CN109706200A - A method of preparing laminaribiose - Google Patents

Abstract

The invention discloses multienzyme molecule machines outside a kind of construct, and the method for cascading catalysis by multienzyme to prepare laminaribiose belongs to the enzymatic preparation field of laminaribiose.The preparation method of laminaribiose disclosed in this invention includes that the glucose unit in starch is converted into Cori ester by glucosan phosphorylase, and Cori ester synthesizes laminaribiose by laminaribiose phosphorylase with glucose.Promote other auxiliary enzymes of the complete phosphorus solution of starch, such as isoamylase and glucanotransferase etc. by addition in the process, can be further improved the utilization rate of starch and the ultimate density of laminaribiose.The technical method has substrate cheap and easy to get, and production cost is low, and product yield is high, isolate and purify the advantages such as simple, it can be achieved that laminaribiose large-scale production.

Description

A method of preparing laminaribiose

Technical field

The invention belongs to biological manufacturing fields, and in particular to one kind passes through external enzyme process using starch and glucose as raw material The method for preparing laminaribiose.

Background technique

Laminaribiose is one kind by β -1, and the oligosaccharide of 3 glucosides key connections is mainly used for agriculture field, and can be used for day Right preservative uses.

Currently, laminaribiose produces the polysaccharide such as main or traditional dilute acid hydrolysis pine needle or thallus laminariae.The technique mistake Journey low yield, separation and Extraction are at high cost, lead to holding at high price for laminaribiose.Laminaribiose can also utilize chemical synthesis It is prepared, using halogen glycosyl as glycosyl donor, elder brother is obtained by the O glycosylation from Koenigs-Knorr method Cloth disaccharides.However final products do not allow easy purification, final yield is lower than 10%.

With the development of industrial biotechnology of enzymes, there is scientist to begin trying enzymatic clarification laminaribiose.Japanese Scientists With regard to utilizing 3 enzymes (sucrose phosphorylase, glucose isomerase and laminaribiose phosphorylase), elder brother is produced by substrate of sucrose Cloth disaccharides, however the yield of laminaribiose only has 50% or so, the higher cost for causing subsequent product to separate.

It would therefore be highly desirable to a kind of low cost is developed, and low pollution, the laminaribiose enzyme preparation method of high yield pulp1.

Summary of the invention

Technical problem to be solved by the invention is to provide a kind of methods for preparing laminaribiose, with starch and grape Sugar is substrate, and by external multienzymatic reaction system catalytic production laminaribiose, this method has yield high, and production cost is low, ring The advantages that border is friendly.

In order to solve the above technical problems, the technical solution used in the present invention is:

The present invention provides a kind of methods for preparing laminaribiose using enzymic catalytic reaction, which is characterized in that reaction system In contain starch, glucose, starch phosphorylase (α-glucan phosphorylase, EC 2.4.1.1, α GP) and thallus laminariae Two saccharophosphorylases (laminaribiose phosphorylase, EC 2.4.1.31, LBP).In the present invention, starch and Glucose is substrate, and starch is catalytically conveted to glucose -1- phosphoric acid, Cori ester and glucose through starch phosphorylase It is catalyzed through laminaribiose phosphorylase and generates laminaribiose.

Preferably, starch is soluble starch, soluble Amylose, soluble Amylopectin, amylodextrin, malt The mixture of the arbitrary proportion of any one or more in dextrin, malt polysaccharide and maltose.

Preferably, the concentration of starch is 1-200g/L, further preferably 5-50g/L, more preferably 8- in reaction system 20g/L, most preferably 10g/L.

Preferably, in reaction system glucose concentration be 1-1000mM, further preferably 10-400mM, more preferably For 50-200mM, most preferably 100mM.

Preferably, the dosage of starch phosphorylase is 0.1-50U/mL, further preferably 0.5-10U/ in reaction system ML, more preferably 1-5U/mL, most preferably 2U/mL.

Preferably, the dosage of laminaribiose phosphorylase is 0.1-50U/mL, further preferably 0.5- in reaction system 10U/mL, more preferably 1-5U/mL, most preferably 2U/mL.

Preferably, the temperature of enzymic catalytic reaction is 10-95 DEG C, further preferably 20-80 DEG C, more preferably 30-60 DEG C, most preferably 50 DEG C.

Preferably, the time of enzymic catalytic reaction is 0.5-150 hours, further preferably 1-60 hours, more preferably 6- 48 hours, most preferably 24-36 hours.

Preferably, buffer, phosphate, magnesium salts are also contained in reaction system.

It will be understood by those skilled in the art that various buffers are used equally for the present invention, such as HEPES buffer solution, Tris-HCl buffer, MOPS buffer, citrate buffer such as sodium citrate buffer solution etc., it is preferable that buffer is HEPES buffer solution.Preferably, the pH of buffer is 5.0-8.0, more preferably 6.0-7.5, most preferably 7.0.Preferably, instead Answer the concentration of buffer in system for 10-500mM, further preferably 20-150mM, more preferably 50-120mM, most preferably For 100mM.

It will be understood by those skilled in the art that various phosphate are used equally for present invention, such as potassium phosphate, sodium phosphate etc., Preferably, phosphate is potassium phosphate.Preferably, phosphatic concentration is 1-50mM, further preferably 2- in reaction system 30mM, more preferably 5-25mM, most preferably 20mM.

It will be understood by those skilled in the art that various magnesium salts are used equally for present invention, such as magnesium chloride, magnesium sulfate etc., it is excellent Selection of land, magnesium salts are magnesium chloride.Preferably, in reaction system magnesium salts concentration be 1-20mM, further preferably 2-15mM, more Preferably 3-10mM, most preferably 5mM.

In preferred embodiments, glucanotransferase (4- α-is added in the reaction system Glucanotransferase, EC 2.4.1.25,4GT)；It is highly preferred that starch phosphorylase is first added in the reaction system And laminaribiose phosphorylase, glucanotransferase is added after reacting a period of time.

Preferably, the dosage of glucanotransferase is 0.1-10U/mL, further preferably 0.2-5 U/ in reaction system ML, more preferably 0.5-2U/mL, most preferably 1U/mL.

Preferably, starch phosphorylase and laminaribiose phosphorylase are first added in the reaction system, it is anti-at 10-95 DEG C Answer 0.25-75 hours, further preferably 20-80 DEG C reaction 0.5-36 hours, more preferably 30-60 DEG C reaction 6-30 hours, Most preferably 50 DEG C reaction 12-24 hours；Preferably, after glucanotransferase being added afterwards in the reaction system, continue in 10- 95 DEG C reaction 0.25-75 hours, further preferably 20-80 DEG C reaction 0.5-36 hours, more preferably in 30-60 DEG C of reaction 6- 30 hours, most preferably 50 DEG C reaction 12-24 hours.

In preferred embodiments, when containing α -1 in starch, 6 glycosidic bonds are (for example, soluble starch, soluble branch Chain starch, amylodextrin, maltodextrin, malt polysaccharide) when, isoamylase (isoamylase, EC are added in the reaction system 3.2.1.68 IA)；It is highly preferred that isoamylase is first added in the reaction system, starch phosphorus is added after reacting a period of time Phosphorylase and laminaribiose phosphorylase；Alternatively, isoamylase is first added in the reaction system, add again after reacting a period of time Enter starch phosphorylase, laminaribiose phosphorylase and glucanotransferase；Or different starch is first added in the reaction system Enzyme is added starch phosphorylase, laminaribiose phosphorylase after reacting a period of time, then adds Portugal after reacting a period of time Glycan transferase.

Preferably, in reaction system isoamylase dosage be 0.1-10U/mL, further preferably 0.2-5 U/mL, more Preferably 0.5-2U/mL, most preferably 1U/mL.

Preferably, isoamylase is first added in the reaction system, 10-99 DEG C reaction 0.5-72 hours, further preferably 30-95 DEG C reaction 1-48 hours, more preferably 50-90 DEG C reaction 6-24 hours, most preferably 85 DEG C react 12 hours；It is excellent Selection of land, is added starch phosphorylase and laminaribiose phosphorylase afterwards in the reaction system, or after starch phosphorylation is added After enzyme, laminaribiose phosphorylase and glucanotransferase, continue 10-95 DEG C reaction 0.5-150 hours, further preferably 20-80 DEG C reaction 1-60 hours, more preferably 30-60 DEG C reaction 6-48 hours, most preferably 50 DEG C reaction 24-36 hours； Preferably, starch phosphorylase, laminaribiose phosphorylase is added afterwards in the reaction system, in 10-95 DEG C of reaction 0.25-75 Hour, further preferably 20-80 DEG C reaction 0.5-36 hours, more preferably 30-60 DEG C reaction 6-30 hours, most preferably exist 50 DEG C reaction 12-24 hours, add glucanotransferase, 10-95 DEG C reaction 0.25-75 hours, further preferably exist 20-80 DEG C reaction 0.5-36 hours, more preferably 30-60 DEG C reaction 6-30 hours, most preferably 50 DEG C reaction 12-24 hours.

In preferred embodiments, when containing α -1 in starch, 6 glycosidic bonds are (for example, soluble starch, soluble branch Chain starch, amylodextrin, maltodextrin, malt polysaccharide) when, the α -1 wherein contained, 6 glucosides are first catalytically decomposed with isoamylase Key.

Preferably, with α -1 for containing in isoamylase catalytic decomposition starch, when 6 glycosidic bond, starch in reaction system Concentration is 1-200g/L, further preferably 5-50g/L, more preferably 8-20g/L, most preferably 10 g/L；Isoamylase Dosage is 0.1-10U/mL, further preferably 0.2-5U/mL, more preferably 0.5-2 U/mL, most preferably 1U/mL；In 10- 99 DEG C reaction 0.5-72 hours, further preferably 30-95 DEG C reaction 1-48 hours, it is more preferably small in 50-90 DEG C of reaction 6-24 When, most preferably reacted 12 hours at 85 DEG C.

Preferably, with α -1 for containing in isoamylase catalytic decomposition starch, when 6 glycosidic bond, also contain in reaction system Buffer, magnesium salts.

It will be understood by those skilled in the art that various buffers are used equally for the present invention, such as sodium acetate buffer, HEPES buffer solution, citrate buffer such as sodium citrate buffer solution etc., it is preferable that buffer is sodium acetate buffer. Preferably, the pH of buffer is 4.0-8.0, more preferably 4.5-6.5, most preferably 5.5.Preferably, it is buffered in reaction system The concentration of liquid is 1-50mM, further preferably 2-20mM, more preferably 3-10mM, most preferably 5mM.

It will be understood by those skilled in the art that various magnesium salts are used equally for present invention, such as magnesium chloride, magnesium sulfate etc., it is excellent Selection of land, magnesium salts are magnesium chloride.Preferably, the concentration of magnesium salts is 0.01-10mM, further preferably 0.1- in reaction system 5mM, more preferably 0.2-1mM, most preferably 0.5mM.

In the present invention, the starch phosphorylase, laminaribiose phosphorylase, isoamylase in various sources can be used And glucanotransferase.For example, starch phosphorylase can be from Thermotoga maritima (Thermotoga maritima), warm Fiber clostridium (Clostridium thermocellum), thermus thermophilus (Thermus thermophilus) etc., it is preferable that Starch phosphorylase derives from Thermotoga maritima；Laminaribiose phosphorylase can derive from series bacillus (Paenibacillus sp.), euglena gracilis (Euglena Gracilis), acholeplasma (Acholeplasma Laidlawii) etc., it is preferable that laminaribiose phosphorylase derives from series bacillus；Isoamylase can be from vulcanization Leaf bacterium (Sulfolobus tokodaii), arabidopsis (Arabidopsis thaliana), Flavobacterium (Flavobacterium Sp.) etc., it is preferable that isoamylase derives from sulfolobus solfataricus；Glucanotransferase can derive from thermophilic high temperature coccus (Thermococcus litoralis), bacillus subtilis (Bacillus subtilis), clostridium butyricum (Clostridium butyricum) etc., it is preferable that glucanotransferase derives from thermophilic high temperature coccus.The present invention can be with Using amino acid sequence and the various enzymes in above-mentioned source at least 70%, preferably at least 80%, more preferably at least 90%, most Starch phosphorylase, laminaribiose phosphorylase, isoamylase and the glucanotransferase of preferably at least 95% identity.

Starch phosphorylase and laminaribiose phosphorylase is added using starch and glucose as substrate in the present invention, prepares double Enzyme reaction system, enzymatic pathway include: to convert grape for a glucose unit in starch by starch phosphorylase Sugar -1- phosphoric acid；Laminaribiose is converted by glucose and Cori ester by laminaribiose phosphorylase.

Since starch is a kind of mixture being made of the direct-connected starch and amylopectin of different chain length.Amylose Portugal It is connected between grape sugar unit with α-Isosorbide-5-Nitrae glycosidic bond, and amylopectin passes through α -1,6 glycosidic bonds are connected with starch backbone, and starch Phosphorylase can not -1,6 glycosidic bond of decomposing alpha.In order to improve the yield of Cori ester, energy is added in the reaction system Debranching enzyme-isoamylase of α -1,6 glycosidic bond in enough starch-splittings.In addition, final due to starch phosphorylation enzyme hydrolysis starch Product is maltose and maltotriose, in order to make the glucose unit in starch is as much as possible to be converted into glucose 1- phosphoric acid, It also added glucanotransferase, the oligosaccharide of short chain can be polymerize the oligosaccharide for becoming long-chain, and the oligomerization of the long-chain by it Sugar can be re-used again by glucosan phosphorylase, to improve the utilization rate of starch.

Since Phos is circulation during the reaction, so only needing to add a small amount of phosphate buffer Starting reaction, and make to react lasting generation, so in actual production, phosphatic use not will cause environmental pressure.

Technical solution of the present invention compared with prior art, has the advantages that

The present invention is in a multienzymatic reaction system, using starch and glucose as raw material, passes through external multienzyme catalyzed conversion For laminaribiose, and by process optimization, addition can promote amylolytic enzyme and convert the short chain Fructus Hordei Germinatus oligose of remnants to The enzyme of long-chain Fructus Hordei Germinatus oligose, significantly improves transformation efficiency, and high yield pulp1 substantially reduces the separation costs of laminaribiose again.This hair Bright method has simplicity, and raw material availability is high, laminaribiose yield is high, and separation costs are low, advantages of environment protection, Ke Yishi The large-scale production of existing laminaribiose.

Detailed description of the invention

Fig. 1 is the schematic diagram for the external multienzyme catalytic route that starch and glucose are converted into laminaribiose；Wherein: IA For isoamylase, α GP is starch phosphorylase, and 4GT is glucanotransferase, and LBP is laminaribiose phosphorylase.

Fig. 2 is that SDS-PAGE detects 4 key enzymes；Wherein: M Marker, IA, α GP and 4GT are purified by heat treatment, LBP passes through Ni-NTA column purification.

Fig. 3 is to analyze laminaribiose using HPLC；Wherein, Fig. 3 A is to distinguish laminaribiose, cellobiose, Portugal with HPLC Grape sugar, inorganic phosphate；It is laminaribiose that Fig. 3 B, which is using the qualitative determining product of TLC,；Fig. 3 C is to utilize HPLC quantitative analysis thallus laminariae The concentration of disaccharides can quantitatively obtain the concentration of laminaribiose by the intensity at laminaribiose peak.

Fig. 4 is that external multienzyme catalytic starch and glucose synthesize laminaribiose situation under primary condition, wherein Fig. 4 A is The reaction process of external multienzyme catalysis grape sugar and starch or the processed Starch synthesis laminaribiose of IA is bent under primary condition Line；Fig. 4 B is the efficient liquid phase chromatographic analysis knot that external multienzyme is catalyzed glucose and Starch synthesis laminaribiose under primary condition Fruit.

Fig. 5 is reaction condition optimization process；Wherein, Fig. 5 A is concentration of glucose optimization process；Fig. 5 B is potassium phosphate concentration Optimization process；Fig. 5 C is α GP additive amount optimization process；Fig. 5 D is LBP additive amount optimization process.

Fig. 6 is under optimum reaction condition, and external multienzyme catalytic starch and glucose synthesis laminaribiose reaction process are bent Line.

Specific embodiment

The invention will now be further described with reference to specific embodiments, and the advantages and features of the present invention will be with describing And it is apparent.It should be understood that described, examples are merely exemplary, does not constitute any restrictions to the scope of the present invention.This Field technical staff should be understood that without departing from the spirit and scope of the invention can be to technical solution of the present invention Details and form are modified or are replaced, but these modifications or substitutions each fall within protection scope of the present invention.

Following material is used in the embodiment of the present invention

Soluble starch, ACROS Products, product number: 424490020；

PET20b carrier, Novagen, Madison, WI；

Bacillus coli expression bacterium BL21 (DE3), Invitrogen, Carlsbad, CA；

All enzymes (removing glucanotransferase) in the present invention can be commercially available in Sigma company, and all enzymes also all may be used To be obtained according to gene engineering method by prokaryotic expression.

Starch and glucose are converted laminaribiose by the catalysis of the external multienzyme of embodiment 1

The catalytic route that starch and glucose are converted into laminaribiose is shown in into Fig. 1 by external multienzyme catalyst system.Wherein The key enzyme being related to includes: (1) starch phosphorylase (α GP, EC 2.4.1.1), for releasing glucose -1- from starch Phosphoric acid；(2) laminaribiose phosphorylase (LBP, EC 2.4.1.31) is generated for being catalyzed Cori ester and glucose Laminaribiose.

In the present embodiment, starch phosphorylase derives from Thermotoga maritima (Thermotoga maritima), base Because the number on KEGG is TM1168；Laminaribiose phosphorylase derives from series bacillus (Paenibacillus Sp.), number of the gene on KEGG is BAJ10826, these genomic DNAs all can be from the official website of ATCC (www.atcc.org) it is obtained on.The two genes pass through PCR from corresponding genomic DNA with F1/R1 and F2/R2 respectively It obtains, wherein F1:GTTTAACTTTAAGA AGGAGATATAGTGCTGGAGAAACTTCCCGAG, R1:GTGGTGGTGGTGGT GCTCGAGTCAGAGAACCTTCTTCCAGAC, F2:GTTTAACTTTAAGAAGGA GATATACCATGGGTCAGAAAGGCTGGAAATTTC, R2:CAGTGGTGGTGG TGGTGGTGCTCGAGACTAATATTACGGCCCAGGGTCAC, and by Simple Cloning (You C, Zhang XZ, Zhang Y-HP.2012.Simple cloning via direct transformation of PCR product(DNA Multimer)to Escherichia coli and Bacillus subtilis.Appl.Environ.Microbiol.78 (5): 1593-5. method) is cloned into pET20b carrier (Novagen, Madison, WI), obtains corresponding expression vector PET20b-Tm α GP and pET20b-PsLBP.Then, the two plasmids are converted respectively to Bacillus coli expression bacterium BL21 (DE3) in (Invitrogen, Carlsbad, CA), protein expression and purifying, the result of protein purification such as Fig. 2 are carried out It is shown.

In the reaction system of a 1.0mL contain 61.3mM glucose, the HEPES buffer solution (pH 7.0) of 100mM, The divalent magnesium ion of 5mM, the potassium phosphate (pH 7.0) of 10mM, 1U starch phosphorylase, 1U laminaribiose phosphorylase, 10mg Soluble starch carries out catalysis reaction at 50 DEG C, and the reaction time is 36 hours.

The concentration of high performance liquid chromatography detection laminaribiose.94.5 μ L of response sample is taken, the sulfuric acid of 5.5 μ L 10% is added Terminate reaction.Centrifuging and taking supernatant goes out peak area using HPLC detection laminaribiose and peak height calculates the concentration of laminaribiose.Cause Laminaribiose phosphorylase is possible to catalysis glucose and Cori ester generates cellobiose, so first to being used Laminaribiose phosphorylase specificity identified.As shown in Figure 3A, laminaribiose retention time is for standard sample detection It is 7.7-7.8 minutes, not be overlapped with glucose, phosphoric acid appearance time but close with cellobiose appearance time, for determination Product only has laminaribiose, and without cellobiose, qualitative detection is carried out using thin-layer chromatography chromatography, as a result as shown in Figure 3B, mark Product cellobiose and laminaribiose speckle displacement are not overlapped, and can carry out qualitative detection, and appearance and Portugal in reaction solution sample The corresponding spot of grape sugar mark product, spot corresponding with Cori ester mark product, and spot corresponding with laminaribiose mark product Point, but there is not spot corresponding with cellobiose mark product, it follows that glucose and glucose -1- phosphoric acid are through the thallus laminariae The catalysis of two saccharophosphorylases has no cellobiose generation, therefore, it is quantitative that laminaribiose can be carried out with high performance liquid chromatography.Elder brother Cloth disaccharides concentration is directly proportional to the response intensity of HPLC inositol characteristic peak, and standard curve is as shown in Figure 3 C.

Liquid phase result is as shown in Figure 4 B, and laminaribiose response intensity gradually increases, and glucose responding intensity is gradually reduced. It is calculated through slope of standard curve, the final concentration (Fig. 4 A) of laminaribiose is 23mM, relative starch (10g/L, about 61.3mM grape Sugared equivalent) conversion ratio be 37.5%.

Embodiment 2 promotes amylolytic enzyme by addition, improves the yield of laminaribiose

Starch phosphorylase is unable to complete hydrolysis starch, and amylolytic different shallow lake can be helped in the reaction system by increasing Powder enzyme (IA, EC 3.2.1.68) can be improved the yield of laminaribiose.

In the present embodiment, isoamylase derives from sulfolobus solfataricus (Sulfolobus tokodaii), and gene exists Number on KEGG is ST0928, and the genomic DNA of the bacterial strain is commercially available from German Culture Collection Center DSMZ.This A gene is obtained from corresponding genomic DNA by PCR with primers F 3/F4, wherein F3: GTTTAACTTTAAGAAGGAGATATAATGGTTTTTTCACACAAGGATAGA CC, R: GTGGTGGTGGTGGTGGTGCTCGAGCTAATATTCAATCCTCCTATAT ACC, and pass through the method for Simple Cloning It is cloned into pET20b carrier, obtains corresponding expression vector pET20b-StIA.Then, this plasmid is converted to large intestine bar Bacterium is expressed in bacterium BL21 (DE3), and protein expression and purifying are carried out, and the result of protein purification is as shown in Figure 2.

The preparation of starch phosphorylase, laminaribiose phosphorylase is the same as embodiment 1.

Contain 5mM sodium acetate buffer (pH 5.5) in the reaction system of a 1.0mL, 0.5mM divalent magnesium ion, 1U isoamylase, 10mg starch carry out catalysis reaction at 85 DEG C, and the reaction time is 12 hours.

Then contain 61.3mM glucose, 100mM HEPES buffer solution (pH in the reaction system of a 1.0mL 7.0), the divalent magnesium ion of 5mM, the potassium phosphate (pH 7.0) of 10mM, 1U starch phosphorylase, 1U laminaribiose phosphorylase, The processed starch of 10mg IA carries out catalysis reaction at 50 DEG C, and the reaction time is 36 hours.

Through detecting, after reaction, the final concentration (Fig. 4 A) of laminaribiose is 33mM, to starch (10g/L, about 61.3mM Glucose equivalent) conversion ratio be 53.8%, compared to the starch handled without IA, conversion ratio improves.

Embodiment 3 further increases the yield of laminaribiose by optimization reaction condition

The preparation of isoamylase, starch phosphorylase, laminaribiose phosphorylase is the same as embodiment 1 and embodiment 2.

Contain 5mM sodium acetate buffer (pH 5.5) in the reaction system of a 1.0mL, 0.5mM divalent magnesium ion, 1U isoamylase, 10mg starch carry out catalysis reaction at 85 DEG C, and the reaction time is 12 hours.

Then contain 100mM HEPES buffer solution (pH 7.0) in the reaction system of a 1.0mL, the divalent magnesium of 5mM Ion, the potassium phosphate (pH 7.0) of 10mM, 1U starch phosphorylase, 1U laminaribiose phosphorylase, 10mg IA are processed The glucose (60-150mM) of starch and various concentration carries out catalysis reaction at 50 DEG C, and the reaction time is 24 hours.Thallus laminariae The detection of disaccharides is the same as embodiment 1.As a result such as Fig. 5 A, as concentration of glucose increases, the output increased of laminaribiose, but grape After sugared concentration is greater than 100mM, effect is not increased significantly to the yield of laminaribiose, it is thus determined that glucose additive amount is 100mM。

Then contain 100mM glucose, 100mM HEPES buffer solution (pH in the reaction system of a 1.0mL 7.0), the divalent magnesium ion of 5mM, 1U starch phosphorylase, 1U laminaribiose phosphorylase, the processed starch of 10mg IA, With the potassium phosphate (pH 7.0) (0-100mM) of various concentration, catalysis reaction is carried out at 50 DEG C, the reaction time is 24 hours.Elder brother The detection of cloth disaccharides is the same as embodiment 1.As a result such as Fig. 5 B, as potassium phosphate concentration increases, the output increased of laminaribiose, but phosphorus After sour potassium concn is greater than 20mM, the yield of laminaribiose starts slowly to decline, it is thus determined that potassium phosphate additive amount is 20mM.

Then contain 100mM glucose, 100mM HEPES buffer solution (pH in the reaction system of a 1.0mL 7.0), the divalent magnesium ion of 5mM, the potassium phosphate (pH 7.0) of 20mM, 1U laminaribiose phosphorylase, 10mg IA are processed Starch, 0-5U starch phosphorylase carry out catalysis reaction at 50 DEG C, and the reaction time is 24 hours.The detection of laminaribiose is same Embodiment 1.As a result such as Fig. 5 C, as starch phosphorylase dosage increases, the output increased of laminaribiose determines starch phosphate Change enzyme additive amount is 2U.

Then contain 100mM glucose, 100mM HEPES buffer solution (pH in the reaction system of a 1.0mL 7.0), the divalent magnesium ion of 5mM, the potassium phosphate (pH 7.0) of 20mM, 2U starch phosphorylase, the processed shallow lake 10mg IA Powder, 0-5U laminaribiose phosphorylase carry out catalysis reaction at 50 DEG C, and the reaction time is 24 hours.The detection of laminaribiose With embodiment 1.As a result such as Fig. 5 D, as laminaribiose phosphorylase dosage increases, the output increased of laminaribiose determines elder brother Two saccharophosphorylase additive amount of cloth is 2U.

Then contain 100mM glucose, 100mM HEPES buffer solution (pH in the reaction system of a 1.0mL 7.0), the divalent magnesium ion of 5mM, the potassium phosphate (pH 7.0) of 20mM, 2U starch phosphorylase, 2U laminaribiose phosphorylase, The processed starch of 10mg IA carries out catalysis reaction at 50 DEG C, and the reaction time is 36 hours.

Through detecting, after reaction, the final concentration (Fig. 6) of laminaribiose is 46mM, to starch (10g/L, about 61.3mM Glucose equivalent) conversion ratio is 75%, primary condition is compared, conversion ratio is significantly improved.

Embodiment 4 promotes the short extended enzyme of chain Fructus Hordei Germinatus oligose sugar chain by addition, improves the yield of laminaribiose

Under the double action of starch phosphorylase and isoamylase, the final product of soluble starch hydrolysis is malt three Sugar and maltose, glucanotransferase (4GT, EC 2.4.1.25) is added in the reaction system can be further by these products It is converted into laminaribiose, to improve yield.

In the present embodiment, glucanotransferase derives from Thermococcus litoralis, and gene is on KEGG Number be OCC_10078, the genomic DNA of the bacterial strain can be obtained from the official website (www.atcc.org) of ATCC.This A gene is obtained from corresponding genomic DNA by PCR with primers F 4/R4, wherein F4: TGTTTAACTTTAAGAAGGAGATATAATGGAAAGAAT AAACTTCATATTTG, R4: CAGTGGTGGTGGTGGTGGTGCTCGAGTCAAAG CTCCCTGAACCTTACCGTG, and pass through the side of Simple Cloning Method is cloned into pET20b carrier, obtains corresponding expression vector pET20b-Tl4GT.Then, this plasmid is converted to big Enterobacteria is expressed in bacterium BL21 (DE3), and protein expression and purifying are carried out.

The preparation of isoamylase is the same as embodiment 2；Starch phosphorylase, laminaribiose phosphorylase prepare same embodiment 1；Reaction condition is the same as embodiment 3.

Contain 5mM sodium acetate buffer (pH 5.5) in the reaction system of a 1.0mL, 0.5mM divalent magnesium ion, 1U isoamylase, 10mg starch carry out catalysis reaction at 85 DEG C, and the reaction time is 12 hours.

Then the HEPES buffer solution in the reaction system of a 1.0mL containing 100mM (pH 7.0), the divalent of 5 mM Magnesium ion, the potassium phosphate (pH 7.0) of 20mM, 100mM glucose, 2U starch phosphorylase, 2U laminaribiose phosphorylase, The processed starch of 10mg IA carries out catalysis reaction at 50 DEG C, and the reaction time is 12 hours, adds 1U glucan later and turns Enzyme is moved, the reaction was continued 24 hours.

Through detecting, after reaction, the final concentration (Fig. 6) of laminaribiose is 52.7mM, to starch (10g/L, about 61.3mM glucose equivalent) conversion ratio is 86%, after 4GT is acted on, laminaribiose is further from having to the conversion ratio of starch It improves.

More than, embodiments of the present invention are illustrated.But the present invention is not limited to above embodiment.It is all Within the spirit and principles in the present invention, any modification, equivalent substitution, improvement and etc. done should be included in guarantor of the invention Within the scope of shield.

Claims (10)

1. a kind of method for preparing laminaribiose using enzymic catalytic reaction, which is characterized in that contain starch, grape in reaction system Sugar, starch phosphorylase and laminaribiose phosphorylase.

Preferably, the concentration of starch is 1-200g/L, further preferably 5-50g/L, more preferably 8-20g/ in reaction system L, most preferably 10g/L.

Preferably, the concentration of glucose is 1-1000mM, further preferably 10-400mM, more preferably 50- in reaction system 200mM, most preferably 100mM.

Preferably, in reaction system starch phosphorylase dosage be 0.1-50U/mL, further preferably 0.5-10U/mL, more Preferably 1-5U/mL, most preferably 2U/mL.

Preferably, the dosage of laminaribiose phosphorylase is 0.1-50U/mL, further preferably 0.5-10U/ in reaction system ML, more preferably 1-5U/mL, most preferably 2U/mL.

Preferably, the temperature of enzymic catalytic reaction is 10-95 DEG C, and further preferably 20-80 DEG C, more preferably 30-60 DEG C are optimal It is selected as 50 DEG C.

Preferably, the time of enzymic catalytic reaction is 0.5-150 hours, and further preferably 1-60 hours, more preferably 6-48 was small When, most preferably 24-36 hours.

2. the method according to claim 1, wherein starch be soluble starch, it is soluble Amylose, solvable Property amylopectin, amylodextrin, maltodextrin, malt polysaccharide and maltose in the arbitrary proportion of any one or more it is mixed Close object.

3. method according to claim 1 or 2, which is characterized in that also contain buffer, phosphate, magnesium in reaction system Salt.

Preferably, buffer is HEPES buffer solution, Tris-HCl buffer, MOPS buffer, citrate buffer such as lemon Lemon acid sodium buffer etc., most preferably HEPES buffer solution.

Preferably, the pH of buffer is 5.0-8.0, more preferably 6.0-7.5, most preferably 7.0.

Preferably, the concentration of buffer is 10-500mM, further preferably 20-150mM, more preferably 50- in reaction system 120mM, most preferably 100mM.

Preferably, phosphate is potassium phosphate, sodium phosphate etc., most preferably potassium phosphate.

Preferably, in reaction system phosphatic concentration be 1-50mM, further preferably 2-30mM, more preferably 5-25mM, Most preferably 20mM.

Preferably, magnesium salts is magnesium chloride, magnesium sulfate etc., most preferably magnesium chloride.

Preferably, in reaction system magnesium salts concentration be 1-20mM, further preferably 2-15mM, more preferably 3-10mM, most Preferably 5mM.

4. method according to any one of claim 1-3, which is characterized in that glucan transfer is added in reaction system Enzyme.

Preferably, in reaction system glucanotransferase dosage be 0.1-10U/mL, further preferably 0.2-5U/mL, more Preferably 0.5-2U/mL, most preferably 1U/mL.

5. according to the method described in claim 4, it is characterized in that, starch phosphorylase and thallus laminariae are first added in the reaction system Two saccharophosphorylases add glucanotransferase after reacting a period of time.

Preferably, starch phosphorylase and laminaribiose phosphorylase are first added in the reaction system, is reacted at 10-95 DEG C 0.25-75 hours, further preferably 20-80 DEG C reaction 0.5-36 hours, more preferably 30-60 DEG C reaction 6-30 hours, most It is preferred that 50 DEG C reaction 12-24 hours.

Preferably, in the reaction system afterwards be added glucanotransferase after, continue 10-95 DEG C reaction 0.25-75 hours, into one Step preferably 20-80 DEG C reaction 0.5-36 hours, more preferably 30-60 DEG C reaction 6-30 hours, most preferably in 50 DEG C of reaction 12- 24 hours.

6. method according to any one of claims 1-5, which is characterized in that when containing α -1 in starch, when 6 glycosidic bond, Isoamylase is added in the reaction system.

Preferably, in reaction system isoamylase dosage be 0.1-10U/mL, further preferably 0.2-5U/mL, more preferably For 0.5-2U/mL, most preferably 1U/mL.

7. according to the method described in claim 6, reacting one section it is characterized in that, isoamylase is first added in the reaction system Starch phosphorylase and laminaribiose phosphorylase are added after time；Alternatively, isoamylase is first added in the reaction system, instead Starch phosphorylase, laminaribiose phosphorylase and glucanotransferase are added after answering a period of time；Or in reaction system It is middle that isoamylase is first added, when starch phosphorylase, laminaribiose phosphorylase is added after reacting a period of time, then reacting one section Between after add glucanotransferase.

Preferably, isoamylase is first added in the reaction system, 10-99 DEG C reaction 0.5-72 hours, further preferably in 30- 95 DEG C reaction 1-48 hours, more preferably 50-90 DEG C reaction 6-24 hours, most preferably 85 DEG C react 12 hours.

Preferably, starch phosphorylase and laminaribiose phosphorylase, or rear addition starch phosphorus is added afterwards in the reaction system After phosphorylase, laminaribiose phosphorylase and glucanotransferase, continue 10-95 DEG C reaction 0.5-150 hours, it is further excellent Be selected in 20-80 DEG C of reaction 1-60 hours, more preferably 30-60 DEG C reaction 6-48 hours, it is most preferably small in 50 DEG C of reaction 24-36 When.

Preferably, starch phosphorylase, laminaribiose phosphorylase is added afterwards in the reaction system, in 10-95 DEG C of reaction 0.25- 75 hours, further preferably 20-80 DEG C reaction 0.5-36 hours, more preferably 30-60 DEG C reaction 6-30 hours, most preferably exist 50 DEG C reaction 12-24 hours, add glucanotransferase, 10-95 DEG C reaction 0.25-75 hours, further preferably in 20- 80 DEG C reaction 0.5-36 hours, more preferably 30-60 DEG C reaction 6-30 hours, most preferably 50 DEG C reaction 12-24 hours.

8. method according to any one of claims 1-5, which is characterized in that when containing α -1 in starch, when 6 glycosidic bond, α -1,6 glycosidic bond wherein contained is first catalytically decomposed with isoamylase.

Preferably, the concentration of starch is 1-200g/L, further preferably 5-50g/L, more preferably 8-20g/ in reaction system L, most preferably 10g/L.

Preferably, in reaction system isoamylase dosage be 0.1-10U/mL, further preferably 0.2-5U/mL, more preferably For 0.5-2U/mL, most preferably 1U/mL.

Preferably, 10-99 DEG C reaction 0.5-72 hours, further preferably 30-95 DEG C reaction 1-48 hours, more preferably exist 50-90 DEG C reaction 6-24 hours, most preferably 85 DEG C react 12 hours.

9. according to the method described in claim 8, it is characterized in that, also containing buffer, magnesium salts in reaction system.

Preferably, buffer is sodium acetate buffer, HEPES buffer solution, citrate buffer such as sodium citrate buffer solution Deng most preferably sodium acetate buffer.

Preferably, the pH of buffer is 4.0-8.0, more preferably 4.5-6.5, most preferably 5.5.

Preferably, in reaction system buffer concentration be 1-50mM, further preferably 2-20mM, more preferably 3-10mM, Most preferably 5mM.

Preferably, magnesium salts is magnesium chloride, magnesium sulfate etc., most preferably magnesium chloride.

Preferably, the concentration of magnesium salts is 0.01-10mM, further preferably 0.1-5mM, more preferably 0.2- in reaction system 1mM, most preferably 0.5mM.

10. method according to claim 1 to 9, which is characterized in that starch phosphorylase is dwelt heat from sea Robe bacterium, Clostridium thermocellum, thermus thermophilus or its amino acid sequence and the starch phosphorylase in above-mentioned source have at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% identity；Preferably, starch phosphorylase comes It is excellent derived from Thermotoga maritima or its amino acid sequence with the starch phosphorylase from Thermotoga maritima at least 70% Choosing at least 80%, more preferably at least 90%, most preferably at least 95% identity.

Preferably, laminaribiose phosphorylase derives from series bacillus, euglena gracilis, acholeplasma or its amino acid sequence Laminaribiose phosphorylase with above-mentioned source is at least 70%, preferably at least 80%, more preferably at least 90%, most preferably extremely Few 95% identity；Most preferably, laminaribiose phosphorylase is from series bacillus or its amino acid sequence and source In series bacillus laminaribiose phosphorylase have at least 70%, preferably at least 80%, more preferably at least 90%, most preferably At least 95% identity.

Isoamylase of the isoamylase from sulfolobus solfataricus, arabidopsis, Flavobacterium or its amino acid sequence and above-mentioned source has Have at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% identity；Most preferably, different starch Enzyme source has at least 70% in sulfolobus solfataricus or its amino acid sequence and the isoamylase from sulfolobus solfataricus, preferably extremely Few 80%, more preferably at least 90%, most preferably at least 95% identity.

Glucanotransferase from thermophilic high temperature coccus, bacillus subtilis, clostridium butyricum or its amino acid sequence with it is above-mentioned The glucanotransferase in source have at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% it is same One property；Most preferably, glucanotransferase from thermophilic high temperature coccus or its amino acid sequence and derives from thermophilic high temperature ball The glucanotransferase of bacterium have at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% it is same Property.