widely present in Chinese cabbage, leaf mustard, cabbage type rape and several wild wild cabbages, so
And cultivation wild cabbages all at present is no epidermal hair type, such as cabbage, cauliflower, broccoli, collard, cabbage mustard
With brussels sprout etc..There is a kind of agriotype (B.incana) that there is biotic ability quite outstanding, the wild wild cabbage
With a distinguishing feature, i.e., its whole body is covered by epidermal hair, and has resistant to diseases and insects outstanding.Therefore, utilization is wild
Wild cabbage Resource Cultivation has the cultivation wild cabbage of epidermal hair, to the Resistant for improving cultivation wild cabbage, drought-resistant and freeze injury ability, reduces
Applications of pesticide amount and cost input have positive effect.
The Forming Mechanism of model plant arabidopsis epidermal hair is elucidated with substantially, and more than 30 genes have been found to participate in epidermis
The formation and development of hair.Wherein, a tripolymer compounding activation factor GL1-GL3-TTG1 is collectively formed in GL1, TTG1 and GL3,
Promote the expression of GL2 gene, and then regulates and controls the development of epidermal hair.With above-mentioned positive regulating factor on the contrary, TRY is regulated and controled in arabidopsis
The main negative growth factor of trichome development can interact with the end of GL3, bHLH albumen is competitively integrated to GL1
On, TRY-GL3-TTG1 complex is formed, to inhibit the development of epidermal hair.Currently, being had been acknowledged by map-based cloning
BrTTG1 is the regulatory factor that Chinese cabbage epidermal hair is formed.Meanwhile the nucleotide polymorphisms of BrGL1 gene also with cabbage leaf table
Fur is related, but there is not been reported for the gene of the wild wild cabbage epidermal hair of control.
At present in the genetic breeding of wild cabbage epidermal hair character, use is still traditional cross breeding method, this
Breeding mode low efficiency, land occupation space are big.
Summary of the invention
In order to solve the above-mentioned technical problem, the present invention disclose it is a kind of identification wild cabbage epidermal hair whether there is or not molecular labeling
Bol.trichome-CAPS.02, the molecular labeling are closely related with wild cabbage epidermal hair character, and invention additionally discloses the molecule marks
The development approach of note, and application of the molecular labeling in wild cabbage breeding is disclosed, wild cabbage epidermal hair point can be precisely identified on a large scale
Peel off heterozygosis and homozygous genotype in body, and progeny selection is made to have more specific aim, improves the efficiency of wild cabbage genetic breeding, and reduce and educate
The soil space that kind occupies.
The present invention is achieved through the following technical solutions:
Identify wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02, have such as SEQ ID No.1 institute
The nucleotide sequence shown.
AAACCTCTCCAACAAAGCCCACTCTCTCTTTCTCTCTAGATACAAGATAGTATAATAAAAGAGTTTGCC
ACCTCTCTTCTCTGCTCTCTCTTCAGTTTCTCATACTTTCCTCTTCCACCTCCATTGATGGATTCAACGTATCGACG
TCAGCGTCACAACTCTGAAGGTCCATCTCATATAATGTGTTTGATTAGCTTATTACATATGCATGCTCTTTCTTCAT
AACCATATTTTATTTCCTTTGGACATAGTCAATAGTCATCGTGTTTAGCTGAAGTTCATGTTATCATATATTATATT
TCCCTAATTAACCAGACTCTTCGTAGCCTTAATTATCACATATATGTAGTTACGCGATTGTGAATAAACACACCAAT
AACAAACTTCGTAGCCTTTTATTATATATATAGCCCTAATTGTATTTACGTGAATGTGAAATAAGTATTTACGAGCA
GAGATGAGATCAAGAAGGACATGAGATTATTACATACGTAGCGATTAGCAAAAGAGAATATAAAAATATTGGAGCAA
AAAGTAAAAGTTTTGTGTTGTTTTTGATAAATGCAGAAGTGTGTAGCGTAAAGTGG
The molecular labeling overall length 587bp, SNP appear in 157bp, and underscore show SNP, and hairless wild cabbage is A, and hairiness is sweet
Indigo plant is G, and restriction enzyme site is between 131-132bp, 157-158bp and 316-317bp, and the amplified production of the molecular labeling is in digestion
When used restriction enzyme be HinfI.
Identify wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 primer, forward primer has
The nucleotide sequence (5 '-AAACCTCTCCAACAAAGCCCA-3 ') as shown in SEQ ID No.2, reverse primer have such as SEQ
Nucleotide sequence shown in ID No.3 (5 '-CCACTTTACGCTACACACTTC-3 ').
Identify wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 development approach, including following step
It is rapid:
1) hybridized with a hairless wild cabbage with the portion wild wild cabbage B.incana of hairiness and generate F1Generation, F1Generation selfing obtains F2
For plant, 1063 F2(contain 149 clone F2 groups and 914 single plant F2:3Family) in 778 hairless, 285 hairiness,
Meet 3:1 segregation ratio (Chi-square value=1.628, P > 0.05,Chi-square Test is not significant, meets the hereditary extractor gauge of 3:1 Rule), show that the epidermal hair of the wild wild cabbage is controlled by Recessive genes；
2) 149 clone F are utilized2Informative population wild cabbage genetic linkage maps (Mei et al, 2013, TAG 126:
549-556), and by the epidermal hair assignment of genes gene mapping to the section wild cabbage C01 chromosome the preceding paragraph 4.3cM (17.56MB)；
3) from F2No epidermal hair is selected in group and there are individual each 50 plants of epidermal hair, and parent is carried out entirely with extremely mixed pond
Genome resurveys sequence, according to Takagi etc. (Takagi et al., 2013, Plant J 74:174-183) method, using Δ
(SNP-index) method identification with the significant relevant difference hot spot region of wild cabbage epidermal hair character, in combination with above-mentioned QTL positioning knot
Wild cabbage epidermal hair character is finally located on wild cabbage C01 chromosome in the section of 1.04Mb by fruit；
4) by comparing with the homologous of arabidopsis with gene annotation information, one candidate gene of discovery in above-mentioned section
BolTRY-l, the gene and arabidopsis regulation epidermal hair Gene A thTRY have similar functions, qRT-PCR analysis shows that, F2Group
In body candidate gene BolTRY-l the expression quantity of hairless plant be significantly higher than hairiness plant (Mei et al., 2017,
TAG130:1953-1959)；
5) further the CDS of clone's hairiness wild cabbage and hairless wild cabbage BolTRY-l gene, sequence alignment are found, the two
There are SNP for CDS sequence.
The present invention also provides a kind of epidermal hair whether there is or not head cabbage varieties identification method, comprising the following steps:
(1) using wild cabbage DNA to be identified as template, amplifier molecule mark Bol.trichome-CAPS.02, primer be with
The nucleotide sequence as shown in SEQ ID No.2 and SEQ ID No.3；
(2) amplified production carries out digestion using restriction enzyme HinfI, carries out gel electrophoresis after digestion, obtain 271-bp,
Five kinds of specific bands of 185-bp, 158-bp, 131-bp and 27-bp；
(3) there is the cabbage plant of tetra- kinds of specific bands of 271-bp, 158-bp, 131-bp and 27-bp, for homozygous hairiness
There are tri- kinds of bands of 271-bp, 185-bp and 131-bp in individual, is homozygous hairless plant, while five kinds of special items occur
Band is heterozygous individual.
The present invention also provides it is a kind of identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 sweet
Purposes in blue breeding.
The present invention also provides it is a kind of identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 selecting
Educate the purposes in the head cabbage varieties of skin factor of different hair character.
The present invention also provides purposes of the molecular labeling primer in wild cabbage breeding.
The present invention also provides purposes of the molecular labeling primer in the head cabbage varieties of breeding skin factor of different hair character.
The present invention also provides a kind of purposes of head cabbage varieties identification method in wild cabbage breeding.
The present invention also provides a kind of use of head cabbage varieties identification method in the head cabbage varieties of breeding skin factor of different hair character
On the way.
Compared with prior art, the present invention having the following advantages and benefits:
1, the present invention identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02, the molecular labeling with
Wild cabbage epidermal hair character is closely related, can be applied to wild cabbage marker assisted selection, realizes extensive precisely identification wild cabbage epidermal hair
Heterozygosis and homozygous genotype in segregating population make progeny selection have more specific aim, improve the efficiency of wild cabbage genetic breeding, and reduce
The soil space that breeding occupies；
2, epidermal hair of the present invention whether there is or not head cabbage varieties identification method, this method utilize and the close phase of wild cabbage epidermal hair character
The primer of the molecular labeling Bol.trichome-CAPS.02 of pass, and digestion rear electrophoresis is carried out through restriction enzyme HinfI, reach mirror
The effect for determining wild cabbage genotype extremely can early judge to filter out heterozygous genotypes plant using the identification method, by itself and homozygous nothing
Hair plant distinguishes, to retain it into next round selection, can enhance the purpose of breeding selection, improve efficiency of selection,
Shorten the breeding time limit.
Detailed description of the invention
Attached drawing described herein is used to provide to further understand the embodiment of the present invention, constitutes one of the application
Point, do not constitute the restriction to the embodiment of the present invention.In the accompanying drawings:
Fig. 1 is the field epidermal hair character figure of two parent of wild cabbage of the present invention.
Width figure is wild cabbage epidermal hair BSA character positioning result figure of the present invention on Fig. 2, and lower width figure is the amplification of C01 chromosome
Figure, the position of candidate gene is at 14.43Mb.
Fig. 3 is the restriction enzyme site schematic diagram of primer and restriction enzyme HinfI used in molecular labeling of the present invention
(C01 is hairiness wild cabbage parent, and C41 is hairless wild cabbage parent, and the subsequent sequence of F is positive primer sequence, and the subsequent sequence of R is
Reverse primer sequences, ATG are initiation codon, and white overstriking letter is SNP site, and white line sequence coverage is that HinfI can
The base sequence of identification, black inverted triangle represent restriction enzyme site, and intermediate base is indicated by ellipsis)
Fig. 4 is that (M represents marker, C01 to detection case schematic diagram of the molecular labeling of the present invention in hairiness and hairless wild cabbage
Hairiness wild cabbage parent is represented, C41 represents hairless wild cabbage parent, F1Represent hybrid F1)。
Specific embodiment
To make the objectives, technical solutions, and advantages of the present invention clearer, below with reference to embodiment and attached drawing, to this
Invention is described in further detail, and exemplary embodiment of the invention and its explanation for explaining only the invention, are not made
For limitation of the invention.
Embodiment 1
The present invention it is a kind of identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 development approach,
The following steps are included:
1) hybridized with a hairless wild cabbage with the portion wild wild cabbage B.incana of hairiness and generate F1Generation, F1In generation, is selfed and plants again
Yu great Tian is planted, 1063 F are obtained2(contain 149 clone F for plant2Group and 914 single plant F2:3Family), in F2For plant
The the 4th to the 5th leaf phase, observe by the naked eye the presence or absence of epidermal hair, F2Hairless for 778 in plant, 285 hairiness meet
The segregation ratio (chi-square value=1.628, P > 0.05) of 3:1, shows that the epidermal hair of the wild wild cabbage is controlled by Recessive genes；
2) 149 clone F are utilized2Informative population wild cabbage genetic linkage maps (Mei et al., 2013, TAG 126:
549-556), and by the epidermal hair assignment of genes gene mapping to the section wild cabbage C01 chromosome the preceding paragraph 4.3cM (17.56MB)；
3) from F2No epidermal hair is picked in group and there are each 50 plants of individual of epidermal hair, and parent is carried out with extremely mixed pond
Full-length genome resurveys sequence, according to Takagi etc. (Takagi et al., 2013, Plant J 74:174-183) method, using Δ
(SNP-index) method identification with the significant relevant difference hot spot region of wild cabbage epidermal hair character, in combination with above-mentioned QTL positioning knot
Wild cabbage epidermal hair character is finally located on wild cabbage C01 chromosome in the section of 1.04Mb, as shown in Figure 2 by fruit；
4) by with arabidopsis it is homologous compare with gene annotation information, according to corresponding function annotation and and plant epidermal hair
Related existing literature finds that a candidate gene BolTRY-l, the gene and arabidopsis regulate and control epidermal hair in above-mentioned section
Gene A thTRY have similar functions, qRT-PCR analysis shows that, F2Table of the candidate gene BolTRY-l in hairless plant in group
It is significantly higher than hairiness plant (Mei et al., 2017, TAG130:1953-1959) up to amount；
5) further we have cloned the CDS of hairiness wild cabbage and hairless wild cabbage BolTRY-l gene, and sequence alignment is found, and two
There are SNP for the CDS sequence of person.
6) according to the SNP site upstream and downstream sequence, the primer of amplifiable above-mentioned SNP site out is designed, as shown in figure 3, its
Forward primer sequence is 5 '-AAACCTCTCCAACAAAGCCCA-3 ', reverse primer sequences 5 '-
CCACTTTACGCTACACACTTC-3 ', amplified fragments size are 587-bp.According to above-mentioned SNP type and neighbouring sequence, determine
The restriction enzyme that can distinguish its base type is HinfI.
Embodiment 2
Invention it is a kind of identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 selecting
Educate the application process in the head cabbage varieties of skin factor of different hair character, the specific steps are as follows:
(1) using wild cabbage single plant Seedling Stage leaf DNA as template, amplifier molecule marks Bol.trichome-CAPS.02, draws
Object is with the nucleotide sequence as shown in SEQ ID No.2 and SEQ ID No.3；
(2) the every 10 μ l of pcr amplification product handles 1h, enzyme after digestion with the restriction enzyme HinfI of 2.5U under the conditions of 37 DEG C
Product is cut through 4% agarose gel electrophoresis, obtains five kinds of specific bands of 271-bp, 185-bp, 158-bp, 131-bp and 27-bp；
(3) as shown in figure 4, there is the cabbage plant of tetra- kinds of specific bands of 271-bp, 158-bp, 131-bp and 27-bp, it is
, there are tri- kinds of bands of 271-bp, 185-bp and 131-bp, for homozygous hairless plant, occurs simultaneously in homozygous hairiness individual
Five kinds of specific bands are heterozygous individual, and the present age shows as hairless, and offspring has separation, can retain for further breeding selection, most
Achieve the purpose that cultivation and identification hairiness wild cabbage eventually.
Embodiment 3
The present invention it is a kind of identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 in back cross breeding
In application process:
As shown in Figure 1, being parent with disease-resistant hairless wild cabbage C41 and hairiness wild cabbage C01, hybridize the F of generation1Continuation and C41
Backcrossing, obtains 80 parts of BC1F1Backcross population is research material, carries out transfer hairiness character (single allogene) to disease-resistant hairless sweet
The back cross breeding of blue C41 is studied.Wherein 80 parts of materials all show hairless, are carried out using the molecular labeling developed in embodiment 1
Genotype identification, steps are as follows:
1) with 80 parts of BC1F1The leaf DNA of backcross population Seedling Stage is template；
2) PCR amplification is carried out using following primer:
Forward primer sequence is 5 '-AAACCTCTCCAACAAAGCCCA-3 ', reverse primer sequences 5 '-
CCACTTTACGCTACACACTTC-3 ', amplified fragments size are 587-bp；
3) PCR reaction system: total volume 10ul, specific ingredient are as follows:
| Ingredient | Volume |
| ddH2O | 6.7μL |
| 10×TaqBuffer (contains Mg2+) | 1.0μL |
| dNTPs(10Mm) | 0.2μL |
| Forward primer (50ng/ μ L) | 0.5μL |
| Reverse primer (50ng/ μ L) | 0.5μL |
| Taqase(5U/μL) | 0.1μL |
| DNA profiling (50ng/ μ L) | 2.0μL |
| Total volume | 10.0μL |
4) PCR amplification program: 94 DEG C of 5min, [94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 1min] × 35 are recycled, 72 DEG C of 10min.
It is saved under the conditions of 4 DEG C after operation.
5) digestion of pcr amplification product: every 10 μ l handles 1h under the conditions of 37 DEG C with the restriction enzyme HinfI of 2.5U；
6) there is tri- kinds of 271-bp, 185-bp and 131-bp specifically after the separation of 4% agarose gel electrophoresis in digestion products
Band has 38 parts of materials, thus it is speculated that for homozygous hairless plant；There is 271-bp, 185-bp, 158-bp, 131-bp and 27-bp
Five kinds of specific bands have 42 parts of materials, thus it is speculated that are heterozygous genotypes plant, the two ratio is close to 1:1.
7) it randomly chooses in step 6) and 5 parts of (nothings of material of tri- kinds of specific bands of 271-bp, 185-bp and 131-bp occurs
Hair), occur 5 parts of material (hairless) of five kinds of specific bands of 271-bp, 185-bp, 158-bp, 131-bp and 27-bp, respectively from
It hands over and plants and investigate next-generation plant epidermal hair character behind crop field, as a result, it has been found that, show the phenotype of three kinds of stripping offsprings
All it is hairless, and does not separate, consistent with previous generation's phenotype, i.e., the previous generation is homozygous hairless plant；Show 5 strippings
There is the segregation phenomenon of epidermal hair character in the phenotype of offspring, i.e. the previous generation is heterozygous genotypes plant.
Above-mentioned qualification result shows in the back cross breeding of transfer wild cabbage epidermal hair, is identified and is screened by functional label,
It is heterozygosis single plant that the material of five kinds of specific bands of 271-bp, 185-bp, 158-bp, 131-bp and 27-bp, which occurs, in reservation, is continued
It carries out second with recurrent parent C41 to be returned, theoretical every generation can reduce by 50% workload.Meanwhile it is auxiliary by molecular labeling
Selection is helped, in the back cross breeding for shifting single allogene (such as epidermis hair gene in this research), it is only necessary to which 5 years just available
BC3F2, traditional back cross breeding need to 8 years (more 3 years F1Selfing generates F2), hence it is evident that shorten the breeding time limit, accelerates breeding process.
Above-described specific embodiment has carried out further the purpose of the present invention, technical scheme and beneficial effects
It is described in detail, it should be understood that being not intended to limit the present invention the foregoing is merely a specific embodiment of the invention
Protection scope, all within the spirits and principles of the present invention, any modification, equivalent substitution, improvement and etc. done should all include
Within protection scope of the present invention.
Sequence table
<110>Southwest University
<120>identification wild cabbage epidermal hair whether there is or not molecular labeling and its development approach and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 587
<212> DNA
<213>artificial sequence (1)
<400> 1
aaacctctcc aacaaagccc actctctctt tctctctaga tacaagatag tataataaaa 60
gagtttgcca cctctcttct ctgctctctc ttcagtttct catactttcc tcttccacct 120
ccattgatgg attcaacgta tcgacgtcag cgtcacaact ctgaaggtcc atctcatata 180
atgtgtttga ttagcttatt acatatgcat gctctttctt cataaccata ttttatttcc 240
tttggacata gtcaatagtc atcgtgttta gctgaagttc atgttatcat atattatatt 300
tccctaatta accagactct tcgtagcctt aattatcaca tatatgtagt tacgcgattg 360
tgaataaaca caccaataac aaacttcgta gccttttatt atatatatag ccctaattgt 420
atttacgtga atgtgaaata agtatttacg agcagagatg agatcaagaa ggacatgaga 480
ttattacata cgtagcgatt agcaaaagag aatataaaaa tattggagca aaaagtaaaa 540
gttttgtgtt gtttttgata aatgcagaag tgtgtagcgt aaagtgg 587
<210> 2
<211> 21
<212> DNA
<213>artificial sequence (2)
<400> 2
aaacctctcc aacaaagccc a 21
<210> 3
<211> 21
<212> DNA
<213>artificial sequence (3)
<400> 3
ccactttacg ctacacactt c 21
Claims (10)
1. identify wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02, which is characterized in that have such as SEQ
Nucleotide sequence shown in ID No.1.
2. as described in claim 1 identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 draw
Object, it is characterised in that: its forward primer has the nucleotide sequence as shown in SEQ ID No.2, and reverse primer has such as SEQ
Nucleotide sequence shown in ID No.3.
3. as described in claim 1 identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 exploitation
Method, which comprises the following steps:
1) hybridized with a hairless wild cabbage with the portion wild wild cabbage B.incana of hairiness and generate F1Generation, F1Generation selfing obtains F2Dai Zhi
Strain, according to F2For segregation ratio hairless in plant and hairiness character, the base for controlling the epidermal hair character of the wild wild cabbage is determined
Because of type；
2) F is utilized2For the clone F in plant2Informative population wild cabbage genetic linkage maps, and by the epidermal hair assignment of genes gene mapping to sweet
The section of blue C01 chromosome the preceding paragraph 4.3cM；
3) from F2Equal number of no epidermal hair is selected in group and has the plant of epidermal hair, and to parent and extremely mixed pond progress is complete
Genome resurveys sequence, according to the methods of Takagi, is identified using Δ (SNP-index) method significant related to wild cabbage epidermal hair character
Difference hot spot region, in combination with above-mentioned QTL positioning result, finally by wild cabbage epidermal hair character be located in wild cabbage C01 dyeing
On body in the section of 1.04Mb；
4) by comparing with the homologous of arabidopsis with gene annotation information, one candidate gene of discovery in above-mentioned section
BolTRY-l, the gene and arabidopsis regulation epidermal hair Gene A thTRY have similar functions, qRT-PCR analysis shows that, F2Group
Candidate gene BolTRY-l is significantly higher than hairiness plant in the expression quantity of hairless plant in body；
5) further the CDS of clone's hairiness wild cabbage and hairless wild cabbage BolTRY-l gene, sequence alignment are found, the CDS sequence of the two
There are SNP for column.
4. epidermal hair whether there is or not head cabbage varieties identification method, which comprises the following steps:
(1) using wild cabbage DNA to be identified as template, amplifier molecule marks Bol.trichome-CAPS.02, and primer is with such as SEQ
Nucleotide sequence shown in ID No.2 and SEQ ID No.3；
(2) amplified production carries out digestion using restriction enzyme HinfI, and gel electrophoresis is carried out after digestion, obtains 271-bp, 185-
Five kinds of specific bands of bp, 158-bp, 131-bp and 27-bp；
(3) there is the cabbage plant of tetra- kinds of specific bands of 271-bp, 158-bp, 131-bp and 27-bp, for homozygous hairiness
There are tri- kinds of bands of 271-bp, 185-bp and 131-bp in body, is homozygous hairless plant, while five kinds of specific bands occur
It is heterozygous individual.
5. as described in claim 1 identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 in wild cabbage
Purposes in breeding.
6. as described in claim 1 identification wild cabbage epidermal hair whether there is or not molecular labeling Bol.trichome-CAPS.02 in breeding
Purposes in the head cabbage varieties of skin factor of different hair character.
7. purposes of the molecular labeling primer as claimed in claim 2 in wild cabbage breeding.
8. purposes of the molecular labeling primer as claimed in claim 2 in the head cabbage varieties of breeding skin factor of different hair character.
9. purposes of the head cabbage varieties identification method as claimed in claim 4 in wild cabbage breeding.
10. use of the head cabbage varieties identification method as claimed in claim 4 in the head cabbage varieties of breeding skin factor of different hair character
On the way.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910186568.XA CN109706266B (en) | 2019-03-12 | 2019-03-12 | Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910186568.XA CN109706266B (en) | 2019-03-12 | 2019-03-12 | Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109706266A true CN109706266A (en) | 2019-05-03 |
| CN109706266B CN109706266B (en) | 2022-04-01 |
Family
ID=66266640
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910186568.XA Active CN109706266B (en) | 2019-03-12 | 2019-03-12 | Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706266B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164502A (en) * | 2017-06-15 | 2017-09-15 | 西南大学 | The molecular labeling being closely related and its application are whether there is with cabbage leaves epidermal hair |
-
2019
- 2019-03-12 CN CN201910186568.XA patent/CN109706266B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164502A (en) * | 2017-06-15 | 2017-09-15 | 西南大学 | The molecular labeling being closely related and its application are whether there is with cabbage leaves epidermal hair |
Non-Patent Citations (5)
| Title |
|---|
| MARGARET GRUBER ET AL: "The biochemical composition and transcriptome of cotyledons from Brassica napus lines expressing the AtGL3 transcription factor and exhibiting reduced flea beetle feeding", 《BMC PLANT BIOLOGY》 * |
| MARTINA PESCH ET AL: "Role of TRIPTYCHON in trichome patterning in Arabidopsis", 《BMC PLANT BIOLOGY》 * |
| NAGHABUSHANA K. NAYIDU ET AL: "Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae", 《PLOS ONE》 * |
| YAICHI KAWAKATSU ET AL: "A GLABRA1 ortholog on LG A9 controls trichome number in the Japanese leafy vegetables Mizuna and Mibuna (Brassica rapa L. subsp. nipposinica L. H. Bailey): evidence from QTL analysis", 《J PLANT RES》 * |
| 张继伟等: "植物表皮毛研究进展", 《植物学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109706266B (en) | 2022-04-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210102219A1 (en) | Pepper plants with improved disease resistance | |
| CN105385697B (en) | Sesame inflorescence finite basis is because of Sidt1 and its SNP marker | |
| AU2018258323B2 (en) | Pepper plants with improved pest resistance | |
| US11800848B2 (en) | Anthracnose resistant alfalfa plants | |
| CN110093346A (en) | With the molecular marker and application thereof of purple tsai-tai a kind of sedge color gene linkage | |
| EP2486155B1 (en) | Methods of quantifying target organisms and creating reniform resistant cotton plants | |
| US10561084B2 (en) | Molecular markers for blackleg resistance gene rlm2 in brassica napus and methods of using the same | |
| CN113736910A (en) | Linkage molecular marker of peanut single plant pod number main effect QTL site qPN7 and application thereof | |
| AU2014268142B2 (en) | Disease resistance loci in onion | |
| AU2020258310A1 (en) | Powdery mildew resistant pepper plants | |
| CN107586881B (en) | Corn molecular marker and application thereof in detecting corn flowering phase related traits | |
| CN109706266A (en) | Identify wild cabbage epidermal hair whether there is or not molecular labeling and its development approach and application | |
| US10793918B2 (en) | Molecular markers for blackleg resistance in canola and methods of using the same | |
| Moffat | Moving forest trees into the modern genetics era | |
| US20170150693A1 (en) | Methods and compositions for producing sorghum plants with anthracnose resistance | |
| CN105385772B (en) | Primer for screening wheat leaf rust resistance QTL and its application | |
| Weiss et al. | Genotyping Antirrhinum commercial varieties using miniature inverted-repeat transposable elements (MITEs) | |
| CN113755637B (en) | Wheat speckle leaf gene Lm5 coseparated KASP molecular marker and application thereof | |
| CN109355426B (en) | Diagnostic molecular marker for detecting powdery mildew resistance gene Pm2a of wheat and application thereof | |
| CN108841994B (en) | Green-keeping related gene marker in winter wheat under genetic background of wheat 895 and application | |
| Hu | Genetic linkage maps: strategies, resources and achievements | |
| CN108034755B (en) | Molecular marker linked with rice drought-enduring gene qLRI9 and application thereof | |
| Leijman | Fine mapping of resistance against root aphids in sugar beet | |
| Aguilar Rangel | The Role of introgression from teosinte (Zea mays ssp. mexicana) in the adaptation of maize to the highlands of Mexico= El papel adaptativo de la introgresión de teocintle Zea mays ssp. mexicana al maiz en los valles altos del centro de México | |
| CN117385074A (en) | SNP molecular marker for identifying resistance of cucumber to bacterial stem soft rot and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |