CN113005104B - Thallus laminariae disaccharide phosphorylase mutant with improved heat stability and application thereof - Google Patents

Abstract

The invention discloses a laminarin phosphorylase mutant with improved thermal stability and application thereof in high-temperature synthesis of laminarin, belonging to the technical field of enzyme engineering. The laminaria disaccharide phosphorylase mutant with obviously improved thermal stability disclosed by the invention is obtained by establishing a gene mutation library by a site-directed saturation mutation and random mutation method based on laminaria disaccharide phosphorylase from pseudomonas sp.YM1 and screening the gene mutation library. And then the obtained laminarin phosphorylase mutant is used for constructing an in-vitro multienzyme system, and laminarin is prepared by taking starch as a substrate at high temperature. Compared with the wild type, the mutant has obviously improved thermal stability, can ensure that the enzyme activity is not lost in the process production high temperature link, replaces the wild type of laminaria disaccharide phosphorylase to be applied to synthesizing laminaria disaccharide at high temperature, can improve the reaction rate of the whole in-vitro multienzyme system, shortens the reaction time, and further improves the industrialization potential of laminaria disaccharide.

Description

Thallus laminariae disaccharide phosphorylase mutant with improved heat stability and application thereof

Technical Field

The invention belongs to the technical field of enzyme engineering, and particularly relates to a laminarin phosphorylase mutant and application thereof in high-temperature synthesis of laminarin.

Background

Laminarin (laminarin) is a reducing disaccharide linked by beta-1, 3 glycosidic bonds, and is a high-valence oligosaccharide with various functions. The hyaluronic acid can be used as a synthetic precursor of hyaluronic acid in pharmaceutical and cosmetic industries, used as a germination promoter and a natural preservative in the agricultural field, used as a food additive in the food health care product industry, and also used for regulating and controlling protein expression of thermophilic bacteria such as clostridium thermocellum. The traditional preparation method of laminarin disaccharide is acidolysis or enzymolysis of beta-1, 3-polysaccharide, such as laminarin, pachyman, lichenan and curdlan, but the natural polysaccharide raw materials are limited in supply, the hydrolysis process is difficult to control, the product separation step is complicated, and the production cost of laminarin disaccharide is high. With the development of industrial enzyme biotechnology, scientists have begun to attempt enzymatic synthesis of laminariae disaccharide. The domestic scholars tried to produce laminariae disaccharide using 3 enzymes (starch phosphorylase, glucosidase and laminaria disaccharide phosphorylase) with starch as substrate, and the conversion rate of about 80% could be reached by reacting for 12 hours at 50 ℃, however the poor thermal stability of laminaria disaccharide phosphorylase limited its application at temperatures above 50 ℃.

Laminarin phosphorylase (laminaribiose phosphorylase, LBP, EC 2.4.1.31) is a phosphorylase belonging to the family of glycoside hydrolases 94, which can reversibly catalyze laminarin to glucose 1-phosphate and glucose. Laminarin phosphorylase was first found in the Roman snail (Helixpoint), but pure enzyme was not isolated. Subsequently, 4 different sources of laminarin phosphorylases were identified successively, derived from euglena (euglena), metamorphic algae (Astasia ocellata), cholesterolfree (Acholeplasma laidlawii) and pseudomonas (Paenibacillus sp.). Wherein the laminaria disaccharide phosphorylase from euglena, metamorphic algae and cholesterolfree pathogen is mesophilic enzyme, and the optimum temperature is 30-40 ℃; the optimum temperature of laminaria disaccharide phosphorylase from pseudomonas is 55 ℃, but the thermal stability is poor, the half-life of pure enzyme solution is only about 10min after being treated at 60 ℃, and the laminaria disaccharide phosphorylase is not suitable for the industrial mass production of laminaria disaccharide by an in vitro biosynthesis system.

In order to promote the industrial application of laminarin phosphorylase in laminarin, a laminarin phosphorylase mutant with improved thermal stability is needed, which can ensure that the enzyme activity is not lost in the high-temperature link of the process production and keep the high specific enzyme activity.

Disclosure of Invention

The technical problem to be solved by the invention is to provide laminaria disaccharide phosphorylase with improved thermal stability, and apply the laminaria disaccharide phosphorylase to an in-vitro multienzyme system for producing laminaria disaccharide by using starch as a substrate to catalyze, thereby achieving the purpose of synthesizing laminaria disaccharide with high temperature and high conversion rate and high efficiency.

In order to solve the technical problems, the invention adopts the following technical scheme:

step 1: analyzing the crystal structure of laminaria disaccharide phosphorylase from pseudomonas by using calculation software to determine mutation site;

step 2: respectively carrying out saturation mutation library construction screening on the mutation sites in the step 1;

step 3: performing expression purification on the positive clone obtained after the preliminary screening in the step 2, and measuring the thermal stability;

step 4: taking the most outstanding site with improved thermal stability obtained by re-screening in the step 3 as an initial sequence, and carrying out iterative saturation mutation on other sites;

step 5: carrying out random mutation library construction screening on the mutant sequence finally screened in the step 4, and further improving the thermal stability of laminaria disaccharide phosphorylase;

step 6: and (3) using the mutant finally screened in the step (5) as a system for preparing laminaria disaccharide by using starch as a substrate and catalyzing with multiple enzymes, reacting at 60 ℃ for 8 hours, and comparing the generation conditions of wild type laminaria disaccharide and mutant laminaria disaccharide.

In order to develop laminaria disaccharide phosphorylase (LBP for short herein) with high thermal stability, the invention is based on laminaria disaccharide phosphorylase (Genebank: BAJ10826, SEQ ID NO: 1) derived from pseudomonas sp.YM1, establishes an LBP gene mutation library by a site-directed saturation mutation and error-prone PCR method, and obtains LBP mutants with obviously improved thermal stability by screening the gene mutation library.

The invention provides an enzyme mutant, the amino acid sequence of the enzyme is SEQ ID NO.2, which is a mutant that the 11 th E of SEQ ID NO.1 is replaced by I and the 12 th Q is replaced by V.

The invention provides an enzyme mutant, the amino acid sequence of the enzyme is SEQ ID NO.3, and the amino acid sequence is replaced by N at 171 th position D of SEQ ID NO. 2.

The invention provides an enzyme mutant, the amino acid sequence of the enzyme is SEQ ID NO.4, and the amino acid sequence is F instead of C at 877 of SEQ ID NO. 3.

The invention provides an enzyme mutant, the amino acid sequence of the enzyme is SEQ ID NO.5, and the amino acid sequence is that D at 452 of SEQ ID NO.4 is replaced by G.

The invention provides an enzyme mutant, the amino acid sequence of the enzyme is SEQ ID NO.6, and the L at the 26 th position of SEQ ID NO.5 is replaced by Q.

The invention provides an enzyme mutant, the amino acid sequence of the enzyme is SEQ ID NO.7, and the I of the 186 th position of SEQ ID NO.6 is replaced by T.

Compared with the prior art, the technical scheme of the invention has the following beneficial effects:

compared with wild type LBP, the LBP enzyme mutant obtained by the invention has the half-life of the mutant at 60 ℃ increased from 10min to 9.76h, which is increased by 58.6 times at most, and the specific enzyme activity is equivalent to that of the wild type; the half-life of the mutant at 65 ℃ is improved from 2min to 3.11h, which is improved by 93.3 times at most.

Drawings

FIG. 1 shows the results of semi-rational design mutation of LBP, 60℃half-life assay.

FIG. 2 shows the result of random mutation of LBP, half-life at 65 ℃.

FIG. 3 shows the LBP mutation site alignment analysis.

FIG. 4 is a schematic representation of the in vitro multienzyme catalytic pathway for starch conversion to laminariae disaccharide; wherein: IA is isoamylase, αgp is starch phosphorylase, αg is glucosidase, and LBP is laminaria disaccharide phosphorylase.

FIG. 5 shows the high temperature synthesis of laminariae disaccharide from 10g/L IA treated starch catalyzed by multiple enzymes in vitro.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. It should be understood that the embodiments described are exemplary only and should not be construed as limiting the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions can be made in the details and form of the technical solution of the present invention without departing from the spirit and scope of the invention, but these changes and substitutions fall within the scope of the present invention.

The following materials were used in the examples of the present invention

Soluble starch, ACROS company product, product number: 424490020;

pET28a vector, novagen, madison, wis;

coli expressing strain BL21 (DE 3), invitrogen, carlsbad, calif.;

all enzymes of the invention are commercially available from Sigma, and all enzymes are also obtained by prokaryotic expression according to genetic engineering methods.

The method for measuring laminaria disaccharide comprises the following steps:

high Performance Liquid Chromatography (HPLC) detection method: RID detector, HPX-87H column (Bio-Rad Hercules, calif.), mobile phase: 5mM H2SO4, flow rate 0.6mL/min, column temperature 55℃and sample volume 20. Mu.L.

Culture medium (g/L): tryptone 10, yeast powder 5 and NaCl 10.

The screening method comprises the following steps: screening was performed by a plate colony cover two-plate chromogenic method, and 8mL of a 0.5% (w/v) thawed agarose solution (60 ℃) containing 50mM HEPESbuffer (pH 7.0), 2mM laminabiose, 2mM phosphate ion, 4mM magnesium ion, 0.5mM NAD+, 50. Mu.M tetranitroblue tetrazolium (TNBT), 10. Mu.M Phenazine Methosulfate (PMS), 1U/mL glucose mutase Phosphate (PGM), 1U/mL glucose 6-phosphate dehydrogenase (G6 PDH) was carefully poured onto the heat-treated plate colony. After 30 minutes at room temperature, positive colonies will appear as blue-black halos.

Example 1 rational analysis, determination of mutation sites

The LBP of Pseudomonas is a homodimer, the catalytic pocket is located in the binding region on both monomers and its crystal structure has been published (PDB: 6gh 2). The optimal temperature of the pure enzyme is 55 ℃, the half life period at 60 ℃ is 10min, the crystal structure of the PDB from pseudomonas LBP is calculated and analyzed by adopting B-FITER and ETSS software respectively, and E11, Q12, D171 and C877 are determined as possible sites for improving the thermal stability.

Site-directed saturation mutagenesis was performed using the rapid PCR technique, with plasmid pET20b-LBP expressing the wild-type LBP gene as template.

Primer for introducing E11 and Q12 mutations:

forward primer: GGTNNKNNKGGTGAATTTCGTCTGGAACAGCCGGAAC

Reverse primer: CTGAAATTTCCAGCCTTTCTGACCCATGGTATATC

Primer for introducing D171 mutation:

forward primer: GTCGTAGTGCCNNKGATCTGCGTGATCATC

Reverse primer: CATACAGCGGAATTGCGGCGGTAGG

Primer for introducing C877 mutation:

forward primer: GCCAGAGCGTGGATNNKCAGAATGATGGC

Reverse primer: CATTCAGACTAACGCTATCAACACGATACTGGCC

Primer phosphorylation system: NEB T4 PNK buffer 2. Mu.L, ATP (100 mM) 1. Mu.L, NEB T4 PNK 1. Mu.L, primer (100. Mu.M) 2. Mu.L, and double distilled water 14. Mu.L were added.

The PCR reaction system is as follows: 10. Mu.L of buffer, 4. Mu.L of dNTPs (2.5 mM each), 1. Mu.L of phosphorylated forward primer (10. Mu.M), 1. Mu.L of phosphorylated reverse primer (10. Mu.M), 1. Mu.L of template DNA, 0.5. Mu.L of NEB high-fidelity Q5 DNApolymerase (2.5U/. Mu.L), and 32.5. Mu.L of double distilled water were added.

The PCR amplification conditions are as follows: pre-denaturation at 98℃for 2min; then, 30 cycles were performed at 98℃for 10s,55℃for 15s, and 72℃for 2min, and finally, the temperature was kept at 72℃for 5min.

After the PCR product is digested for 0.5h by Dpn I, the PCR product is purified by TIAN quickMidipurification kit (Tiangen, beijin, china), the NEB Quick Ligation kit is used for connecting linear plasmids into a ring shape, the linear plasmids are respectively transferred into competent cells of E.coli TOP10, the competent cells are coated into LB solid medium containing agar for culturing overnight, the flat plate is subjected to heat treatment at 60 ℃ for 1h, a chromogenic two-layer flat plate is covered, positive clones are selected, plasmids are extracted, the competent cells are transferred into competent cells of E.coli BL21 (DE 3), enzyme expression and purification are carried out, and the thermal stability of the enzyme is measured.

Screening gave E11I Q V mutant (i.e.mutant M1), which had the most significant improvement in thermostability over the wild type, increasing the half-life of LBP pure enzyme at 60℃from 10min to 1.56h (FIG. 2).

The rapid PCR technique was used to carry out saturation mutation at D177 and C877 sites using plasmid pET20b-lbpm1 expressing the gene of mutant LBP-M1 as a template, and the obtained mutant M2 (E11I Q12VD 171N) was selected to increase the half-life of LBP pure enzyme at 60℃to 2.59h (FIG. 2).

The saturated mutation at the C877 site was performed using the plasmid pET20b-lbpm2 expressing the gene of the mutant LBP-M2 as a template by the rapid PCR technique, and the obtained mutant M3 (E11I Q12V D171N C877F) was selected to increase the half-life of the LBP pure enzyme to 3.46h at 60 ℃.

EXAMPLE 2 random mutagenesis further improves thermostability

Through computational analysis and iterative saturation mutation, the thermal stability of LBP from pseudomonas at 60 ℃ is obviously improved, and random mutation is adopted for library construction and screening so as to obtain mutants with better thermal stability.

Random mutation was performed using error-prone PCR technique with plasmid pET20b-lbpm3 expressing the gene of mutant LBP-M3 as template.

The method for building the library comprises the following steps:

the lbp gene fragment is amplified by adopting error-prone PCR technology and using pET20b-lbpm3 as a template, and the primer IF: CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGTCAGAAAGGCTGGAAATTTCAGGGTGAACAGGGTG, IR: ACTAATATTACGGCCCAGGGTCACAATC.

Primer phosphorylation system: NEB T4 PNK buffer 2. Mu.L, ATP (100 mM) 1. Mu.L, NEB T4 PNK 1. Mu.L, IF (100. Mu.M) 2. Mu.L, and double distilled water 14. Mu.L were added.

PCR reaction System (50. Mu.L): 1 ng/. Mu.L template, 0.2mM dATP,0.2mM dGTP,1mM dCTP,1mM dTTP,5mM MgCl2,0.4. Mu.M primer (phosphorylated IF and IR), 0.05U/LNEB Taqpolymerase.

The amplification conditions of the error-prone PCR reaction are as follows: pre-denaturation at 94℃for 4min; then, 18 cycles were performed at 94℃for 30s,56℃for 30s, and 68℃for 2min, and finally, the temperature was kept at 72℃for 5min.

The plasmid skeleton is amplified by adopting a rapid PCR technology and using pET20b as a template, and a primer VF: CTCGAGCACCACCACCACCACCACTGAGATCC, VR: CACCCTGTTCACCCTGAAATTTCCAGCCTTTCTGACCCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAG.

Primer phosphorylation system: NEB T4 PNK buffer 2. Mu.L, ATP (100 mM) 1. Mu.L, NEB T4 PNK 1. Mu.L, VR (100. Mu.M) 2. Mu.L, and double distilled water 14. Mu.L were added.

The PCR reaction system is as follows: 10. Mu.L of buffer, 4. Mu.L of dNTPs (2.5 mM each), 1. Mu.L of VF (10. Mu.M), 1. Mu.L of phosphorylated VR (10. Mu.M), 1. Mu.L of template DNA, 0.5. Mu.L of NEB high-fidelity Q5 DNApolymerase (2.5U/. Mu.L), and 32.5. Mu.L of double distilled water were added.

The PCR amplification conditions are as follows: pre-denaturation at 98℃for 2min; then, 30 cycles were performed at 98℃for 10s,55℃for 15s, and 72℃for 2min, and finally, the temperature was kept at 72℃for 5min.

The PCR reaction system is as follows: 10. Mu.L of buffer, 4. Mu.L of dNTPs (2.5 mM each), 1. Mu.L of phosphorylated forward primer (10. Mu.M), 1. Mu.L of phosphorylated reverse primer (10. Mu.M), 1. Mu.L of template DNA, 0.5. Mu.L of NEB high-fidelity Q5 DNApolymerase (2.5U/. Mu.L), and 32.5. Mu.L of double distilled water were added.

The PCR amplification conditions are as follows: pre-denaturation at 98℃for 2min; then, 30 cycles were performed at 98℃for 10s,55℃for 15s, and 72℃for 2min, and finally, the temperature was kept at 72℃for 5min.

The PCR products of the fragment and plasmid backbone were digested with DpnI for 0.5h, purified by TIAN quick Midi purification kit (Tiangen, beijin, china) and subjected to overlap extension PCR (OE-PCR).

The PCR reaction system is as follows: 10. Mu.L of buffer, 4. Mu.L of dNTPs (2.5 mM each), 1. Mu.L of phosphorylated primer IF/VR (10. Mu.M), 2 ng/. Mu.L of fragment, 4 ng/. Mu.L of carrier backbone (equimolar concentration to fragment), 0.5. Mu.L of NEB high-fidelity Q5 DNApolymerase (2.5U/. Mu.L) and 50. Mu.L of double distilled water were added.

The PCR amplification conditions are as follows: pre-denaturation at 98℃for 2min; then, 30 cycles were performed at 98℃for 10s,60℃for 15s, and 72℃for 4min, and finally, the temperature was kept at 72℃for 10min.

NEB Quick Ligation kit the linear plasmids are connected into a ring, transferred into competent cells of E.coli TOP10, spread on LB solid medium containing agar for culturing overnight, heat-treated at 70 ℃ for 1h, covered with chromogenic two-layer plates, picked up positive clones, extracted plasmids, transferred into competent cells of E.coli BL21 (DE 3) for enzyme expression purification, and the thermal stability of the enzyme is measured.

Screening of the mutants was performed at 65℃to give D452G mutants (i.e.mutant M4) with the most pronounced increase in thermal stability over mutant LBP-M3, increasing the half-life of LBP pure enzyme from 2min to 15min at 65℃ (FIG. 3) and from 3.46h to 5.13h at 60℃ (FIG. 2).

The error-prone PCR technique is used, plasmid pET20b-lbpm4 with the gene of mutant LBP-M4 expressed is used as a template, library establishment and screening are continued, and the obtained mutant M5 (E11I Q12V D171N C877F D452G L Q) is used for continuously improving the half-life of LBP pure enzyme to 1.21h at 65 ℃ and improving the half-life to 7.70h at 60 ℃ from 5.13h (figure 2).

The error-prone PCR technique was used to continue library screening using plasmid pET20b-lbpm5 expressing the gene of mutant LBP-M5 as a template, and the resulting mutant M6 (E11I Q12V D171N C877F D452G L Q I186T) continued to increase the half-life of LBP-purified enzyme to 3.11h at 65℃and to 9.76h at 60℃from 7.7h (FIG. 3).

EXAMPLE 3 production of laminarin when the reaction temperature was increased to 60 ℃

The catalytic pathway for the conversion of starch to laminariae disaccharide by the in vitro multienzyme catalytic system is shown in FIG. 4. The key enzymes and key steps involved therein include: (1) Starch phosphorylase (αgp, EC 2.4.1.1) for liberating glucose-1-phosphate from starch; (2) Glucosidase (αg, EC 3.2.1.20) for liberating glucose from starch; (3) A mutant laminariae disaccharide phosphorylase (LBP, EC 2.4.1.31) M6 for catalyzing the production of laminarin from glucose-1-phosphate and glucose. The isoamylase can assist in hydrolyzing starch, i.e. adding isoamylase (IA, EC 3.2.1.68) capable of helping starch hydrolysis to the reaction system can improve laminaria disaccharide yield.

In this example, the starch phosphorylase is derived from Thermotoga maritima (Thermotoga maritima), the gene of which is numbered TM1168 on the KEGG; the glucosidase is derived from paecilomyces lilacinus (Paecilomyces lilacinus), and the gene of the glucosidase is numbered QAQ81244 on KEGG; the isoamylase is derived from sulfolobus (Sulfolobus tokodaii) and its gene is numbered ST0928 on KEGG. These genomic DNAs are available from the official website of ATCC (www.atcc.org). These three genes were obtained by PCR from the corresponding genomic DNA using F1/R1, F2/R2 and F3/R3, respectively, wherein F1: GTTTAACTTTAAGAAGGAGATATAGTGCTGGAGAAACTTCCCGAG, R1: GTGGTGGTGGTGGTGCTCGAGTCAGAGAACCTTCTTCCAGAC, F2: CATCATCATCATCATCACAGCAGCGGCTTGAAAAAAACATGGTGGAAAGAAG, R2: GTGGTGGTGGTGGTGGTGCTCGAGTTCTTTCCAGATGTATACGCGCGCC, F3: GTTTAACTTTAAGAAGGAGATATACCATGGGTCAGAAAGGCTGGAAATTTC, R3: CAGTGGTGGTGGTGGTGGTGCTCGAGACTAATATTACGGCCCAGGGTCAC and cloned into pET20b vectors (Novagen, madison, wis.) by Simple Cloning (Young C, zhang XZ, zhangY-HP.2012.simple Cloning via direct transformation ofPCR product (DNA Multi) to Escherichia coli and Bacillus subli.Appl.environmental.Microbiol.78 (5): 1593-5.) to obtain the corresponding expression vectors pET20b-Tm αGP, pET20b-PlαG and pET20b-StIA. The laminaria disaccharide phosphorylase was derived from Pseudomonas (Paenibacillus sp.YM1) using the mutant M6 of example 2, SEQ ID NO.7 and pET20b-lbpm6 as expression vector. Then, these four plasmids were transformed into E.coli expression bacterium BL21 (DE 3) (Invitrogen, carlsbad, calif.), respectively, and protein expression and purification were performed, and the results of protein purification are shown in FIG. 2.

The reaction system contained 5mM sodium acetate buffer (pH 5.5), 0.5mM divalent zinc ion, 5U/mL isoamylase, 200g/L starch, and the reaction time was 3 hours at 85 ℃.

The reaction system then contained 100mM HEPES buffer (pH 6.5), 5mM divalent zinc ion, 20mM potassium phosphate (pH 6.5), 3U/mL starch phosphorylase, 1U/mL glucosidase, 2U/mL laminaria disaccharide phosphorylase, 10g/LIA treated starch, and the reaction was catalyzed at 60℃for 8 hours.

High performance liquid chromatography is used for detecting laminarin concentration. 94.5. Mu.L of the reaction sample was taken and the reaction was stopped by adding 5.5. Mu.L of 10% sulfuric acid. Centrifuging to obtain supernatant, and detecting peak area and peak height of laminariae disaccharide by HPLC to calculate laminarin concentration.

After completion of the reaction, the final concentration of laminariae disaccharide produced by LBP mutant M6 (FIG. 5) was 22.4mM, the conversion rate relative to starch (10 g/L, about 55.5mM glucose equivalent, 2 molecules glucose equivalent to 1 molecule laminariae disaccharide) was 80.7%, and the final concentration of laminaria disaccharide produced by LBP wild-type catalysis was only 5.4mM, the conversion rate relative to starch was 19.4%.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> institute of Tianjin Industrial biotechnology, national academy of sciences

<120> a laminarin phosphorylase mutant with improved thermostability and use thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 911

<212> PRT

<213> Paenibacillus sp.YM1

<400> 1

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Glu Gln Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asp Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Asp Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Cys Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 2

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 2

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asp Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Asp Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Cys Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 3

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 3

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Asp Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Cys Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 4

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 4

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Asp Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Phe Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 5

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 5

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Leu Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Gly Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Phe Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 6

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 6

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Gln Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Ile Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Gly Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Phe Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

<210> 7

<211> 911

<212> PRT

<213> Artificial sequence ()

<400> 7

Met Gly Gln Lys Gly Trp Lys Phe Gln Gly Ile Val Gly Glu Phe Arg

1 5 10 15

Leu Glu Gln Pro Glu His Asn Ser Tyr Gln Tyr Phe Pro Leu Val Asn

20 25 30

Glu Ala Gly Met Met Ser Ala Val Thr Pro Asn Leu His Gly Glu Ile

35 40 45

Thr Ser Gly His Asn Thr Phe Leu Met Glu Pro Val Ser Ala Glu Ser

50 55 60

Leu His Asn Ser Lys Ala Ser Arg Asn Phe Trp Val Phe Ile Glu Gly

65 70 75 80

Tyr Gly Ala Trp Ser Val Ser Gly Asn Ser Ala Arg Gln Asn Ala Ala

85 90 95

Arg Phe Thr Gly Glu Glu Glu Arg Ser Ala Val Glu Ala Gly Phe Leu

100 105 110

Trp His Ala Val Thr Arg Glu Asn Glu Lys Ala Gly Leu Lys Ala Arg

115 120 125

Thr Val Ser Phe Val Pro Val Thr Asp Asp Lys Ile Glu Leu Met Arg

130 135 140

Val Thr Leu Thr Asn Thr Gly Asn Ala Pro Leu Lys Leu Thr Pro Thr

145 150 155 160

Ala Ala Ile Pro Leu Tyr Gly Arg Ser Ala Asn Asp Leu Arg Asp His

165 170 175

Arg His Val Thr Ser Leu Leu His Arg Thr Phe Thr Ser Glu Tyr Gly

180 185 190

Ile Glu Val Gln Pro Ala Leu Ser Phe Asp Glu Arg Gly His Arg Val

195 200 205

Asn Lys Val Thr Tyr Gly Val Phe Gly Ala Glu Ala Gly Gly Thr Ala

210 215 220

Pro Ala Gly Phe Phe Pro Val Thr Glu Asp Phe Ile Gly Glu Gly Gly

225 230 235 240

Ala Leu Asp Trp Pro Glu Ala Val Val Ala Asn Arg Glu Pro Asp Ala

245 250 255

Gln Ala Gly Thr Ala Val Glu Gly Tyr Glu Ala Val Gly Ala Leu Arg

260 265 270

Phe Ala Pro Val Glu Leu Ala Pro Gly Lys Ser Val Ser Tyr Val Val

275 280 285

Ala Met Val Ile Ser Gly Asp Arg Ile Asp Val Gly Arg Tyr Ala Ala

290 295 300

Asp Tyr Leu Ala Ala Gly Arg Phe Asp Ala Leu Leu Glu Gln Asn Arg

305 310 315 320

Ala Tyr Trp Arg Asp Lys Leu Asp Thr Val Arg Phe Ser Ser Gly Asp

325 330 335

Gly Glu Gln Asp Leu Trp Met Lys Trp Val Thr Leu Gln Pro Ile Leu

340 345 350

Arg Arg Leu Tyr Gly Asn Ser Phe Leu Pro Tyr His Asp Tyr Gly Arg

355 360 365

Gly Gly Arg Gly Trp Arg Asp Leu Trp Gln Asp Cys Leu Ala Leu Met

370 375 380

Val Met Glu Pro Ala Glu Val Arg His Leu Leu Leu Asn Asn Tyr Ala

385 390 395 400

Gly Val Arg Met Asp Gly Ser Asn Ala Thr Ile Ile Gly Ala Gly Pro

405 410 415

Gly Glu Phe Val Ala Asp Arg Asn Asn Ile Pro Arg Val Trp Met Asp

420 425 430

His Gly Ala Trp Pro Leu Met Thr Thr Leu Leu Tyr Leu His Gln Ser

435 440 445

Gly Asp Leu Gly Leu Leu Phe Gln Pro Gln Ser Tyr Phe Arg Asp Val

450 455 460

Phe Val Lys Arg Cys Arg Glu Arg Asp Ala Ser Trp Thr Pro Glu Gln

465 470 475 480

Gly Asn Lys Leu Leu Thr Ala Asp Gly Gln Ile Tyr Glu Gly Thr Ile

485 490 495

Leu Glu His Ile Leu Leu Gln Asn Ile Val Pro Phe Phe Asn Val Gly

500 505 510

Glu His Gly Asn Ile Lys Leu Glu Gly Ala Asp Trp Asn Asp Gly Leu

515 520 525

Asp Leu Ala Pro Glu Arg Gly Glu Ser Val Ala Phe Thr Ala Phe Tyr

530 535 540

Ala Ser Asn Leu Met Glu Leu Ser Glu Leu Leu Leu Glu Leu Gln Lys

545 550 555 560

Arg Thr Gly Lys Asp Ser Leu Asp Ile Ala Glu Glu Met Ala Leu Leu

565 570 575

Leu Asp Thr Leu Gly Lys Pro Ile Ser Tyr Asp Ser Ile Gln Glu Lys

580 585 590

Arg Ser Leu Leu Asp Arg Tyr Tyr Asp Ala Val Thr Pro Arg Val Ser

595 600 605

Gly Lys Lys Leu Leu Leu Asp Ile Arg Lys Val Ala Glu Asp Leu Lys

610 615 620

Arg Lys Ala Asp Trp Ala Val Ala His Leu Arg Gly Ser Glu Trp Ile

625 630 635 640

Gln Ser Lys Glu Gly Tyr Ala Trp Phe Asn Gly Tyr Tyr Asn Asn Asp

645 650 655

Gly Glu Arg Val Glu Gly Asp His Pro Asp Gly Val Arg Met Thr Leu

660 665 670

Thr Gly Gln Val Phe Ala Ile Met Gly Gly Val Ala Thr Asp Glu Gln

675 680 685

Thr Glu Lys Ile Ser Gln Ala Val Asn Arg Tyr Leu Lys Asp Glu Arg

690 695 700

Ile Gly Tyr Arg Leu Asn Ser Arg Phe Gly Gly Ile Gln Gln Asn Leu

705 710 715 720

Gly Arg Ala Phe Gly Phe Ala Phe Gly His Lys Glu Asn Gly Ala Met

725 730 735

Phe Ser His Met Thr Val Met Tyr Ala Asn Ala Leu Tyr Lys Arg Gly

740 745 750

Phe Val Gln Glu Gly Phe Glu Val Leu Asp Ser Ile Tyr Arg Leu Ser

755 760 765

Ala Asp Phe Glu Asn Ser Arg Ile Tyr Pro Gly Val Pro Glu Tyr Ile

770 775 780

Asn Glu Arg Gly Arg Gly Met Tyr Thr Tyr Leu Thr Gly Ser Ala Ser

785 790 795 800

Trp Leu Leu Leu Thr Gln Leu Thr Glu Val Tyr Gly Val Lys Gly Arg

805 810 815

Phe Gly Asp Leu Arg Leu Glu Pro Lys Leu Val Gln Ala Gln Phe Asp

820 825 830

Gly Ser Gly Glu Ala Ala Val Glu Thr Leu Phe Ala Gly Arg Met Leu

835 840 845

Arg Val Val Tyr Arg Asn Pro Gln Ala Ala Glu His Gly Gln Tyr Arg

850 855 860

Val Asp Ser Val Ser Leu Asn Gly Gln Ser Val Asp Phe Gln Asn Asp

865 870 875 880

Gly Ala Gly Cys Leu Ile Gly Arg Ser Leu Ile Glu Ala Leu Pro Ala

885 890 895

Asp Gly Val His Glu Leu Ile Val Thr Leu Gly Arg Asn Ile Ser

900 905 910

Claims (6)

1. A laminaria disaccharide phosphorylase mutant is characterized in that laminaria disaccharide phosphorylase with an amino acid sequence shown as SEQ ID NO.1 is subjected to iterative saturation mutation and/or random mutation to obtain laminaria disaccharide phosphorylase mutant with improved thermal stability; the amino acid sequences of the mutants are shown as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7.

2. A gene encoding the laminarin phosphorylase mutant according to claim 1.

3. A vector or cell carrying the gene of claim 2, said cell being of a non-animal or plant variety.

4. A method for preparing laminarin by catalyzing starch at high temperature is characterized in that escherichia coli BL21 (DE 3) is taken as a host to respectively and recombinantly express starch phosphorylase from Thermotoga maritima; the enzyme preparation method comprises the steps of purifying and obtaining recombinant enzyme by using a glucosaccharase derived from paecilomyces lilacinus and an isoamylase derived from sulfolobus as well as the laminaria disaccharide phosphorylase mutant as claimed in claim 1, constructing an in-vitro multi-enzyme system, and catalyzing starch at high temperature to prepare laminaria disaccharide.

5. The in vitro multi-enzyme system of claim 4 further comprising divalent zinc ions, potassium phosphate, sodium acetate and HEPES buffer.

6. The method for preparing laminarin by using laminarin phosphorylase mutant in vitro multienzyme to catalyze starch is characterized in that the laminarin phosphorylase mutant in claim 1 is used as a catalyst in the in vitro multienzyme system, and other high temperature resistant enzymes are combined, so that the laminarin can be produced by catalyzing starch at high temperature.

Images