CN109706177A - A kind of vaccinia virus recombinant surface display system vector plasmid and application - Google Patents

Abstract

The invention discloses a kind of vaccinia virus recombinant surface display system vector plasmid and application, the expression cassette core group point of the vaccinia vectors plasmid display system includes the vaccinia virus H5 promoter of modification, Escherichia coli EM7 promoter, concatenated histidine tag, polypeptide fragment Nano-tag15, DsRed mCherry, Zeocin resistance protein, the vaccinia virus D8 albumen transmembrane domains that can combine Streptavidin.The present invention is based on the vaccinia virus recombinants of above-mentioned plasmid construction can be in outer virionic membrane surface display Nano-tag15, and take this to be captured recombinant virus by Streptavidin MagneSphere, and surface display DsRed mCherry and Zeocin resistance markers, it quickly screens vaccinia virus recombinant to be used alone or being used in combination by magnetic bead sorting, fluorescent marker tracer and the methods of selected by flow cytometry apoptosis and drug resistance and provides new powerful measure.

Description

A kind of vaccinia virus recombinant surface display system vector plasmid and application

Technical field

The present invention relates to field of biotechnology, more particularly to a kind of vaccinia virus recombinant surface display system vector plasmid And its application.

Background technique

Vaccinia virus (vaccinia virus) is maximum, most complicated one of the virus found so far, it is prevention day Colored virus of live vaccine.For smallpox after global eradication, vaccinia virus obtains further investigation and wide as gene engineering expression carrier General application.Based on the virus following characteristics, so that it has been more and more widely used in field of tumor gene therapy: 1. pacifying Complete: vaccinia virus is the DNA virus that can uniquely replicate in endochylema, it will not be integrated into host cell gene group, non-carcinogenesis Etc. safety problems；2. expression efficiency is high: vaccinia virus can cultivate very high titre (> 10⁹Pfu/ml), usually infection 1-3 is small When, it is screened without any drug resistance, 90% or more infected cell can be made to express target gene product；3. infection cell model It encloses extensively: almost all kinds of mammalian cell can be infected；4. can infection/transduction to division and non-dividing cell；⑤ Gene pool-size is big: at least can be inserted into the foreign gene of 25kb without influencing its genetic stability；6. to thermostabilization: facilitating scene It uses and transports；7. low in cost；8. the intimate native configurations of expression product: the product that it is expressed can undergo correct glycosylation, Post translational processing, close to native configurations, and these are vital for vaccine carrier challenge；9. generating effective Immune response: vaccinia virus recombinant generates live virus natural infection process, makes expressed exogenous antigen together with itself viral egg Bai Yiqi offers altogether for host MHC, can not only generate humoral immunity, moreover it is possible to which activated cell is immune, and immune response is potent, holds Long, generally it is not required to multiple cropping.Importantly, bovine vaccine infection can provide " danger signal " to host, excitation body effectively generates needle To the t cell immune response of carrier itself and its expressed antigen, or even body can also be excited very weak to script natural antigenicity Immunogene (such as CEA) also generate strong immune response.

In above and other vaccinia virus correlative study and application, rate-limiting step is construction and screening recombinant vaccinia disease Poison.Since last century the eighties vaccinia virus is used as gene engineering expression carrier for the first time and carries out correlative study, building Main stream approach with screening vaccinia virus recombinant is always to be based on homologous recombination principle, i.e. building vaccinia virus recombinant expression first External source target gene is placed under natural or artificial synthesized Vaccinia promoters control, by the expression cassette by vector plasmid It is inserted among some vaccinia virus dispensable gene (the most commonly used is vaccinia virus TK genes) segment, when the Transfected Recombinant Plasmid It is nonessential by the left and right side of target gene in recombinant plasmid in the cell when by the cell of wild type vaccinia virus infection Homologous recombination occurs for same dispensable gene sequence in gene order and wild type vaccinia virus gene group, thus by external source purpose Gene is inserted into the corresponding dispensable gene of vaccinia virus, completes the building of vaccinia virus recombinant.

However, the probability that above-mentioned homologous recombination generates vaccinia virus recombinant only has 0.1% if special processing is not added, because This requires to add other processing for the screening efficiency for improving vaccinia virus recombinant.The side of classical screening vaccinia virus recombinant Method is such as: chemical reagent 5-bromouracil deoxyribose (5-BrdU) is a kind of thymidine analog, in virus TK gene coding It is phosphorylated under thymidine kinase catalysis and penetrates into progeny virus genomic DNA, lead to lethal effect, therefore TK gene is completely wild Type vaccinia virus in the presence of 5-BrdU do not survive by reproducible, and in vaccinia virus recombinant, target gene is by TK gene Insertion inactivation, therefore duplication amplification can be continued not by the lethal effects of 5-BrdU, pass through the selectivity pressure of 5-BrdU Power, and the vaccinia virus recombinant with TK negative phenotype is mixed from the wild type vaccinia virus with TK positive phenotypes to occupy the majority It is screened in object.However, the classical way other than step is various, needs the i.e. TK phenotype feminine gender of special cell strain 143 cell strain of TK-.In addition, 5-BrdU selection pressure is merely able to filter out the vaccinia virus of TK negative phenotype, but wild type acne The TK gene of seedling diseases poison has the spontaneous mutation of certain frequency, also generates TK negative phenotype, and 5-BrdU screening cannot distinguish between It, therefore 5-BrdU selection pressure is merely able to filter out the vaccinia virus of TK negative phenotype but is not necessarily exactly recombinant virus, Including the non-recombinant virus generated because of spontaneous mutation.

Other than above-mentioned 5-BrdU pressure screening method, other classics screen the methods of vaccinia virus recombinants also: by purpose Expression casette and certain drug resistance gene such as gpt express cassette in series, or with the enzyme gene that can act on substrate colour developing (such as LacZ) series connection, or connect with the gene (such as GFP) for generating fluorescence, it is screened by drug resistance or enzyme colour developing is screened, or Fluorescent screening separates vaccinia virus recombinant.However, these methods have certain limitation, as operating procedure is complicated and screening It is inefficient etc..In addition, certain selectable marker genes such as LacZ is bigger, common restriction enzyme site can be tied up, building is caused to turn Move the difficulty of vector plasmid.

Summary of the invention

In view of the above-mentioned deficiencies in the prior art, it is an object of the present invention to provide a kind of vaccinia virus recombinant surface display system Vector plasmid pVTK-CZ and application.

The purpose of the present invention is achieved through the following technical solutions: a kind of vaccinia virus recombinant surface showing plasmid table Up to carrier, its nucleotide sequence is as shown in SEQ ID No.22；Vaccinia virus H5 promoter including sequentially connected modification, Escherichia coli EM7 promoter, concatenated histidine tag, can be in conjunction with the polypeptide fragment Nano-tag15, red glimmering of Streptavidin Photoprotein mCherry, Zeocin resistance protein and vaccinia virus D8 albumen transmembrane domains；The vaccinia virus H5 of the modification is opened The nucleotide sequence of mover is as shown in SEQ ID No.1, the nucleotide sequence of Escherichia coli EM7 promoter such as SEQ ID No.2 Shown, the nucleotide sequence of concatenated histidine tag, can be in conjunction with the polypeptide fragment of Streptavidin as shown in SEQ ID No.3 The nucleotide sequence of Nano-tag15 is as shown in SEQ ID No.4, the nucleotide sequence of DsRed mCherry such as SEQ ID Shown in No.5, the nucleotide sequence of Zeocin resistance protein is as shown in SEQ ID No.6, the core of vaccinia virus D8 albumen transmembrane domains Nucleotide sequence is as shown in SEQ ID No.7.

It further, further include that be connected to vaccinia virus D8 albumen transmembrane domains subsequent for driving destination gene expression Artificial synthesized vaccinia virus morning-late promoter P-s/l and cloning site downstream.Artificial synthesized vaccinia virus morning- The nucleotide sequence of late promoter P-s/l is as shown in SEQ ID No.8.

Further, the amino acid sequence of the concatenated histidine tag can combine strepto- as shown in SEQ ID No.9 The amino acid sequence of the polypeptide fragment Nano-tag15 of Avidin is as shown in SEQ ID No.10.DsRed mCherry's Amino acid sequence is as shown in SEQ ID No.11, and the amino acid sequence of Zeocin resistance protein is as shown in SEQ ID No.12, acne The amino acid sequence of seedling diseases poison D8 albumen transmembrane domains is as shown in SEQ ID No.13.

The invention also discloses above-mentioned vaccinia virus recombinant surface showing plasmid expression vectors to construct in vaccinia virus recombinant Application in being separated with vaccinia virus recombinant.

The beneficial effects of the present invention are: the table of vaccinia virus recombinant surface display system vector plasmid pVTK-CZ of the present invention Include (5 ' → 3 ') up to frame core group point: the vaccinia virus H5 promoter (mH5) of modification, Escherichia coli EM7 promoter are concatenated Histidine tag (6 × His-tag), can be in conjunction with the polypeptide fragment Nano-tag15 of Streptavidin, DsRed (mCherry), Zeocin resistance protein and vaccinia virus D8 albumen transmembrane domains.In addition, with above-mentioned display systems expression cassette string Connection there are also for driving the artificial synthesized vaccinia virus morning-late promoter P-s/l and downstream of destination gene expression Cloning site.Vaccinia virus recombinant based on above-mentioned plasmid construction can be in outer virionic membrane surface display Nano-tag15, and nationality This is captured recombinant virus and surface display DsRed mCherry and Zeocin resistance mark by Streptavidin MagneSphere Will object.The present invention is individually to be made by magnetic bead sorting, fluorescent marker tracer and the methods of selected by flow cytometry apoptosis and drug resistance With or be used in combination and quickly screen vaccinia virus recombinant and provide new powerful measure.

Detailed description of the invention

Fig. 1 vaccinia virus recombinant surface display system vector plasmid pVTK-CZ map；

Fig. 2 vaccinia virus recombinant surface display system vector plasmid pVTK-CZ core component ideograph, in figure, mH5 is to repair The vaccinia virus H5 promoter of decorations, EM7 are Escherichia coli EM7 promoter, and 6 × His is series connection histidine tag, Nano-tag15 For Streptavidin binding peptide, mCherry is DsRed, and Zeocin is Zeocin resistance protein, and D8-TMD is bovine vaccine disease Malicious D8 albumen transmembrane domains, P-se/l are the vaccinia virus early late phase promoter of synthesis；

Fig. 3 is that ELISA detects VV-mC/Z-D8 virus surface and shows His-tag polypeptide histogram, in figure, Histag+D8 +: expression His-tag is more in the vaccinia virus recombinant VV-mC/Z-D8, Histag+D8-: coating of surface display His-tag polypeptide The vaccinia virus recombinant VV-GFP of peptide；

Fig. 4 is the sensibility schematic diagram that vaccinia virus recombinant VV-mC/Z-D8 surface display fusion protein digests pancreatin； In figure, VV-mC/Z-D8: VV-GFP: the vaccinia virus recombinant of surface display DsRed expresses green fluorescent protein in coating Vaccinia virus recombinant, VV-WR: wild type vaccinia virus (WR plants).

Specific embodiment

The nucleotide sequence of vaccinia virus recombinant surface showing plasmid expression vector of the present invention as shown in SEQ ID No.22, Its expression cassette successively includes following core component (5 ' → 3 ') and its function: the vaccinia virus H5 promoter (mH5) of modification is used for Drive the expression of marker gene；Escherichia coli EM7 promoter, for driving external source purpose track fusion to be particularly used for The expression of the marker gene, that is, DsRed (mCherry) and Zeocin resistance protein gene in fusion is driven, with side Just construction of recombinant plasmid；Concatenated histidine tag (6 × His-tag), the expression for detection fusion gene；Strepto- can be combined The polypeptide fragment Nano-tag15 of Avidin, for combining the magnetic bead of coupling Streptavidin, fast to separate recombinant vaccinia disease Poison；DsRed (mCherry) is used for vaccinia virus recombinant tracer, flow cytometric sorting and plaque purification；Zeocin is anti- Property albumen, be used for vaccinia virus recombinant resistance screening；And vaccinia virus D8 albumen transmembrane domains, it is used for above-mentioned all element tables Face presenting and expressing is in vaccinia virus recombinant peplos.In addition, concatenated also for driving mesh with above-mentioned display systems expression cassette Gene expression artificial synthesized vaccinia virus morning-late promoter P-s/l and cloning site downstream.

The core component encoding gene nucleotide sequence of the recombinant vaccinia surface display expression vector plasmid, which is respectively as follows:, to be repaired Vaccinia virus H5 promoter (mH5) sequence of decorations is as shown in SEQ ID No.1, Escherichia coli EM7 promoter sequence such as SEQ ID Shown in No.2, concatenated histidine tag (6 × His-tag) sequence is as shown in SEQ ID No.3, and Nano-tag15 sequence is such as Shown in SEQ ID No.4.MCherry gene order is as shown in SEQ ID No.5, Zeocin resistance protein gene order such as SEQ Shown in ID No.6, vaccinia virus D8 albumen transmembrane domains gene order is as shown in SEQ ID No.7.Artificial synthesized vaccinia virus Morning-late promoter P-s/l sequence is as shown in SEQ ID No.8.

The core component amino acid sequence of the recombinant vaccinia surface display expression vector plasmid is respectively as follows: concatenated group of ammonia Acidity scale label (6 × His-tag) sequence is as shown in SEQ ID No.9, and Nano-tag15 sequence is as shown in SEQ ID No.10. MCherry sequence is as shown in SEQ ID No.11, and Zeocin resistance protein sequence is as shown in SEQ ID No.12, vaccinia virus D8 Albumen transmembrane domains sequence is as shown in SEQ ID No.13.

The present invention is amplified the PCR fragment comprising each core component first, is then gradually superimposed by overlapping PCR method Extend, assemble fusion, then clones into the basic vaccinia vectors matter for including the left and right other sequencing column of vaccinia virus TK gene Grain pVTK, specific steps are described below.

The present invention provides use pVTK-CZ plasmid construction vaccinia virus recombinant and fast screen using magnetic bead sorting method to divide Method from vaccinia virus recombinant.

Embodiment 1: the building of recombinant plasmid pVTK-CZ

(1) PCR primer

HN-1 (SEQ ID No.14): atcatgatgtagaagcttggttaggagctagagtaccattagtagaaac tgtgagcaagggcgaggag

HN-2 (SEQ ID No.15): taatacgactcactataggagggccaccccaccatgcaccatcatcatc atcatgatgtagaagcttg

HN-3 (SEQ ID No.16): gctgcagcacgtgttgacaattaatcatcggcatagtatatcggcatag tataatacgactcactatag

HN-4 (SEQ ID No.17): aggttcttgagggttgtgttaaattgaaagcgagaaataatcataaata agctgcagcacgtgttgac

HN-5 (SEQ ID No.18): gtctagaactagtaaaaattgaaaataaatacaaaggttcttgagggtt gtg

TMD-1 (SEQ ID No.19): ctatggcaataattgcgaatgttttattctcttcgatatatttttggt cctgctcctcggccacgaag

TMD-2 (SEQ ID No.20): tcgtcgactcataaaaaagagaatagcggtaagtataaacacgaatac tatggcaataattgcgaatg

TMD-3 (SEQ ID No.21): tcgactagatctattagttttgtttttctcgcgaatatcgtcgactca taaaaaagag

(2) general PCR reaction system is as follows:

(3) PCR reaction process are as follows: 94 DEG C of initial denaturation 2min；94 DEG C of denaturation 50s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min, Repeat 30 circulations；72 DEG C of extension 10min.PCR product is taken to run 1% agarose gel electrophoresis, gel image analyser observation note Record is as a result, purpose band gel extraction.It is recycled using plastic recovery kit (Sangon Biotech (Shanghai) Co., Ltd.) Target gene fragment.

(4) construction step of recombinant plasmid pVTK-CZ

1) with LeGO-C/Zeo plasmid (fusion containing mCherry-Zeocin) for template, with primer HN-1 and TMD-1 And pfu enzyme makees PCR, 18 circulation of operation amplifies about 1170bp segment (segment -1), electrophoresis verifies it.

2) it is template with above-mentioned segment -1, makees PCR with primer HN-2 and TMD-2 and pfu enzyme, 18 circulation of operation amplifies About 1266bp segment (segment -2), electrophoresis verifies it.

3) it is template with above-mentioned segment -2, makees PCR with primer HN-3 and TMD-3 and pfu enzyme, 18 circulation of operation amplifies About 1339bp segment (segment -3), electrophoresis verifies it.

4) it is template with above-mentioned segment -3, makees PCR with primer HN-4 and TMD-3 and pfu enzyme, 18 circulation of operation amplifies About 1389bp segment (segment -4), electrophoresis verifies it.

5) it is template with above-mentioned segment -4, makees PCR with primer HN-5 and TMD-3 and pfu enzyme, 30 circulation of operation amplifies About 1423bp segment (segment -5), cuts glue purification.

6) carrier is carrier pVTK plasmid, -5 wine of segment are expressed with Bgl II and Spe I difference double digestion segment -5 and bovine vaccine Smart deposition and purification, vector plasmid cut glue purification, reconnect target fragment and carrier.

7) by attachment transformed competence colibacillus bacterium, the choosing colony in the Double plate of Amp and Zeocin.Recombinant plasmid name For pVTK-CZ

(5) identification of recombinant plasmid pVTK-CZ:

1) with after Bgl II and Spe I double digestion recombinant plasmid, 1.4kb and 4.9 two segment can be obtained.

2) recombinant bacterium red color visible fluorescence under ultraviolet light even white light.

3) Transfected Recombinant Plasmid is by 293 cells of vaccinia virus infection, it is seen that red fluorescence.

Embodiment 2: vaccinia virus recombinant building and screening

Method one: classical resistance-fluorescence plaque purification screening

It is inoculated with Vero cell in 6 orifice plates, grows its next day to 80% in flakes.Lipofectamine2000 liposome transfection PVTK-CZ recombinant plasmid takes 4 μ g pVTK-CZ plasmids to be diluted in the DMEM culture medium of 250 μ L serum-frees, as A liquid, takes 10 μ L liposome is diluted in the DMEM culture medium of 250 μ L serum-frees, is incubated at room temperature after mixing A liquid and B liquid as B liquid 20min adds 300 μ L serum-free DMEM, mixes, and mixed liquor is added in the cell for washing 2 times through HanKs liquid, 37 DEG C, 5% CO₂After cultivating 4h in incubator, WR plants of wild type vaccinia virus of 10 μ L, 37 DEG C, 5%CO are added in every hole₂Continue to be incubated for 2h in incubator Afterwards, DMEM culture medium of the 2mL containing 2%FCS, 37 DEG C, 5%CO are added in every hole₂Continue to cultivate in incubator, infection is collected after 48h The cell of vaccinia virus, in -80 DEG C and 37 DEG C multigelation 3 times, the as infection cell lysate containing recombinant virus saves It is spare in -80 DEG C.

Then, sieve recombinant virus 2 times blind first.It is inoculated with Vero cell in 6 orifice plates, grows to 80%- to next day cell Culture medium is discarded when 90%, is washed twice with Hank ' s liquid, the employing virus cracking liquid generated in addition 0.2mL above-mentioned steps, 37 DEG C, 5%CO₂2h is cultivated in incubator and abandons supernatant, is washed twice with Hank ' s liquid, and containing 1 × gpt, (initial concentration: 400 × secondary Huang is fast for addition Purine 10mg/ml, 40 × xanthine 10mg/ml, 670 × mould phenol 10mg/ml) and 200 μ g/mL Zeocin 2%FCS DMEM Culture medium.Vero cell red fluorescence expression is observed under fluorescence inverted microscope, after the complete lesion of cell, collects disease Venom.It repeats the above steps primary.

The screening of vaccinia virus recombinant plaque purification: it is inoculated with Vero cell in 6 orifice plates, grows to 80- to next day cell Culture medium is discarded when 90%, is washed twice with Hank ' s liquid, and the 200 μ l of virus liquid being serially diluted through 10 times, 37 DEG C, 5%CO are added₂ 2h is cultivated in incubator, is during which then abandoned supernatant every the 15min shaking several seconds to disperse viral agglomerate, is washed two with Hank ' s liquid Time, the DMEM culture medium for containing 1 × gpt and 200 μ g/mL Zeocin and 2%FCS is added.It is observed under fluorescence inverted microscope Vero cell red fluorescence expression, is fixed after having typical Plaque Formation with agar.Default 45 DEG C of water-baths are spare, by concentration For 2% low melting-point agarose (every hole needs 1.5mL) set micro-wave oven melt after, with isometric 2 × DMEM culture solution mix, set 45 DEG C water-bath is stand-by.The above-mentioned prepared every hole 2mL of agarose is carefully added into each hole, after room temperature or 4 DEG C solidify, picking expression is red Single plaque at color fluorescence in the DMEM culture medium of 500 μ L 2%FCS, in -80 DEG C and 37 DEG C multigelation 3 times.Hereafter, Each plaque infects a hole, remaining step is same as above, and repeats above step, until the vaccinia virus recombinant purified, name For VV-mC/Z-D8.

Method two: magnetic bead screening method separates vaccinia virus recombinant

Following experimental procedure requires sterile working, and the product Streptavidin Magnetic of NEB company is used in experiment Beads kit (article No.: S1420S；Content: 4mg/ml).

1, routinely (contain the Nano-tag15 with D8 protein fusion with bovine vaccine expression plasmid pVTK-CZ and related plasmids Polypeptide) wild type vaccinia virus infection cell in 6 well culture plates of transfection, cell is collected after 48 hours, -70 DEG C/37 DEG C freeze thawing are thin 3 lytic cells of born of the same parents, the frozen-thaw lysate will contain vaccinia virus recombinant, immediately using or freeze spare.

2, magnetic bead sorting buffer: the PBS buffer solution without Ca without Mg is prepared, 0.1%BSA, 2mM EDTA, pH7.4 are contained, or Person directlys adopt the Wash/Binding Buffer of NEB company kit

3, Beads bottles of Streptavidin Magnetic are shaken up, draws 10-30 μ L, addition has had 0.5ml sorting The small centrifuge tube of buffer shakes after mixing 30 seconds, EP pipe is placed in magnet frame 1 minute, buffer is sucked, repeats Step is stated to wash one time.

4, the above-mentioned frozen-thaw lysate about 0.5-1ml containing virus is transferred to a sterile EP tube, the ultrasound 3 in edta buffer liquid It is secondary, 15 seconds every time, above-mentioned washed magnetic bead is added, slowly shakes incubation 10 minutes.

5, small centrifuge tube is placed in magnet frame 1 minute, carefully sucks supernatant, 1ml is added to sort buffer, magnetic is resuspended Pearl repeats to place and wash after 1 minute one time in magnet frame.

6, the magnetic bead that absorption vaccinia virus recombinant has been hanged with serum-free DMEM culture solution 200ul adds in 6 orifice plates about 80% sheet of cell, 6 orifice plates bottom can place magnet frame with the infectivity of enhanced virus, cultivate 24-48 hours, observe daily Viral index (Virus plaque or fluorescence etc.).

7, it repeats the above steps 1-2 times, until the concentration of vaccinia virus recombinant progressive, purifying.

Embodiment 3: the vaccinia virus recombinant verifying of surface display target gene

It is illustrated by taking vaccinia virus recombinant VV-mC/Z-D8 as an example below.

(1) ELISA detects VV-mC/Z-D8 virus surface and shows His-tag polypeptide

Vero cell expands vaccinia virus recombinant VV-mC/Z-D8, and making up to virus titer is 10⁸Pfu/mL is dense with end 37 DEG C of inactivation of viruses of formalin that degree is 0.4%, pH9.6 carbonate buffer solution are resuspended, and are coated with 96 hole elisa plates, 100 μ L/ Hole, 4 DEG C overnight, and PBST is washed 3 times, and each 2min is patted dry, and the 300 μ L of PBST confining liquid containing 5%FCS, room temperature closing is added in every hole 4h, PBST are washed 3 times, and each 2min is patted dry, and the anti-His-tag of mouse that the PBST dilution (1:200) containing 0.5%FCS is added in every hole is anti- Body (" primary antibody "), 37 DEG C of effect 2h, PBST are washed 3 times, and each 2min is patted dry, be added containing 0.5%FCS PBST dilution (1: 1000) HRP marks sheep anti-mouse igg antibody (" secondary antibody "), 100 holes μ L/, and 37 DEG C of effect 1h, PBST are washed 5 times, each 2min, bat It is dry, the colour developing of EL-ABTS colour reagent box, microplate reader 405nm wavelength detecting.Histag+D8- is arranged in experiment to compare, that is, recombinates Vaccinia virus expresses His-tag label, but without the outer virionic membrane surface display expression based on D8-TMD.Experimental result such as Fig. 3 institute Show, the His-tag reading of ELISA detection VV-mC/Z-D8 virus is significantly higher than control virus (expression His-tag but non-surface exhibition Show), prompt the fusion protein containing His-tag in VV-mC/Z-D8 virus surface presenting and expressing.

(2) sensibility that vaccinia virus recombinant VV-mC/Z-D8 surface display fusion protein digests pancreatin

Vero cell expands VV-mC/Z-D8 virus, and making up to virus titer is 10⁸Pfu/mL takes 10 μ L virus liquids to add Enter in EP pipe, 300 μ L pancreatin (containing 0.25% pancreatin and 0.02%EDTA) is added, 37 DEG C act on 4min, 30min respectively, 60min, 90min add 10%FCS cell culture fluid to terminate reaction, and high speed centrifugation abandons supernatant, and PBS is washed once, 580nm/610nm Survey fluorescence intensity.And to carry the vaccinia virus recombinant of fluorescent marker but fluorescin is not showed in virus surface and compares, As a result as shown in figure 4, the fluorescence intensity of VV-mC/Z-D8 virus extends at any time and progressive decline, and compare virus fluorescence It is hardly influenced by pancreatin digestion, fusion protein of the strong indication containing fluorescin is showed in VV-mC/Z-D8 virus surface Rather than inside peplos.

(3) the magnetic bead sorting experiment of hybrid virus

Contain Nano-tag15 polypeptide in the fusion protein of vaccinia virus recombinant VV-mC/Z-D8 surface display, it can be with chain Mould Avidin high-affinity combines, and therefore, the magnetic bead that coupling has Streptavidin can be used, by VV-mC/Z-D8 virus from mixing " capture " sorts out in solution.By identical titre (10⁶Pfu/mL the vaccinia virus recombinant of surface display DsRed) VV-mC/Z-D8 and the vaccinia virus recombinant vvGFP of expression green fluorescent protein (but non-surface display) are digested through 0.02%EDTA (not having to pancreatin to digest in order to avoid destroying surface protein) combines ultrasonic treatment to disperse virion, then respectively by 1:1,1:10 and 1:100 is by red, green two kinds of virus mixing, then viral, the ginseng with the VV-mC/Z-D8 in Streptavidin MagneSphere screening hybrid virus Streptavidin MagneSphere (article No. S1420S) product description for examining NEB company is operated.Take 30 μ L magnetic beads through Wash/ Binding Buffer is washed 2 times, and after being resuspended with 30 μ L Wash/Binding Buffer, the pipe of Xiang Shangshu 3 is equipped with hybrid virus EP pipe in 10 μ L are respectively added, room temperature shakes 30min, mixes well, then EP pipe is placed on magnetic frame, and fixed magnetic bead is abandoned Supernatant is removed, is washed magnetic bead 2 times with Wash/Binding Buffer, after magnetic bead is resuspended with 200 μ L DMEM culture solutions, infection Vero is thin Born of the same parents.Hybrid virus liquid separately is prepared in above-mentioned same ratio, but handles without magnetic bead sorting but is directly infected with hybrid virus Vero cell.Virus infection for 24 hours after, in fluorescence microscopy microscopic observation fluorescence and take pictures.The results show that target viral with In the case of non-targeted virus 1:1 mixes, only through a magnetic bead sorting, it can almost 100% purity sub-elects target disease Poison can also be only through a magnetic bead sorting, i.e., even if mixing (i.e. target viral only account for hybrid virus 1%) with 1:100 height Most target virals can be sorted out.

Sequence table

<110>Zhejiang Academy of Medical Sciences

<120>a kind of vaccinia virus recombinant surface display system vector plasmid and application

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 71

<212> DNA

<213>engineer (Unknown)

<400> 1

aaaaattgaa aataaataca aaggttcttg agggttgtgt taaattgaaa gcgagaaata 60

atcataaata a 71

<210> 2

<211> 78

<212> DNA

<213>engineer (Unknown)

<400> 2

ctgcagcacg tgttgacaat taatcatcgg catagtatat cggcatagta taatacgact 60

cactatagga gggccacc 78

<210> 3

<211> 18

<212> DNA

<213>engineer (Unknown)

<400> 3

caccatcatc atcatcat 18

<210> 4

<211> 45

<212> DNA

<213>engineer (Unknown)

<400> 4

gatgtagaag cttggttagg agctagagta ccattagtag aaact 45

<210> 5

<211> 705

<212> DNA

<213>engineer (Unknown)

<400> 5

gtgagcaagg gcgaggagga taacatggcc atcatcaagg agttcatgcg cttcaaggtg 60

cacatggagg gctccgtgaa cggccacgag ttcgagatcg agggcgaggg cgagggccgc 120

ccctacgagg gcacccagac cgccaagctg aaggtgacca agggtggccc cctgcccttc 180

gcctgggaca tcctgtcccc tcagttcatg tacggctcca aggcctacgt gaagcacccc 240

gccgacatcc ccgactactt gaagctgtcc ttccccgagg gcttcaagtg ggagcgcgtg 300

atgaacttcg aggacggcgg cgtggtgacc gtgacccagg actcctccct gcaggacggc 360

gagttcatct acaaggtgaa gctgcgcggc accaacttcc cctccgacgg ccccgtaatg 420

cagaagaaga ccatgggctg ggaggcctcc tccgagcgga tgtaccccga ggacggcgcc 480

ctgaagggcg agatcaagca gaggctgaag ctgaaggacg gcggccacta cgacgctgag 540

gtcaagacca cctacaaggc caagaagccc gtgcagctgc ccggcgccta caacgtcaac 600

atcaagttgg acatcacctc ccacaacgag gactacacca tcgtggaaca gtacgaacgc 660

gccgagggcc gccactccac cggcggcatg gacgagctgt acaag 705

<210> 6

<211> 369

<212> DNA

<213>engineer (Unknown)

<400> 6

gccaagttga ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg agcggtcgag 60

ttctggaccg accggctcgg gttctcccgg gacttcgtgg aggacgactt cgccggtgtg 120

gtccgggacg acgtgaccct gttcatcagc gcggtccagg accaggtggt gccggacaac 180

accctggcct gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg gtcggaggtc 240

gtgtccacga acttccggga cgcctccggg ccggccatga ccgagatcgg cgagcagccg 300

tgggggcggg agttcgccct gcgcgacccg gccggcaact gcgtgcactt cgtggccgag 360

gagcaggac 369

<210> 7

<211> 114

<212> DNA

<213>engineer (Unknown)

<400> 7

caaaaatata tcgaagagaa taaaacattc gcaattattg ccatagtatt cgtgtttata 60

cttaccgcta ttctcttttt tatgagtcga cgatattcgc gagaaaaaca aaac 114

<210> 8

<211> 53

<212> DNA

<213>engineer (Unknown)

<400> 8

aagcttaaaa attgaaattt tatttttttt ttttggaata taaataagct cga 53

<210> 9

<211> 6

<212> PRT

<213>engineer (Unknown)

<400> 9

His His His His His His

1 5

<210> 10

<211> 15

<212> PRT

<213>engineer (Unknown)

<400> 10

Asp Val Glu Ala Trp Leu Gly Ala Arg Val Pro Leu Val Glu Thr

1 5 10 15

<210> 11

<211> 235

<212> PRT

<213>engineer (Unknown)

<400> 11

Val Ser Lys Gly Glu Glu Asp Asn Met Ala Ile Ile Lys Glu Phe Met

1 5 10 15

Arg Phe Lys Val His Met Glu Gly Ser Val Asn Gly His Glu Phe Glu

20 25 30

Ile Glu Gly Glu Gly Glu Gly Arg Pro Tyr Glu Gly Thr Gln Thr Ala

35 40 45

Lys Leu Lys Val Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile

50 55 60

Leu Ser Pro Gln Phe Met Tyr Gly Ser Lys Ala Tyr Val Lys His Pro

65 70 75 80

Ala Asp Ile Pro Asp Tyr Leu Lys Leu Ser Phe Pro Glu Gly Phe Lys

85 90 95

Trp Glu Arg Val Met Asn Phe Glu Asp Gly Gly Val Val Thr Val Thr

100 105 110

Gln Asp Ser Ser Leu Gln Asp Gly Glu Phe Ile Tyr Lys Val Lys Leu

115 120 125

Arg Gly Thr Asn Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr

130 135 140

Met Gly Trp Glu Ala Ser Ser Glu Arg Met Tyr Pro Glu Asp Gly Ala

145 150 155 160

Leu Lys Gly Glu Ile Lys Gln Arg Leu Lys Leu Lys Asp Gly Gly His

165 170 175

Tyr Asp Ala Glu Val Lys Thr Thr Tyr Lys Ala Lys Lys Pro Val Gln

180 185 190

Leu Pro Gly Ala Tyr Asn Val Asn Ile Lys Leu Asp Ile Thr Ser His

195 200 205

Asn Glu Asp Tyr Thr Ile Val Glu Gln Tyr Glu Arg Ala Glu Gly Arg

210 215 220

His Ser Thr Gly Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210> 12

<211> 123

<212> PRT

<213>engineer (Unknown)

<400> 12

Ala Lys Leu Thr Ser Ala Val Pro Val Leu Thr Ala Arg Asp Val Ala

1 5 10 15

Gly Ala Val Glu Phe Trp Thr Asp Arg Leu Gly Phe Ser Arg Asp Phe

20 25 30

Val Glu Asp Asp Phe Ala Gly Val Val Arg Asp Asp Val Thr Leu Phe

35 40 45

Ile Ser Ala Val Gln Asp Gln Val Val Pro Asp Asn Thr Leu Ala Trp

50 55 60

Val Trp Val Arg Gly Leu Asp Glu Leu Tyr Ala Glu Trp Ser Glu Val

65 70 75 80

Val Ser Thr Asn Phe Arg Asp Ala Ser Gly Pro Ala Met Thr Glu Ile

85 90 95

Gly Glu Gln Pro Trp Gly Arg Glu Phe Ala Leu Arg Asp Pro Ala Gly

100 105 110

Asn Cys Val His Phe Val Ala Glu Glu Gln Asp

115 120

<210> 13

<211> 38

<212> PRT

<213>engineer (Unknown)

<400> 13

Gln Lys Tyr Ile Glu Glu Asn Lys Thr Phe Ala Ile Ile Ala Ile Val

1 5 10 15

Phe Val Phe Ile Leu Thr Ala Ile Leu Phe Phe Met Ser Arg Arg Tyr

20 25 30

Ser Arg Glu Lys Gln Asn

35

<210> 14

<211> 68

<212> DNA

<213>engineer (Unknown)

<400> 14

atcatgatgt agaagcttgg ttaggagcta gagtaccatt agtagaaact gtgagcaagg 60

gcgaggag 68

<210> 15

<211> 68

<212> DNA

<213>engineer (Unknown)

<400> 15

taatacgact cactatagga gggccacccc accatgcacc atcatcatca tcatgatgta 60

gaagcttg 68

<210> 16

<211> 69

<212> DNA

<213>engineer (Unknown)

<400> 16

gctgcagcac gtgttgacaa ttaatcatcg gcatagtata tcggcatagt ataatacgac 60

tcactatag 69

<210> 17

<211> 68

<212> DNA

<213>engineer (Unknown)

<400> 17

aggttcttga gggttgtgtt aaattgaaag cgagaaataa tcataaataa gctgcagcac 60

gtgttgac 68

<210> 18

<211> 52

<212> DNA

<213>engineer (Unknown)

<400> 18

gtctagaact agtaaaaatt gaaaataaat acaaaggttc ttgagggttg tg 52

<210> 19

<211> 68

<212> DNA

<213>engineer (Unknown)

<400> 19

ctatggcaat aattgcgaat gttttattct cttcgatata tttttggtcc tgctcctcgg 60

ccacgaag 68

<210> 20

<211> 68

<212> DNA

<213>engineer (Unknown)

<400> 20

tcgtcgactc ataaaaaaga gaatagcggt aagtataaac acgaatacta tggcaataat 60

tgcgaatg 68

<210> 21

<211> 58

<212> DNA

<213>engineer (Unknown)

<400> 21

tcgactagat ctattagttt tgtttttctc gcgaatatcg tcgactcata aaaaagag 58

<210> 22

<211> 1400

<212> DNA

<213>engineer (Unknown)

<400> 22

aaaaattgaa aataaataca aaggttcttg agggttgtgt taaattgaaa gcgagaaata 60

atcataaata actgcagcac gtgttgacaa ttaatcatcg gcatagtata tcggcatagt 120

ataatacgac tcactatagg agggccaccc accatcatca tcatcatgat gtagaagctt 180

ggttaggagc tagagtacca ttagtagaaa ctgtgagcaa gggcgaggag gataacatgg 240

ccatcatcaa ggagttcatg cgcttcaagg tgcacatgga gggctccgtg aacggccacg 300

agttcgagat cgagggcgag ggcgagggcc gcccctacga gggcacccag accgccaagc 360

tgaaggtgac caagggtggc cccctgccct tcgcctggga catcctgtcc cctcagttca 420

tgtacggctc caaggcctac gtgaagcacc ccgccgacat ccccgactac ttgaagctgt 480

ccttccccga gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggtga 540

ccgtgaccca ggactcctcc ctgcaggacg gcgagttcat ctacaaggtg aagctgcgcg 600

gcaccaactt cccctccgac ggccccgtaa tgcagaagaa gaccatgggc tgggaggcct 660

cctccgagcg gatgtacccc gaggacggcg ccctgaaggg cgagatcaag cagaggctga 720

agctgaagga cggcggccac tacgacgctg aggtcaagac cacctacaag gccaagaagc 780

ccgtgcagct gcccggcgcc tacaacgtca acatcaagtt ggacatcacc tcccacaacg 840

aggactacac catcgtggaa cagtacgaac gcgccgaggg ccgccactcc accggcggca 900

tggacgagct gtacaaggcc aagttgacca gtgccgttcc ggtgctcacc gcgcgcgacg 960

tcgccggagc ggtcgagttc tggaccgacc ggctcgggtt ctcccgggac ttcgtggagg 1020

acgacttcgc cggtgtggtc cgggacgacg tgaccctgtt catcagcgcg gtccaggacc 1080

aggtggtgcc ggacaacacc ctggcctggg tgtgggtgcg cggcctggac gagctgtacg 1140

ccgagtggtc ggaggtcgtg tccacgaact tccgggacgc ctccgggccg gccatgaccg 1200

agatcggcga gcagccgtgg gggcgggagt tcgccctgcg cgacccggcc ggcaactgcg 1260

tgcacttcgt ggccgaggag caggaccaaa aatatatcga agagaataaa acattcgcaa 1320

ttattgccat agtattcgtg tttatactta ccgctattct cttttttatg agtcgacgat 1380

attcgcgaga aaaacaaaac 1400

Claims (4)

1. a kind of vaccinia virus recombinant surface showing plasmid expression vector, which is characterized in that its nucleotide sequence such as SEQ ID Shown in No.22.Vaccinia virus H5 promoter, Escherichia coli EM7 promoter, concatenated histidine including sequentially connected modification Label, can in conjunction with the polypeptide fragment Nano-tag15 of Streptavidin, DsRed mCherry, Zeocin resistance protein, with And vaccinia virus D8 albumen transmembrane domains.The nucleotide sequence of the vaccinia virus H5 promoter of the modification such as SEQ ID No.1 institute Show, the nucleotide sequence of Escherichia coli EM7 promoter is as shown in SEQ ID No.2, the nucleotides sequence of concatenated histidine tag Column, can be in conjunction with the nucleotide sequence such as SEQ ID of the polypeptide fragment Nano-tag15 of Streptavidin as shown in SEQ ID No.3 Shown in No.4, the nucleotide sequence of DsRed mCherry is as shown in SEQ ID No.5, the nucleosides of Zeocin resistance protein Acid sequence is as shown in SEQ ID No.6, and the nucleotide sequence of vaccinia virus D8 albumen transmembrane domains is as shown in SEQ ID No.7.

2. vaccinia virus recombinant surface showing plasmid expression vector according to claim 1, which is characterized in that can also wrap It includes and is connected to the vaccinia virus D8 albumen transmembrane domains subsequent artificial synthesized vaccinia virus morning-for being used to drive destination gene expression Late promoter P-s/l and cloning site downstream.The nucleosides of artificial synthesized vaccinia virus morning-late promoter P-s/l Acid sequence is as shown in SEQ ID No.8.

3. vaccinia virus recombinant surface showing plasmid expression vector according to claim 1, which is characterized in that the series connection Histidine tag amino acid sequence as shown in SEQ ID No.9, can in conjunction with Streptavidin polypeptide fragment Nano- The amino acid sequence of tag15 is as shown in SEQ ID No.10.The amino acid sequence of DsRed mCherry such as SEQ ID Shown in No.11, the amino acid sequence of Zeocin resistance protein as shown in SEQ ID No.12, vaccinia virus D8 albumen transmembrane domains Amino acid sequence is as shown in SEQ ID No.13.

4. vaccinia virus recombinant surface showing plasmid expression vector described in a kind of claim 1 is in vaccinia virus recombinant building and again Application in group vaccinia virus separation.