CN113005104A - Laminaribiose phosphorylase mutant with improved thermal stability and application thereof - Google Patents

Abstract

The invention discloses a laminaribiose phosphorylase mutant with improved thermal stability and application thereof in high-temperature synthesis of laminaribiose, belonging to the technical field of enzyme engineering. The laminaribiose phosphorylase mutant with obviously improved thermal stability disclosed by the invention is obtained by establishing a gene mutation library by using a site-directed saturation mutation and random mutation method and then screening the gene mutation library on the basis of laminaribiose phosphorylase derived from pseudomonas Paenibacillus sp.YM1. The obtained laminaribiose phosphorylase mutant is used for constructing an in vitro multienzyme system, and laminaribiose is prepared by using starch as a substrate at high temperature. Compared with a wild type, the mutant has obviously improved thermal stability, can ensure that the enzyme activity of the mutant is not lost in the high-temperature link of the process production, can replace the wild type of the laminaribiose phosphorylase to be applied to synthesizing laminaribiose at high temperature, can improve the reaction rate of the whole in-vitro multienzyme system, shortens the reaction time, and further improves the industrial potential of the laminaribiose.

Description

Laminaribiose phosphorylase mutant with improved thermal stability and application thereof

Technical Field

The invention belongs to the technical field of enzyme engineering, and particularly relates to a laminaribiose phosphorylase mutant and application thereof in high-temperature synthesis of laminaribiose.

Background

Laminaribiose (laminaribiose) is a reducing disaccharide with beta-1, 3 glycosidic bonds and is a high-value oligosaccharide with various functions. It can be used as a synthetic precursor of hyaluronic acid in pharmaceutical and cosmetic industries, as a germination promoter and a natural preservative in the agricultural field, as a food additive in the food and health product industry, and can also be used for regulating and controlling protein expression of thermophilic bacteria such as clostridium thermocellum. Laminaribiose is traditionally prepared by acid or enzymatic hydrolysis of beta-1, 3 glycans, such as laminarin, pachyman, lichenin and curdlan, but these natural glycans are limited in raw material supply, difficult to control the hydrolysis process, complex product separation steps, and high laminaribiose production costs. With the development of industrial enzyme biotechnology, there have been scientists who have attempted enzymatic synthesis of laminaribiose. Domestic scholars try to produce laminaribiose by using 3 enzymes (starch phosphorylase, glucosidase and laminaribiose phosphorylase) and taking starch as a substrate, and the laminaribiose can reach about 80% conversion rate after reacting for 12 hours at 50 ℃, however, the application of the laminaribiose phosphorylase at the temperature higher than 50 ℃ is limited due to poor thermal stability of the laminaribiose phosphorylase.

Laminaribiose phosphorylase (LBP, EC 2.4.1.31) is a phosphorylase belonging to the glycoside hydrolase 94 family and reversibly catalyzes the production of glucose 1-phosphate and glucose from laminaribiose. Laminaribiose phosphorylase was first found in the body of Roman snails (HelixPatia), but pure enzyme was not isolated. Subsequently, 4 different sources of laminaribiose phosphorylase were identified in succession, originating from Euglenaga (Euglenagracilis), Cytophaga variabilis (Astasia oceltata), Cholesterol-free pathogen (Acholeplastia laidlaii) and Pseudomonas (Paenibacillus sp.) respectively. Wherein the laminaribiose phosphorylase derived from Euglena microphylla, Cytospora variabilis and Cholesterol-free protomer is mesophilic enzyme, and the optimum temperature is 30-40 deg.C; the optimal temperature of the laminaribiose phosphorylase from pseudomonas is 55 ℃, but the heat stability is poor, the pure enzyme solution is processed at 60 ℃, the half-life period is only about 10min, and the laminaribiose phosphorylase is not suitable for the industrialized mass production of laminaribiose in an in vitro biosynthesis system.

In order to promote the laminaribiose phosphorylase to be applied to the industrialization of laminaribiose, a laminaribiose phosphorylase mutant with improved thermal stability is urgently needed, the enzyme activity of the laminaribiose phosphorylase mutant in the high-temperature link of the process production can be ensured not to be lost, and the high specific enzyme activity of the laminaribiose phosphorylase mutant can be kept.

Disclosure of Invention

The invention aims to provide laminaribiose phosphorylase with improved thermal stability, and the laminaribiose phosphorylase is applied to an in-vitro multienzyme system for producing laminaribiose by catalyzing starch as a substrate, so as to achieve the aim of synthesizing laminaribiose with high temperature, high conversion rate and high efficiency.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

step 1: analyzing the crystal structure of laminaribiose phosphorylase derived from Pseudomonas sp using computational software to determine the mutation site;

step 2: respectively carrying out saturated mutation library construction screening on the mutation sites in the step 1;

and step 3: performing expression purification on the positive clone obtained after primary screening in the step 2, and determining thermal stability;

and 4, step 4: taking the most prominent site with improved thermal stability obtained by re-screening in the step 3 as an initial sequence, and carrying out iterative saturation mutation on other sites;

and 5: performing random mutation library-building screening on the mutant sequence finally screened in the step 4, and further improving the thermal stability of the laminaribiose phosphorylase;

step 6: the mutants finally selected in step 5 were used in a system for preparing laminaribiose by multienzyme catalysis using starch as a substrate, and reacted at 60 ℃ for 8 hours, comparing the production of wild type laminaribiose with that of the mutants.

In order to develop laminaribiose phosphorylase (abbreviated as LBP in the text) with high thermal stability, the invention takes laminaribiose phosphorylase (Genebank: BAJ10826, namely SEQ ID NO:1) from pseudomonas Paenibacillus sp.YM1 as a base, establishes an LBP gene mutation library by a method of site-specific saturation mutation and error-prone PCR, and obtains an LBP mutant with obviously improved thermal stability by screening the gene mutation library.

The invention provides an enzyme mutant, wherein the amino acid sequence of the enzyme is SEQ ID NO.2, and the mutant is a mutant in which the 11 th E of the SEQ ID NO.1 is replaced by I and the 12 th Q is replaced by V.

The invention provides an enzyme mutant, wherein the amino acid sequence of the enzyme is SEQ ID NO.3, and D at the 171 st position of SEQ ID NO.2 is replaced by N.

The invention provides an enzyme mutant, wherein the amino acid sequence of the enzyme is SEQ ID NO.4, and the 877 th C of the SEQ ID NO.3 is replaced by F.

The invention provides an enzyme mutant, wherein the amino acid sequence of the enzyme is SEQ ID NO.5, and D at the 452 th site of SEQ ID NO.4 is replaced by G.

The invention provides an enzyme mutant, wherein the amino acid sequence of the enzyme is SEQ ID NO.6, and the 26 th L of the SEQ ID NO.5 is replaced by Q.

The invention provides an enzyme mutant, wherein the amino acid sequence of the enzyme is SEQ ID NO.7, and I at 186 th position of SEQ ID NO.6 is replaced by T.

Compared with the prior art, the technical scheme of the invention has the following beneficial effects:

compared with wild type LBP, the LBP enzyme mutant obtained by the invention has the advantages that the half-life period of the mutant at 60 ℃ is improved to 9.76h from 10min, the maximum half-life period is improved by 58.6 times, and the specific enzyme activity is equivalent to that of the wild type; the half-life period of the mutant at 65 ℃ is improved from 2min to 3.11h, and is improved by 93.3 times at most.

Drawings

FIG. 1 shows the results of LBP semi-rational design of mutations, half-life assay at 60 ℃.

FIG. 2 shows the results of random LBP mutation, half-life assay at 65 ℃.

FIG. 3 is a LBP mutation site collation analysis.

FIG. 4 is a schematic of an in vitro multi-enzyme catalytic pathway for starch conversion to laminaribiose; wherein: IA is isoamylase, alpha GP is starch phosphorylase, alpha G is glucosidase and LBP is laminaribiose phosphorylase.

FIG. 5 shows the high temperature synthesis of laminaribiose from starch treated with 10g/L IA by in vitro multi-enzyme catalysis.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. It is to be understood that the described embodiments are exemplary only and are not limiting upon the scope of the invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.

The following materials were used in the examples of the present invention

Soluble starch, product of ACROS company, product number: 424490020, respectively;

pET28a vector, Novagen, Madison, WI;

coli expression strain BL21(DE3), Invitrogen, Carlsbad, CA;

all enzymes of the present invention can be purchased from Sigma, and all enzymes can be obtained by prokaryotic expression according to genetic engineering methods.

The method for measuring laminaribiose comprises the following steps:

high Performance Liquid Chromatography (HPLC) detection: RID detector, HPX-87H column (Bio-Rad Hercules, Calif.), mobile phase: 5mM H2SO4, flow rate of 0.6mL/min, column temperature of 55 ℃, injection volume of 20 uL.

Medium (g/L): tryptone 10, yeast powder 5 and NaCl 10.

The screening method comprises the following steps: screening was performed by plate colony overlay two-plate color development by carefully pouring 8mL of 0.5% (w/v) melted agarose solution (60 ℃) containing 50mM HEPES buffer (pH 7.0),2mM laminaribiose, 2mM phosphate ion, 4mM magnesium ion, 0.5mM NAD +, 50. mu.M tetranitroblue tetrazolium (TNBT), 10. mu.M Phenazine Methosulfate (PMS),1U/mL Phosphoglucomutase (PGM), 1U/mL glucose 6-phosphate dehydrogenase (G6PDH) onto the heat-treated plate colonies. After 30 minutes at room temperature, a blue-black halo appeared in the positive colonies.

Example 1 rational analysis, determination of mutation sites

The Pseudomonas LBP is a homodimer with the catalytic pocket located in the binding region on both monomers and its crystal structure is published (PDB:6gh 2). The optimal temperature of the pure enzyme is 55 ℃, and the half-life period at 60 ℃ is 10min, the crystal structure of PDB derived from pseudomonas LBP is calculated and analyzed by B-FITTER and ETSS software respectively, and E11, Q12, D171 and C877 are possible sites for improving the thermal stability.

The site-directed saturation mutagenesis was performed by using the plasmid pET20b-LBP expressing the gene of wild type LBP as a template by the rapid PCR technique.

Primers introducing mutations of E11 and Q12:

a forward primer: GGTNNKNNKGGTGAATTTCGTCTGGAACAGCCGGAAC

Reverse primer: CTGAAATTTCCAGCCTTTCTGACCCATGGTATATC

Primer introducing D171 mutation:

a forward primer: GTCGTAGTGCCNNKGATCTGCGTGATCATC

Reverse primer: CATACAGCGGAATTGCGGCGGTAGG

Primer for introducing the C877 mutation:

a forward primer: GCCAGAGCGTGGATNNKCAGAATGATGGC

Reverse primer: CATTCAGACTAACGCTATCAACACGATACTGGCC

Primer phosphorylation system: NEB T4 PNK buffer 2. mu.L, ATP (100mM) 1. mu.L, NEB T4 PNK 1. mu.L, primers (100. mu.M) 2. mu.L, and double distilled water 14. mu.L was added.

The PCR reaction systems are as follows: mu.L of buffer, 4. mu.L of dNTPs (2.5 mM each), 1. mu.L of phosphorylated forward primer (10. mu.M), 1. mu.L of phosphorylated reverse primer (10. mu.M), 1. mu.L of template DNA, 0.5. mu.L of NEB high-fidelity Q5 DNApolymerase (2.5U/. mu.L), and 32.5. mu.L of double distilled water were added.

The PCR amplification conditions are as follows: pre-denaturation at 98 ℃ for 2 min; then 30 cycles of 98 ℃ for 10s, 55 ℃ for 15s and 72 ℃ for 2min, and finally 5min of 72 ℃ heat preservation.

Digesting the PCR product for 0.5h by Dpn I, purifying by a TIAN Quick Midipurification kit (Tiangen, Beijing, China), connecting linear plasmids into rings by a NEB Quick Ligation kit, respectively transferring into competent cells of Escherichia coli E.coli TOP10, coating the competent cells into LB solid culture medium containing agar for culturing overnight, carrying out heat treatment on the plates for 1h at 60 ℃, covering the developed double-layer plates, picking positive clones, extracting plasmids, transferring into competent cells of Escherichia coli E.coli BL21(DE3), carrying out expression and purification of enzyme, and determining the thermal stability of the enzyme.

Through screening, the mutant E11I Q12V (namely the mutant M1) is obtained, the thermal stability of the mutant is improved most obviously compared with that of the wild type, and the half life of the LBP pure enzyme at 60 ℃ is improved from 10min to 1.56h (figure 2).

By using a rapid PCR technology, the plasmid pET20b-lbpm1 expressing the gene of the mutant LBP-M1 is used as a template to carry out saturation mutation on D177 and C877 sites, and the mutant M2(E11I Q12VD171N) obtained by screening continuously improves the half-life period of the LBP pure enzyme at 60 ℃ to 2.59h (figure 2).

By using a rapid PCR technology, a plasmid pET20b-lbpm2 expressing a gene of a mutant LBP-M2 is used as a template to carry out saturation mutation of a C877 site, and the mutant M3(E11I Q12V D171N C877F) is obtained through screening, so that the half-life of the LBP pure enzyme at 60 ℃ is continuously improved to 3.46h (figure 2).

Example 2 random mutagenesis to further improve thermostability

Through calculation analysis and iterative saturation mutation, the thermal stability of the LBP derived from the pseudomonas at 60 ℃ is obviously improved, and random mutation is adopted for library construction and screening so as to obtain a mutant with better thermal stability.

Random mutagenesis was performed using error-prone PCR with plasmid pET20b-lbpm3 expressing the gene of mutant LBP-M3 as template.

The library building method comprises the following steps:

the lbp gene fragment is amplified by adopting error-prone PCR technology and using pET20b-lbpm3 as a template, and a primer IF: CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGTCAGAAAGGCTGGAAATTTCAGGGTGAACAGGGTG, IR: ACTAATATTACGGCCCAGGGTCACAATC are provided.

Primer phosphorylation system: NEB T4 PNK buffer 2. mu.L, ATP (100mM) 1. mu.L, NEB T4 PNK 1. mu.L, IF (100. mu.M) 2. mu.L, and double distilled water 14. mu.L was added.

PCR reaction (50. mu.L): 1 ng/. mu.L template, 0.2mM dATP, 0.2mM dGTP, 1mM dCTP, 1mM dTTP, 5mM MgCl2, 0.4. mu.M primers (phosphorylated IF and IR), 0.05U/LNEB Taqpolymerase.

The error-prone PCR amplification conditions are all as follows: pre-denaturation at 94 ℃ for 4 min; followed by 18 cycles at 94 ℃ for 30s, 56 ℃ for 30s, and 68 ℃ for 2min, and finally by a final incubation at 72 ℃ for 5 min.

The plasmid skeleton is amplified by adopting a rapid PCR technology and taking pET20b as a template, and the primer VF: CTCGAGCACCACCACCACCACCACTGAGATCC, VR: CACCCTGTTCACCCTGAAATTTCCAGCCTTTCTGACCCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAG are provided.

Primer phosphorylation system: NEB T4 PNK buffer 2. mu.L, ATP (100mM) 1. mu.L, NEB T4 PNK 1. mu.L, VR (100. mu.M) 2. mu.L, and double distilled water 14. mu.L was added.

The PCR reaction system is as follows: mu.L of buffer, 4. mu.L of dNTPs (2.5 mM each), 1. mu.L of VF (10. mu.M), 1. mu.L of phosphorylated VR (10. mu.M), 1. mu.L of template DNA, 0.5. mu.L of NEB high-fidelity Q5 DNApolymerase (2.5U/. mu.L), and 32.5. mu.L of double distilled water were added.

The PCR amplification conditions are as follows: pre-denaturation at 98 ℃ for 2 min; then 30 cycles of 98 ℃ for 10s, 55 ℃ for 15s and 72 ℃ for 2min, and finally 5min of 72 ℃ heat preservation.

The PCR reaction systems are as follows: mu.L of buffer, 4. mu.L of dNTPs (2.5 mM each), 1. mu.L of phosphorylated forward primer (10. mu.M), 1. mu.L of phosphorylated reverse primer (10. mu.M), 1. mu.L of template DNA, 0.5. mu.L of NEB high-fidelity Q5 DNApolymerase (2.5U/. mu.L), and 32.5. mu.L of double distilled water were added.

The PCR amplification conditions are as follows: pre-denaturation at 98 ℃ for 2 min; then 30 cycles of 98 ℃ for 10s, 55 ℃ for 15s and 72 ℃ for 2min, and finally 5min of 72 ℃ heat preservation.

The PCR products of the fragment and plasmid backbone were digested with Dpn I for 0.5h, purified with a TIAN quick Midi purification kit (Tiangen, Beijing, China), and subjected to overlap extension PCR (OE-PCR).

The PCR reaction systems are as follows: 10 μ L of buffer, 4 μ L of dNTPs (2.5 mM each), 1 μ L of phosphorylated primer IF/VR (10 μ M), 2ng/μ L of fragment, 4ng/μ L of vector backbone (equimolar to the fragment), 0.5 μ L of NEB high-fidelity Q5 DNApolymerase (2.5U/μ L), and 50 μ L of double distilled water.

The PCR amplification conditions are as follows: pre-denaturation at 98 ℃ for 2 min; then 30 cycles of 98 ℃ for 10s, 60 ℃ for 15s and 72 ℃ for 4min, and finally the temperature is maintained at 72 ℃ for 10 min.

The NEB Quick Ligation kit connects linear plasmids into a ring, transfers the circular ring into competent cells of Escherichia coli E.coli TOP10, spreads the competent cells into LB solid culture medium containing agar to culture overnight, carries out heat treatment on the plate at 70 ℃ for 1h, covers the chromogenic double-layer plate, picks up positive clones, extracts plasmids, transfers the plasmids into competent cells of Escherichia coli E.coli BL21(DE3), carries out expression and purification of enzyme, and determines the thermal stability of the enzyme.

Screening of the mutants at 65 ℃ resulted in the D452G mutant (i.e., mutant M4) which showed the most significant improvement in thermostability relative to mutant LBP-M3, increasing the half-life of the pure LBP enzyme from 2min to 15min at 65 ℃ (FIG. 3), and from 3.46h to 5.13h at 60 ℃ (FIG. 2).

By using an error-prone PCR technology and taking a plasmid pET20b-lbpm4 expressing a gene of the mutant LBP-M4 as a template, library construction and screening are carried out continuously to obtain a mutant M5(E11I Q12V D171N C877F D452G L26Q), the half-life of the LBP pure enzyme at 65 ℃ is continuously improved to 1.21h (figure 3), and the half-life at 60 ℃ is improved to 7.70h from 5.13h (figure 2).

By using an error-prone PCR technology and taking a plasmid pET20b-lbpm5 expressing a gene of the mutant LBP-M5 as a template, library construction and screening are carried out continuously to obtain a mutant M6(E11I Q12V D171N C877F D452G L26Q I186T), the half-life of the LBP pure enzyme at 65 ℃ is continuously improved to 3.11h (figure 3), and the half-life at 60 ℃ is improved to 9.76h from 7.7h (figure 2).

EXAMPLE 3 formation of laminaribiose when the reaction temperature was increased to 60 deg.C

The catalytic pathway for the conversion of starch to laminaribiose by an in vitro multienzyme catalytic system is shown in FIG. 4. The key enzyme and key steps involved in the method comprise: (1) starch phosphorylase (α GP, EC 2.4.1.1) for the release of glucose-1-phosphate from starch; (2) a glucosidase (α G, EC 3.2.1.20) for releasing glucose from starch; (3) laminaribiose phosphorylase (LBP, EC 2.4.1.31) mutant M6, for catalyzing the production of laminaribiose from glucose-1-phosphate and glucose. Isoamylase can assist in hydrolyzing starch, i.e. isoamylase (IA, EC 3.2.1.68) capable of assisting in starch hydrolysis can be added in the reaction system to improve the yield of laminaribiose.

In this example, the starch phosphorylase is derived from Thermotoga maritima (Thermotoga maritima), and the number of the gene on KEGG is TM 1168; the glucosidase is derived from Paecilomyces lilacinus (Paecilomyces lilacinus), and the number of the gene on KEGG is QAQ 81244; isoamylase is derived from Sulfolobus (Sulfolobus tokodaii) and its gene is numbered ST0928 on KEGG. These genomic DNAs are all available from the ATCC's official website (www.atcc.org). These three genes were obtained by PCR from the corresponding genomic DNA using F1/R1, F2/R2 and F3/R3, respectively, wherein F1: GTTTAACTTTAAGAAGGAGATATAGTGCTGGAGAAACTTCCCGAG, R1: GTGGTGGTGGTGGTGCTCGAGTCAGAGAACCTTCTTCCAGAC, F2: CATCATCATCATCATCACAGCAGCGGCTTGAAAAAAACATGGTGGAAAGAAG, R2: GTGGTGGTGGTGGTGGTGCTCGAGTTCTTTCCAGATGTATACGCGCGCC, F3: GTTTAACTTTAAGAAGGAGATATACCATGGGTCAGAAAGGCTGGAAATTTC, R3: CAGTGGTGGTGGTGGTGGTGCTCGAGACTAATATTACGGCCCAGGGTCAC, and cloned into pET20b vector (Novagen, Madison, Wis.) by the method of Simple Cloning (You C, Zhang XZ, Zhang Y-HP.2012.Simple Cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. environ. Microbiol.78(5):1593-5.) to obtain the corresponding expression vectors pET20b-Tm α GP, pET20b-Pl α G and pET20 b-StIA. The laminaribiose phosphorylase is derived from Pseudomonas sp (Paenibacillus sp.YM1), and the mutant M6 of example 2 was used, with the sequence of SEQ ID NO.7 and the expression vector pET20b-lbpm 6. Then, these four plasmids were transformed into escherichia coli expression bacteria BL21(DE3) (Invitrogen, Carlsbad, CA), and protein expression and purification were performed, and the results of protein purification are shown in fig. 2.

The reaction system contained 5mM sodium acetate buffer (pH 5.5), 0.5mM divalent zinc ion, 5U/mL isoamylase, and 200g/L starch, and the reaction was catalyzed at 85 ℃ for 3 hours.

Then, the reaction system contained 100mM HEPES buffer (pH 6.5), 5mM divalent zinc ion, 20mM potassium phosphate (pH 6.5), 3U/mL starch phosphorylase, 1U/mL glucosidase, 2U/mL laminaribiose phosphorylase, and 10 g/LIA-treated starch, and catalyzed at 60 ℃ for 8 hours.

Detecting the concentration of laminaribiose by high performance liquid chromatography. 94.5. mu.L of the reaction sample was taken, and 5.5. mu.L of 10% sulfuric acid was added to terminate the reaction. Centrifuging to obtain supernatant, and detecting the area and height of laminaribiose peak by HPLC to calculate laminaribiose concentration.

It was determined that after the reaction, the final concentration of laminaribiose catalyzed by LBP mutant M6 (FIG. 5) was 22.4mM, the conversion to starch (10g/L, about 55.5mM glucose equivalents, 1 molecule of laminaribiose synthesized 2 molecules glucose equivalents) was 80.7%, while the final concentration of laminaribiose catalyzed by LBP wild type was only 5.4mM, and the conversion to starch was 19.4%.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> a laminaribiose phosphorylase mutant having improved thermostability and use thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 911

<212> PRT

<213> Paenibacillus sp.YM1

<400> 1

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Glu Gln Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asp Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Asp Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Cys Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 2

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 2

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asp Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Asp Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Cys Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 3

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 3

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Asp Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Cys Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 4

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 4

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Asp Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Phe Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 5

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 5

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Gly Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Phe Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 6

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 6

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Gln Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Gly Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Phe Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 7

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 7

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Gln Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Thr Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Gly Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Phe Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

Claims (10)

1. A laminaribiose phosphorylase (LBP) mutant characterized in that the laminaribiose phosphorylase having improved thermostability is obtained by subjecting the laminaribiose phosphorylase having the amino acid sequence shown in SEQ ID NO.1 to iterative saturation mutation and/or random mutation. The amino acid sequence of the mutant is shown as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7. The amino acid sequence of the mutant comprises one or more of mutation sites E11I, Q12V, D171N, C877F, D452G, L26Q and I186T or any combination of the mutation sites.

2. A gene encoding the laminaribiose phosphorylase mutant according to claim 1.

3. A vector or cell carrying the gene of claim 2.

4. A method for obtaining the laminaribiose phosphorylase mutant of claim 1, characterized in that pET20b-LBP containing coding gene of wild type or mutant LBP is used as template, the gene shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 is subjected to site-directed saturation mutagenesis, the gene shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 is subjected to random mutagenesis, the vector carrying the coding mutant gene is transferred into Escherichia coli BL21(DE3), and recombinant bacteria are cultured to obtain the laminaribiose phosphorylase mutant.

5. The laminaribiose phosphorylase according to claims 1-4 originally derived from Pseudomonas sp (YM1).

6. The laminaribiose phosphorylase of claims 1-5 having a half-life of LBP pure enzyme increased from 10min to 9.76h at 60 ℃ and from 2min to 3.11h at 65 ℃ by multiple rounds of site-directed saturation mutagenesis and random mutagenesis.

7. A method for preparing laminaribiose by catalyzing starch at high temperature is characterized in that escherichia coli BL21(DE3) is used as a host, and starch phosphorylase from Thermotoga maritima (Thermotoga maritima) is respectively recombined and expressed; purifying glucosidase from Paecilomyces lilacinus and isoamylase from Sulfolobus tokodaii to obtain recombinase, constructing an exomultienzyme system, and catalyzing starch at high temperature to prepare laminaribiose.

8. The in vitro multiple enzyme system of claim 7 further comprising divalent zinc ions, potassium phosphate, and sodium acetate and HEPES buffers.

9. The enzyme component of the in vitro multi-enzyme system according to claims 7-8 can be any source of enzyme resources with the same function.

10. Use of the laminaribiose phosphorylase mutants according to claims 1-6 in a process for the preparation of laminaribiose from starch by means of in vitro multienzyme catalysis. The method is characterized in that the in vitro multienzyme system takes the high-temperature-resistant laminaribiose phosphorylase mutant as a catalyst, combines other high-temperature-resistant enzymes, and catalyzes starch to produce laminaribiose at high temperature.

Images