CN109706200B - Method for preparing laminaribiose - Google Patents

Abstract

The invention discloses a method for preparing laminaribiose by constructing an in-vitro multienzyme molecular machine and through multienzyme cascade catalysis, belonging to the field of enzymatic preparation of laminaribiose. The preparation method of the laminaribiose disclosed by the invention comprises the steps of converting glucose units in starch into glucose-1-phosphate by glucan phosphorylase, and synthesizing the laminaribiose by the laminaribiose phosphorylase through the glucose-1-phosphate and the glucose. The utilization rate of starch and the final concentration of laminaribiose can be further improved by adding other auxiliary enzymes such as isoamylase and glucanotransferase which promote complete phosphate-lysis of starch during the process. The method has the advantages of cheap and easily available substrate, low production cost, high product yield, simple separation and purification, and the like, and can realize the large-scale production of laminaribiose.

Description

Method for preparing laminaribiose

Technical Field

The invention belongs to the field of biological manufacturing, and particularly relates to a method for preparing laminaribiose by taking starch and glucose as raw materials through an in vitro enzyme method.

Background

Laminaribiose is an oligosaccharide linked by beta-1, 3 glycosidic bonds, is mainly used in the agricultural field and can be used as a natural preservative.

At present, laminaribiose is mainly produced by hydrolyzing polysaccharides such as pine needles or laminarin with traditional dilute acid. The process has low yield and high cost, and can result in high laminaribiose price. Laminaribiose can also be prepared by chemical synthesis, obtaining laminaribiose by O-glycosylation from the Koenigs-Knorr process, using halo sugar groups as glycosyl donors. However, the final product is not easy to purify, and the final yield is less than 10%.

With the development of industrial enzyme biotechnology, there have been scientists who have attempted enzymatic synthesis of laminaribiose. Japanese scientists have utilized 3 enzymes (sucrose phosphorylase, glucose isomerase and laminaribiose phosphorylase) to produce laminaribiose from sucrose as a substrate, however, laminaribiose yield is only about 50%, resulting in higher cost for subsequent product separation.

Therefore, it is highly desirable to develop a method for preparing laminarin with low cost, low pollution and high yield.

Disclosure of Invention

The invention aims to solve the technical problem of providing a method for preparing laminaribiose, which takes starch and glucose as substrates and produces the laminaribiose through catalysis of an in vitro multi-enzyme reaction system.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

the invention provides a method for preparing laminaribiose by using enzyme catalysis reaction, which is characterized in that a reaction system contains starch, glucose, starch phosphorylase (alpha-glucan phosphorylase, EC 2.4.1.1, alpha GP) and laminaribiose phosphorylase (EC 2.4.1.31, LBP). In the invention, starch and glucose are taken as substrates, the starch is converted into glucose-1-phosphate by the catalysis of starch phosphorylase, and the glucose-1-phosphate and the glucose are catalyzed by laminaribiose phosphorylase to generate laminaribiose.

Preferably, the starch is a mixture of any one or more of soluble starch, soluble amylose, soluble amylopectin, starch dextrin, maltodextrin, maltopolysaccharide and maltose in any proportion.

Preferably, the concentration of starch in the reaction system is 1 to 200g/L, more preferably 5 to 50g/L, still more preferably 8 to 20g/L, and most preferably 10 g/L.

Preferably, the concentration of glucose in the reaction system is 1 to 1000mM, more preferably 10 to 400mM, still more preferably 50 to 200mM, and most preferably 100 mM.

Preferably, the amount of the starch phosphorylase to be used in the reaction system is 0.1 to 50U/mL, more preferably 0.5 to 10U/mL, still more preferably 1 to 5U/mL, and most preferably 2U/mL.

Preferably, the amount of laminaribiose phosphorylase used in the reaction system is 0.1 to 50U/mL, more preferably 0.5 to 10U/mL, still more preferably 1 to 5U/mL, most preferably 2U/mL.

Preferably, the temperature of the enzyme-catalyzed reaction is 10-95 deg.C, more preferably 20-80 deg.C, more preferably 30-60 deg.C, and most preferably 50 deg.C.

Preferably, the time of the enzyme-catalyzed reaction is 0.5 to 150 hours, more preferably 1 to 60 hours, more preferably 6 to 48 hours, and most preferably 24 to 36 hours.

Preferably, the reaction system further comprises buffer, phosphate and magnesium salt.

It will be appreciated by those skilled in the art that various buffers can be used in the present invention, such as HEPES buffer, Tris-HCl buffer, MOPS buffer, citrate buffer such as sodium citrate buffer, etc., preferably, the buffer is HEPES buffer. Preferably, the pH of the buffer is 5.0-8.0, more preferably 6.0-7.5, and most preferably 7.0. Preferably, the concentration of the buffer in the reaction system is 10 to 500mM, more preferably 20 to 150mM, still more preferably 50 to 120mM, and most preferably 100 mM.

It will be appreciated by those skilled in the art that various phosphates may be used in the present invention, such as potassium phosphate, sodium phosphate, and the like, preferably the phosphate is potassium phosphate. Preferably, the concentration of phosphate in the reaction system is 1 to 50mM, more preferably 2 to 30mM, still more preferably 5 to 25mM, and most preferably 20 mM.

It will be appreciated by those skilled in the art that various magnesium salts may be used in the present invention, such as magnesium chloride, magnesium sulfate, and the like, preferably the magnesium salt is magnesium chloride. Preferably, the concentration of the magnesium salt in the reaction system is 1 to 20mM, more preferably 2 to 15mM, still more preferably 3 to 10mM, and most preferably 5 mM.

In a preferred embodiment, glucanotransferase (4- α -glucanotransferase, EC 2.4.1.25, 4GT) is added to the reaction system; more preferably, the starch phosphorylase and laminaribiose phosphorylase are added to the reaction system, and the glucanotransferase is added after the reaction is carried out for a certain period of time.

Preferably, the amount of glucanotransferase used in the reaction system is 0.1 to 10U/mL, more preferably 0.2 to 5U/mL, still more preferably 0.5 to 2U/mL, and most preferably 1U/mL.

Preferably, the starch phosphorylase and the laminaribiose phosphorylase are added into the reaction system to react for 0.25 to 75 hours at 10 to 95 ℃, further preferably for 0.5 to 36 hours at 20 to 80 ℃, more preferably for 6 to 30 hours at 30 to 60 ℃, and most preferably for 12 to 24 hours at 50 ℃; preferably, the reaction is continued at 10 to 95 ℃ for 0.25 to 75 hours, more preferably at 20 to 80 ℃ for 0.5 to 36 hours, even more preferably at 30 to 60 ℃ for 6 to 30 hours, and most preferably at 50 ℃ for 12 to 24 hours after adding glucanotransferase to the reaction system.

In a preferred embodiment, when the starch contains α -1,6 glycosidic linkages (e.g., soluble starch, soluble amylopectin, amylodextrin, maltodextrin, maltopolysaccharide), an isoamylase (EC 3.2.1.68, IA) is added to the reaction system; more preferably, isoamylase is added into the reaction system, and after a period of reaction, starch phosphorylase and laminaribiose phosphorylase are added; or adding isoamylase into the reaction system, reacting for a period of time, and then adding starch phosphorylase, laminaribiose phosphorylase and glucanotransferase; or adding isoamylase into the reaction system, reacting for a period of time, adding starch phosphorylase and laminaribiose phosphorylase, reacting for a period of time, and adding glucanotransferase.

Preferably, the amount of isoamylase used in the reaction system is 0.1 to 10U/mL, more preferably 0.2 to 5U/mL, still more preferably 0.5 to 2U/mL, and most preferably 1U/mL.

Preferably, isoamylase is added into the reaction system to react for 0.5 to 72 hours at the temperature of between 10 and 99 ℃, further preferably for 1 to 48 hours at the temperature of between 30 and 95 ℃, more preferably for 6 to 24 hours at the temperature of between 50 and 90 ℃, and most preferably for 12 hours at the temperature of 85 ℃; preferably, the reaction system is added with starch phosphorylase and laminaribiose phosphorylase, or added with starch phosphorylase, laminaribiose phosphorylase and glucanotransferase, and then the reaction is continued for 0.5-150 hours at 10-95 ℃, more preferably for 1-60 hours at 20-80 ℃, even more preferably for 6-48 hours at 30-60 ℃, and most preferably for 24-36 hours at 50 ℃; preferably, the starch phosphorylase and laminaribiose phosphorylase are added after the reaction system, and the reaction is carried out at 10-95 ℃ for 0.25-75 hours, more preferably at 20-80 ℃ for 0.5-36 hours, even more preferably at 30-60 ℃ for 6-30 hours, most preferably at 50 ℃ for 12-24 hours, and then the glucanotransferase is added, and the reaction is carried out at 10-95 ℃ for 0.25-75 hours, even more preferably at 20-80 ℃ for 0.5-36 hours, even more preferably at 30-60 ℃ for 6-30 hours, most preferably at 50 ℃ for 12-24 hours.

In a preferred embodiment, when the starch contains α -1,6 glucosidic linkages (e.g., soluble starch, soluble amylopectin, amylodextrin, maltodextrin, maltopolysaccharose), the α -1,6 glucosidic linkages contained therein are first catalytically broken down with isoamylase.

Preferably, when the alpha-1, 6 glycosidic bond contained in the starch is catalytically decomposed by isoamylase, the concentration of the starch in the reaction system is 1 to 200g/L, more preferably 5 to 50g/L, even more preferably 8 to 20g/L, and most preferably 10 g/L; the dosage of the isoamylase is 0.1-10U/mL, more preferably 0.2-5U/mL, more preferably 0.5-2U/mL, and most preferably 1U/mL; the reaction is carried out at 10 to 99 ℃ for 0.5 to 72 hours, more preferably at 30 to 95 ℃ for 1 to 48 hours, still more preferably at 50 to 90 ℃ for 6 to 24 hours, and most preferably at 85 ℃ for 12 hours.

Preferably, when the α -1, 6-glycosidic bond contained in starch is decomposed by isoamylase, the reaction system further contains a buffer and a magnesium salt.

It will be appreciated by those skilled in the art that various buffers can be used in the present invention, such as sodium acetate buffer, HEPES buffer, citrate buffer such as sodium citrate buffer, and the like, preferably, the buffer is sodium acetate buffer. Preferably, the pH of the buffer is from 4.0 to 8.0, more preferably from 4.5 to 6.5, most preferably 5.5. Preferably, the concentration of the buffer in the reaction system is 1 to 50mM, more preferably 2 to 20mM, still more preferably 3 to 10mM, and most preferably 5 mM.

It will be appreciated by those skilled in the art that various magnesium salts may be used in the present invention, such as magnesium chloride, magnesium sulfate, and the like, preferably the magnesium salt is magnesium chloride. Preferably, the concentration of the magnesium salt in the reaction system is 0.01 to 10mM, more preferably 0.1 to 5mM, still more preferably 0.2 to 1mM, and most preferably 0.5 mM.

In the present invention, starch phosphorylase, laminaribiose phosphorylase, isoamylase and glucanotransferase from various sources can be used. For example, the starch phosphorylase may be derived from Thermotoga maritima (Thermotoga maritima), Clostridium thermocellum (Clostridium thermocellum), Thermus thermophilus (Thermus thermophilus), etc., preferably, the starch phosphorylase is derived from Thermotoga maritima; the laminaribiose phosphorylase may be derived from Paenibacillus sp, Euglena Gracilis, Acholeplasma laevis, etc., preferably, the laminaribiose phosphorylase is derived from Paenibacillus sp; the isoamylase may be derived from Sulfolobus (Sulfolobus tokodaii), Arabidopsis thaliana (Arabidopsis thaliana), Flavobacterium sp, etc., preferably, the isoamylase is derived from Sulfolobus; the glucanotransferase may be derived from thermophilic coccus (Thermococcus litoralis), Bacillus subtilis (Bacillus subtilis), Clostridium butyricum (Clostridium butyricum), etc., and preferably, the glucanotransferase is derived from thermophilic coccus. The present invention can also use starch phosphorylase, laminaribiose phosphorylase, isoamylase and glucanotransferase having an amino acid sequence at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% identical to each of the enzymes derived as described above.

The invention takes starch and glucose as substrates, adds starch phosphorylase and laminaribiose phosphorylase to prepare a double-enzyme reaction system, and the enzyme catalysis path comprises: converting a glucose unit in the starch into glucose-1-phosphate by starch phosphorylase; converting glucose and glucose-1-phosphate to laminaribiose by laminaribiose phosphorylase.

Since starch is a mixture of amylose and amylopectin with different chain lengths. Amylose glucose units are linked by alpha-1, 4 glucosidic bonds, amylopectin is linked to the starch backbone by alpha-1, 6 glucosidic bonds, and starch phosphorylase does not break down the alpha-1, 6 glucosidic bonds. In order to improve the yield of glucose-1-phosphate, a debranching enzyme isoamylase capable of decomposing alpha-1, 6 glycosidic bonds in starch is added into a reaction system. In addition, because the final products of starch hydrolysis by starch phosphorylase are maltose and maltotriose, in order to convert glucose units in the starch into glucose 1-phosphate as much as possible, glucanotransferase is added, short-chain oligosaccharide can be polymerized into long-chain oligosaccharide, and the long-chain oligosaccharide can be reused by the glucanotransferase, thereby improving the utilization rate of the starch.

As the inorganic phosphorus is circulated in the reaction process, the reaction can be started by only adding a small amount of phosphate buffer solution and can be continuously carried out, so that the use of phosphate does not cause environmental pressure in the actual production.

Compared with the prior art, the technical scheme of the invention has the following beneficial effects:

in a multienzyme reaction system, starch and glucose are used as raw materials, the laminaribiose is converted by in vitro multienzyme catalysis, and enzyme capable of promoting starch hydrolysis and enzyme capable of converting residual short-chain malto-oligosaccharide into long-chain malto-oligosaccharide are added through process optimization, so that the conversion efficiency is obviously improved, the yield is high, and the separation cost of the laminaribiose is greatly reduced. The method has the advantages of simplicity, high utilization rate of raw materials, high yield of laminaribiose, low separation cost, environmental friendliness and the like, and can realize the large-scale production of the laminaribiose.

Drawings

FIG. 1 is a schematic representation of an in vitro multi-enzyme catalytic pathway for the conversion of starch and glucose to laminaribiose; wherein: IA is isoamylase, alpha GP is starch phosphorylase, 4GT is glucanotransferase and LBP is laminarin phosphorylase.

FIG. 2 shows SDS-PAGE detection of 4 key enzymes; wherein: m is Marker, IA, α GP and 4GT are purified by heat treatment and LBP is purified by Ni-NTA column.

FIG. 3 is an analysis of laminaribiose by HPLC; wherein FIG. 3A shows that HPLC is used to distinguish laminaribiose, cellobiose, glucose, inorganic phosphoric acid; FIG. 3B is a qualitative determination of laminaribiose as the product by TLC; FIG. 3C shows the quantitative analysis of laminaribiose concentration by HPLC, and the laminaribiose concentration can be determined quantitatively from the intensity of the laminaribiose peak.

FIG. 4 is a graph showing the synthesis of laminaribiose from starch and glucose under in vitro multi-enzyme catalysis under initial conditions, wherein FIG. 4A is a graph showing the reaction progress of the synthesis of laminaribiose from glucose and starch or IA-treated starch under in vitro multi-enzyme catalysis under initial conditions; FIG. 4B is the HPLC analysis result of synthesizing laminaribiose from glucose and starch under in vitro multi-enzyme catalysis under the initial conditions.

FIG. 5 is a process of reaction condition optimization; wherein, fig. 5A is a glucose concentration optimization process; FIG. 5B is a potassium phosphate concentration optimization process; FIG. 5C is a process of optimizing the amount of α GP added; fig. 5D shows LBP addition optimization.

FIG. 6 is a graph showing the reaction process of synthesizing laminaribiose from starch and glucose under optimal reaction conditions by multi-enzyme catalysis in vitro.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. It should be understood that the illustrated embodiments are exemplary only, and are not intended to limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.

The following materials were used in the examples of the present invention

Soluble starch, product of ACROS company, product number: 424490020, respectively;

pET20b vector, Novagen, Madison, WI;

coli expression strain BL21(DE3), Invitrogen, Carlsbad, CA;

all enzymes (except glucanotransferase) in the present invention were purchased from Sigma, and all enzymes were obtained by prokaryotic expression according to genetic engineering methods.

Example 1 in vitro Multi-enzyme catalysis of the conversion of starch and glucose to laminaribiose

The catalytic pathway for the conversion of starch and glucose to laminaribiose by an in vitro multienzyme catalytic system is shown in FIG. 1. The key enzymes involved include: (1) starch phosphorylase (α GP, EC 2.4.1.1) for the release of glucose-1-phosphate from starch; (2) laminaribiose phosphorylase (LBP, EC 2.4.1.31) for catalyzing the production of laminaribiose from glucose-1-phosphate and glucose.

In this example, the starch phosphorylase is derived from Thermotoga maritima (Thermotoga maritima), and the number of the gene on KEGG is TM 1168; the laminaribiose phosphorylase is derived from Paenibacillus sp (Paenibacillus sp.) with gene number BAJ10826 on KEGG, and these genomic DNAs are all available from the ATCC official website (www.atcc.org). These two genes were obtained by PCR from the corresponding genomic DNA using F1/R1 and F2/R2, respectively, wherein F1: GTTTAACTTTAAGA AGGAGATATAGTGCTGGAGAAACTTCCCGAG, R1: GTGGTGGTGGTGGT GCTCGAGTCAGAGAACCTTCTTCCAGAC, F2: GTTTAACTTTAAGAAGGA GATATACCATGGGTCAGAAAGGCTGGAAATTTC, R2: CAGTGGTGGTGG TGGTGGTGCTCGAGACTAATATTACGGCCCAGGGTCAC, and cloned into pET20b vector (Novagen, Madison, Wis.) by the method of Simple Cloning (You C, Zhang XZ, Zhang Y-HP.2012.Simple Cloning via direct transformation of PCR products (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. environ. Microbiol.78(5): 1593-5), to obtain corresponding expression vectors pET20b-Tm α GP and pET20 b-PsLBP. Then, these two plasmids were transformed into e.coli expression strain BL21(DE3) (Invitrogen, Carlsbad, CA) and protein expression and purification were performed, and the results of protein purification are shown in fig. 2.

A1.0 mL reaction system containing 61.3mM glucose, 100mM HEPES buffer (pH 7.0), 5mM divalent magnesium ions, 10mM potassium phosphate (pH 7.0), 1U starch phosphorylase, 1U laminaribiose phosphorylase, and 10mg soluble starch was subjected to a catalytic reaction at 50 ℃ for 36 hours.

Detecting the concentration of laminaribiose by high performance liquid chromatography. 94.5. mu.L of the reaction sample was taken, and 5.5. mu.L of 10% sulfuric acid was added to terminate the reaction. Centrifuging to obtain supernatant, and detecting the area and height of laminaribiose peak by HPLC to calculate laminaribiose concentration. Since laminaribiose phosphorylase has a possibility of catalyzing the production of cellobiose from glucose and glucose-1-phosphate, the specificity of laminaribiose phosphorylase used was first identified. As shown in FIG. 3A, the detection of the standard sample showed that laminaribiose had a retention time of 7.7 to 7.8 minutes, and did not overlap with neither glucose nor phosphate, but was close to cellobiose, and in order to determine that only laminaribiose, but not cellobiose, was produced, the qualitative detection was carried out by thin layer chromatography, and as a result, as shown in FIG. 3B, the positions of cellobiose and laminaribiose spots of the standards did not overlap, and the qualitative detection was possible, while spots corresponding to glucose standards, spots corresponding to glucose-1-phosphate standards, and spots corresponding to laminaribiose standards did not occur, and it was found that glucose and glucose-1-phosphate were catalyzed by the laminaribiose phosphorylase and had no cellobiose production, the laminaribiose can be quantified by HPLC. Laminaribiose concentration is proportional to the intensity of the response of the characteristic peak of HPLC inositol, and the standard curve is shown in FIG. 3C.

The liquid phase results are shown in FIG. 4B, where the response intensity of laminaribiose gradually increased and the response intensity of glucose gradually decreased. The final laminaribiose concentration (FIG. 4A) was 23mM, calculated from the slope of the standard curve, and the conversion to starch (10g/L, about 61.3mM dextrose equivalent) was 37.5%.

Example 2 increasing the yield of laminaribiose by adding an enzyme that promotes starch hydrolysis

The starch phosphorylase can not completely hydrolyze starch, and the addition of isoamylase (IA, EC 3.2.1.68) capable of assisting starch hydrolysis in the reaction system can improve the yield of laminaribiose.

In this example, isoamylase was derived from Sulfolobus (Sulfolobus tokodaii) and the gene thereof is numbered ST0928 on KEGG, and the genomic DNA of this strain was purchased from DSMZ, german collection of strains. This gene was obtained by PCR from the corresponding genomic DNA using primers F3/F4, wherein F3: GTTTAACTTTAAGAAGGAGATATAATGGTTTTTTCACACAAGGATAGA CC, R: GTGGTGGTGGTGGTGGTGCTCGAGCTAATATTCAATCCTCCTATAT ACC, and Cloning into pET20b vector by Simple Cloning method to obtain corresponding expression vector pET20 b-StIA. Then, this plasmid was transformed into E.coli expression strain BL21(DE3) and protein expression and purification were carried out, and the results of protein purification are shown in FIG. 2.

Preparation of starch phosphorylase and laminaribiose phosphorylase was the same as in example 1.

A1.0 mL reaction system containing 5mM sodium acetate buffer (pH 5.5), 0.5mM magnesium chloride, 1U isoamylase, 10mg starch was subjected to catalytic reaction at 85 ℃ for 12 hours.

Then, a 1.0mL reaction system containing 61.3mM glucose, 100mM HEPES buffer (pH 7.0), 5mM divalent magnesium ions, 10mM potassium phosphate (pH 7.0), 1U of starch phosphorylase, 1U of laminaribiose phosphorylase, and 10mg of IA-treated starch was subjected to a catalytic reaction at 50 ℃ for 36 hours.

It was determined that at the end of the reaction, the final laminaribiose concentration (FIG. 4A) was 33mM and the conversion to starch (10g/L, about 61.3mM dextrose equivalent) was 53.8%, with a certain increase in conversion over starch not treated with IA.

Example 3 further increase of laminaribiose yield by optimizing reaction conditions

Isoamylase, starch phosphorylase and laminaribiose phosphorylase were prepared as in examples 1 and 2.

A1.0 mL reaction system containing 5mM sodium acetate buffer (pH 5.5), 0.5mM magnesium chloride, 1U isoamylase, 10mg starch was subjected to catalytic reaction at 85 ℃ for 12 hours.

Then, a 1.0mL reaction system containing 100mM HEPES buffer (pH 7.0), 5mM divalent magnesium ions, 10mM potassium phosphate (pH 7.0), 1U starch phosphorylase, 1U laminaribiose phosphorylase, 10mg IA-treated starch, and glucose (60-150mM) at 50 ℃ was catalyzed for 24 hours. Detection of laminaribiose was the same as in example 1. As a result, as shown in FIG. 5A, the yield of laminaribiose increased with the increase of glucose concentration, but the yield of laminaribiose did not increase significantly with the glucose concentration of more than 100mM, and therefore the amount of glucose added was determined to be 100 mM.

Then, a 1.0mL reaction system containing 100mM glucose, 100mM HEPES buffer (pH 7.0), 5mM divalent magnesium ions, 1U starch phosphorylase, 1U laminaribiose phosphorylase, 10mg of IA-treated starch, and potassium phosphate (pH 7.0) (0-100mM) at different concentrations was subjected to catalytic reaction at 50 ℃ for 24 hours. Detection of laminaribiose was the same as in example 1. As a result, as shown in FIG. 5B, the yield of laminaribiose increased as the concentration of potassium phosphate increased, but the yield of laminaribiose began to decrease slowly after the concentration of potassium phosphate was more than 20mM, and thus the amount of potassium phosphate added was determined to be 20 mM.

Then, a 1.0mL reaction system containing 100mM glucose, 100mM HEPES buffer (pH 7.0), 5mM divalent magnesium ions, 20mM potassium phosphate (pH 7.0), 1U laminaribiose phosphorylase, 10mg of IA-treated starch, and 0-5U starch phosphorylase was subjected to catalytic reaction at 50 ℃ for 24 hours. Detection of laminaribiose was the same as in example 1. As a result, as shown in FIG. 5C, the yield of laminaribiose increased with the increase of the amount of starch phosphorylase, and it was confirmed that the amount of starch phosphorylase added was 2U.

Then, a 1.0mL reaction system containing 100mM glucose, 100mM HEPES buffer (pH 7.0), 5mM divalent magnesium ions, 20mM potassium phosphate (pH 7.0), 2U of starch phosphorylase, 10mg of IA-treated starch, and 0-5U of laminaribiose phosphorylase was subjected to catalytic reaction at 50 ℃ for 24 hours. Detection of laminaribiose was the same as in example 1. As a result, as shown in FIG. 5D, the yield of laminaribiose increased with the increase in the amount of laminaribiose phosphorylase, and it was determined that the amount of laminaribiose phosphorylase added was 2U.

Then, a 1.0mL reaction system containing 100mM glucose, 100mM HEPES buffer (pH 7.0), 5mM divalent magnesium ions, 20mM potassium phosphate (pH 7.0), 2U starch phosphorylase, 2U laminaribiose phosphorylase, and 10mg of IA-treated starch was subjected to a catalytic reaction at 50 ℃ for 36 hours.

After the reaction was complete, the final laminaribiose concentration (FIG. 6) was found to be 46mM and the conversion to starch (10g/L, about 61.3mM dextrose equivalent) was found to be 75%, which was a significant improvement over the initial conditions.

Example 4 increase in laminaribiose yield by adding an enzyme that promotes elongation of short-chain maltooligosaccharide sugar chains

Under the dual action of starch phosphorylase and isoamylase, the final products of hydrolysis of soluble starch are maltotriose and maltose, and glucan transferase (4GT, EC 2.4.1.25) is added into the reaction system to further convert the products into laminaribiose, thereby improving the yield.

In this example, glucanotransferase was derived from Thermococcus litoralis with the gene on KEGG numbered OCC-10078, and the genomic DNA of this strain was available from the official website (www.atcc.org) of ATCC. This gene was obtained by PCR from the corresponding genomic DNA using primers F4/R4, wherein F4: TGTTTAACTTTAAGAAGGAGATATAATGGAAAGAAT AAACTTCATATTTG, R4: CAGTGGTGGTGGTGGTGGTGCTCGAGTCAAAG CTCCCTGAACCTTACCGTG, and cloned into pET20b vector by Simple Cloning method to obtain the corresponding expression vector pET20b-Tl4 GT. Then, this plasmid was transformed into E.coli expressing bacterium BL21(DE3) for protein expression and purification.

Isoamylase was prepared as in example 2; preparation of starch phosphorylase and laminaribiose phosphorylase as in example 1; the reaction conditions were the same as in example 3.

A1.0 mL reaction system containing 5mM sodium acetate buffer (pH 5.5), 0.5mM magnesium chloride, 1U isoamylase, 10mg starch was subjected to catalytic reaction at 85 ℃ for 12 hours.

Then, a 1.0mL reaction system containing 100mM HEPES buffer (pH 7.0), 5mM divalent magnesium ions, 20mM potassium phosphate (pH 7.0), 100mM glucose, 2U starch phosphorylase, 2U laminaribiose phosphorylase, and 10mg of IA-treated starch was subjected to a catalytic reaction at 50 ℃ for 12 hours, after which 1U glucanotransferase was added and the reaction was continued for 24 hours.

It was found that the final laminaribiose concentration (FIG. 6) after the reaction was 52.7mM and the conversion to starch (10g/L, about 61.3mM dextrose equivalent) was 86%, and that the conversion to starch of laminaribiose was further improved by 4 GT.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (55)

1. A method for preparing laminaribiose by using an enzyme catalysis reaction is characterized in that a reaction system contains starch, glucose, starch phosphorylase, laminaribiose phosphorylase and buffer solution, the laminaribiose phosphorylase is derived from Paenibacillus, the starch phosphorylase is derived from Thermotoga maritima, the concentration of the starch in the reaction system is 8-20g/L, the concentration of the glucose in the reaction system is 50-200mM, the dosage of the starch phosphorylase in the reaction system is 1-5U/mL, the dosage of the laminaribiose phosphorylase in the reaction system is 1-5U/mL, the temperature of the enzyme catalysis reaction is 30-60 ℃, the time of the enzyme catalysis reaction is 6-48 hours, and the pH of the buffer solution is 6.0-7.5.

2. The method according to claim 1, wherein the concentration of starch in the reaction system is 10 g/L.

3. The method according to claim 1, wherein the concentration of glucose in the reaction system is 100 mM.

4. The method according to claim 1, wherein the amount of the starch phosphorylase used in the reaction system is 2U/mL.

5. The process according to claim 1, wherein the amount of laminaribiose phosphorylase used in the reaction system is 2U/mL.

6. The method of claim 1, wherein the temperature of the enzyme-catalyzed reaction is 50 ℃.

7. The method of claim 1, wherein the time for the enzyme-catalyzed reaction is 24 to 36 hours.

8. The method of claim 1, wherein the starch is a mixture of any one or more of soluble starch, soluble amylose, soluble amylopectin, amylodextrin, maltodextrin, maltopolysaccharide and maltose in any proportion.

9. The method according to claim 1, wherein the reaction system further contains a phosphate or a magnesium salt.

10. The method according to claim 1, wherein the buffer is HEPES buffer, Tris-HCl buffer, MOPS buffer, or citrate buffer.

11. The method of claim 10, wherein the citrate buffer is sodium citrate buffered.

12. The method of claim 1, wherein the buffer has a pH of 7.0.

13. The method according to claim 1, wherein the concentration of the buffer in the reaction system is 50 to 120 mM.

14. The method according to claim 13, wherein the concentration of the buffer in the reaction system is 100 mM.

15. The method of claim 9, wherein the phosphate is potassium phosphate or sodium phosphate.

16. The method according to claim 9, wherein the concentration of the phosphate in the reaction system is 5 to 25 mM.

17. The method according to claim 16, wherein the concentration of the phosphate in the reaction system is 20 mM.

18. The method of claim 9, wherein the magnesium salt is magnesium chloride or magnesium sulfate.

19. The method according to claim 9, wherein the concentration of the magnesium salt in the reaction system is 3 to 10 mM.

20. The method according to claim 19, wherein the concentration of the magnesium salt in the reaction system is 5 mM.

21. The method of claim 1, wherein glucanotransferase is added to the reaction system.

22. The method of claim 21, wherein the glucanotransferase is used in an amount of 0.5 to 2U/mL in the reaction system.

23. The method of claim 22, wherein the amount of glucanotransferase used in the reaction system is 1U/mL.

24. The method as claimed in claim 21, wherein the starch phosphorylase and laminaribiose phosphorylase are added to the reaction system, and the glucanotransferase is added after the reaction is performed for a certain period of time.

25. The method according to claim 24, wherein the starch phosphorylase and laminaribiose phosphorylase are added to the reaction system and reacted at 30 to 60 ℃ for 6 to 30 hours.

26. The method according to claim 25, wherein the starch phosphorylase and laminaribiose phosphorylase are added to the reaction system and reacted at 50 ℃ for 12 to 24 hours.

27. The method of claim 24, wherein the reaction is continued at 30-60 ℃ for 6-30 hours after adding glucanotransferase to the reaction system.

28. The method of claim 27, wherein the reaction is continued at 50 ℃ for 12 to 24 hours after the glucanotransferase is added to the reaction system.

29. The method according to claim 1, wherein isoamylase is added to the reaction system when the starch contains α -1,6 glucosidic bonds.

30. The method of claim 29, wherein the isoamylase is added in an amount of 0.5 to 2U/mL.

31. The method of claim 30, wherein the amount of isoamylase used in the reaction system is 1U/mL.

32. The method of claim 29, wherein isoamylase is added to the reaction system, and after a certain period of reaction, starch phosphorylase and laminaribiose phosphorylase are added; or adding isoamylase into the reaction system, reacting for a period of time, and then adding starch phosphorylase, laminaribiose phosphorylase and glucanotransferase; or adding isoamylase into the reaction system, adding starch phosphorylase and laminaribiose phosphorylase after reacting for a period of time, and adding glucanotransferase after reacting for a period of time.

33. The method of claim 32, wherein isoamylase is added to the reaction system and the reaction is carried out at 50 to 90 ℃ for 6 to 24 hours.

34. The method of claim 33, wherein isoamylase is added to the reaction system and reacted at 85 ℃ for 12 hours.

35. The method of claim 32, wherein the reaction is continued at 30-60 ℃ for 6-48 hours after the starch phosphorylase and laminaribiose phosphorylase are post-added to the reaction system or after the starch phosphorylase, laminaribiose phosphorylase and glucanotransferase are post-added.

36. The method as set forth in claim 35, wherein the reaction is continued at 50 ℃ for 24 to 36 hours after the starch phosphorylase and laminaribiose phosphorylase are post-added to the reaction system or after the starch phosphorylase, laminaribiose phosphorylase and glucanotransferase are post-added.

37. The method as claimed in claim 32, wherein the starch phosphorylase and laminaribiose phosphorylase are added after the reaction, and the reaction is carried out at 30-60 ℃ for 6-30 hours, and further the glucanotransferase is added, and the reaction is carried out at 30-60 ℃ for 6-30 hours.

38. The method as claimed in claim 32, wherein the starch phosphorylase and laminaribiose phosphorylase are added to the reaction system, and the reaction is carried out at 50 ℃ for 12 to 24 hours, and further the glucanotransferase is added, and the reaction is carried out at 50 ℃ for 12 to 24 hours.

39. The method of claim 1, wherein when the starch contains α -1,6 glucosidic bonds, the α -1,6 glucosidic bonds contained therein are first catalytically decomposed by isoamylase.

40. The method as claimed in claim 39, wherein the concentration of starch in the reaction system is 8 to 20 g/L.

41. The method as claimed in claim 40, wherein the concentration of starch in the reaction system is 10 g/L.

42. The method as claimed in claim 39, wherein the amount of isoamylase used in the reaction system is 0.5 to 2U/mL.

43. The method as claimed in claim 42, wherein the amount of isoamylase used in the reaction system is 1U/mL.

44. The process of claim 39, wherein the reaction is carried out at 50-90 ℃ for 6-24 hours.

45. The method of claim 44, wherein the reaction is carried out at 85 ℃ for 12 hours.

46. The method of claim 39, wherein the reaction system further comprises a buffer and a magnesium salt.

47. The method of claim 46, wherein the buffer is sodium acetate buffer, HEPES buffer, citrate buffer.

48. The method of claim 47, wherein the citrate buffer is a sodium citrate buffer.

49. The method of claim 46, wherein the buffer has a pH of 4.5 to 6.5.

50. The method of claim 49, wherein the buffer has a pH of 5.5.

51. The method according to claim 46, wherein the concentration of the buffer in the reaction system is 3 to 10 mM.

52. The method of claim 51, wherein the buffer is present in the reaction system at a concentration of 5 mM.

53. The method of claim 46, wherein the magnesium salt is magnesium chloride or magnesium sulfate.

54. The method according to claim 46, wherein the concentration of the magnesium salt in the reaction system is 0.2 to 1 mM.

55. The method of claim 54, wherein the concentration of the magnesium salt in the reaction system is 0.5 mM.

Images