CN109706177A - A kind of vaccinia virus recombinant surface display system vector plasmid and application - Google Patents
A kind of vaccinia virus recombinant surface display system vector plasmid and application Download PDFInfo
- Publication number
- CN109706177A CN109706177A CN201910069596.3A CN201910069596A CN109706177A CN 109706177 A CN109706177 A CN 109706177A CN 201910069596 A CN201910069596 A CN 201910069596A CN 109706177 A CN109706177 A CN 109706177A
- Authority
- CN
- China
- Prior art keywords
- vaccinia virus
- seq
- recombinant
- promoter
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of vaccinia virus recombinant surface display system vector plasmid and application, the expression cassette core group point of the vaccinia vectors plasmid display system includes the vaccinia virus H5 promoter of modification, Escherichia coli EM7 promoter, concatenated histidine tag, polypeptide fragment Nano-tag15, DsRed mCherry, Zeocin resistance protein, the vaccinia virus D8 albumen transmembrane domains that can combine Streptavidin.The present invention is based on the vaccinia virus recombinants of above-mentioned plasmid construction can be in outer virionic membrane surface display Nano-tag15, and take this to be captured recombinant virus by Streptavidin MagneSphere, and surface display DsRed mCherry and Zeocin resistance markers, it quickly screens vaccinia virus recombinant to be used alone or being used in combination by magnetic bead sorting, fluorescent marker tracer and the methods of selected by flow cytometry apoptosis and drug resistance and provides new powerful measure.
Description
Technical field
The present invention relates to field of biotechnology, more particularly to a kind of vaccinia virus recombinant surface display system vector plasmid
And its application.
Background technique
Vaccinia virus (vaccinia virus) is maximum, most complicated one of the virus found so far, it is prevention day
Colored virus of live vaccine.For smallpox after global eradication, vaccinia virus obtains further investigation and wide as gene engineering expression carrier
General application.Based on the virus following characteristics, so that it has been more and more widely used in field of tumor gene therapy: 1. pacifying
Complete: vaccinia virus is the DNA virus that can uniquely replicate in endochylema, it will not be integrated into host cell gene group, non-carcinogenesis
Etc. safety problems;2. expression efficiency is high: vaccinia virus can cultivate very high titre (> 109Pfu/ml), usually infection 1-3 is small
When, it is screened without any drug resistance, 90% or more infected cell can be made to express target gene product;3. infection cell model
It encloses extensively: almost all kinds of mammalian cell can be infected;4. can infection/transduction to division and non-dividing cell;⑤
Gene pool-size is big: at least can be inserted into the foreign gene of 25kb without influencing its genetic stability;6. to thermostabilization: facilitating scene
It uses and transports;7. low in cost;8. the intimate native configurations of expression product: the product that it is expressed can undergo correct glycosylation,
Post translational processing, close to native configurations, and these are vital for vaccine carrier challenge;9. generating effective
Immune response: vaccinia virus recombinant generates live virus natural infection process, makes expressed exogenous antigen together with itself viral egg
Bai Yiqi offers altogether for host MHC, can not only generate humoral immunity, moreover it is possible to which activated cell is immune, and immune response is potent, holds
Long, generally it is not required to multiple cropping.Importantly, bovine vaccine infection can provide " danger signal " to host, excitation body effectively generates needle
To the t cell immune response of carrier itself and its expressed antigen, or even body can also be excited very weak to script natural antigenicity
Immunogene (such as CEA) also generate strong immune response.
In above and other vaccinia virus correlative study and application, rate-limiting step is construction and screening recombinant vaccinia disease
Poison.Since last century the eighties vaccinia virus is used as gene engineering expression carrier for the first time and carries out correlative study, building
Main stream approach with screening vaccinia virus recombinant is always to be based on homologous recombination principle, i.e. building vaccinia virus recombinant expression first
External source target gene is placed under natural or artificial synthesized Vaccinia promoters control, by the expression cassette by vector plasmid
It is inserted among some vaccinia virus dispensable gene (the most commonly used is vaccinia virus TK genes) segment, when the Transfected Recombinant Plasmid
It is nonessential by the left and right side of target gene in recombinant plasmid in the cell when by the cell of wild type vaccinia virus infection
Homologous recombination occurs for same dispensable gene sequence in gene order and wild type vaccinia virus gene group, thus by external source purpose
Gene is inserted into the corresponding dispensable gene of vaccinia virus, completes the building of vaccinia virus recombinant.
However, the probability that above-mentioned homologous recombination generates vaccinia virus recombinant only has 0.1% if special processing is not added, because
This requires to add other processing for the screening efficiency for improving vaccinia virus recombinant.The side of classical screening vaccinia virus recombinant
Method is such as: chemical reagent 5-bromouracil deoxyribose (5-BrdU) is a kind of thymidine analog, in virus TK gene coding
It is phosphorylated under thymidine kinase catalysis and penetrates into progeny virus genomic DNA, lead to lethal effect, therefore TK gene is completely wild
Type vaccinia virus in the presence of 5-BrdU do not survive by reproducible, and in vaccinia virus recombinant, target gene is by TK gene
Insertion inactivation, therefore duplication amplification can be continued not by the lethal effects of 5-BrdU, pass through the selectivity pressure of 5-BrdU
Power, and the vaccinia virus recombinant with TK negative phenotype is mixed from the wild type vaccinia virus with TK positive phenotypes to occupy the majority
It is screened in object.However, the classical way other than step is various, needs the i.e. TK phenotype feminine gender of special cell strain
143 cell strain of TK-.In addition, 5-BrdU selection pressure is merely able to filter out the vaccinia virus of TK negative phenotype, but wild type acne
The TK gene of seedling diseases poison has the spontaneous mutation of certain frequency, also generates TK negative phenotype, and 5-BrdU screening cannot distinguish between
It, therefore 5-BrdU selection pressure is merely able to filter out the vaccinia virus of TK negative phenotype but is not necessarily exactly recombinant virus,
Including the non-recombinant virus generated because of spontaneous mutation.
Other than above-mentioned 5-BrdU pressure screening method, other classics screen the methods of vaccinia virus recombinants also: by purpose
Expression casette and certain drug resistance gene such as gpt express cassette in series, or with the enzyme gene that can act on substrate colour developing
(such as LacZ) series connection, or connect with the gene (such as GFP) for generating fluorescence, it is screened by drug resistance or enzyme colour developing is screened, or
Fluorescent screening separates vaccinia virus recombinant.However, these methods have certain limitation, as operating procedure is complicated and screening
It is inefficient etc..In addition, certain selectable marker genes such as LacZ is bigger, common restriction enzyme site can be tied up, building is caused to turn
Move the difficulty of vector plasmid.
Summary of the invention
In view of the above-mentioned deficiencies in the prior art, it is an object of the present invention to provide a kind of vaccinia virus recombinant surface display system
Vector plasmid pVTK-CZ and application.
The purpose of the present invention is achieved through the following technical solutions: a kind of vaccinia virus recombinant surface showing plasmid table
Up to carrier, its nucleotide sequence is as shown in SEQ ID No.22;Vaccinia virus H5 promoter including sequentially connected modification,
Escherichia coli EM7 promoter, concatenated histidine tag, can be in conjunction with the polypeptide fragment Nano-tag15, red glimmering of Streptavidin
Photoprotein mCherry, Zeocin resistance protein and vaccinia virus D8 albumen transmembrane domains;The vaccinia virus H5 of the modification is opened
The nucleotide sequence of mover is as shown in SEQ ID No.1, the nucleotide sequence of Escherichia coli EM7 promoter such as SEQ ID No.2
Shown, the nucleotide sequence of concatenated histidine tag, can be in conjunction with the polypeptide fragment of Streptavidin as shown in SEQ ID No.3
The nucleotide sequence of Nano-tag15 is as shown in SEQ ID No.4, the nucleotide sequence of DsRed mCherry such as SEQ ID
Shown in No.5, the nucleotide sequence of Zeocin resistance protein is as shown in SEQ ID No.6, the core of vaccinia virus D8 albumen transmembrane domains
Nucleotide sequence is as shown in SEQ ID No.7.
It further, further include that be connected to vaccinia virus D8 albumen transmembrane domains subsequent for driving destination gene expression
Artificial synthesized vaccinia virus morning-late promoter P-s/l and cloning site downstream.Artificial synthesized vaccinia virus morning-
The nucleotide sequence of late promoter P-s/l is as shown in SEQ ID No.8.
Further, the amino acid sequence of the concatenated histidine tag can combine strepto- as shown in SEQ ID No.9
The amino acid sequence of the polypeptide fragment Nano-tag15 of Avidin is as shown in SEQ ID No.10.DsRed mCherry's
Amino acid sequence is as shown in SEQ ID No.11, and the amino acid sequence of Zeocin resistance protein is as shown in SEQ ID No.12, acne
The amino acid sequence of seedling diseases poison D8 albumen transmembrane domains is as shown in SEQ ID No.13.
The invention also discloses above-mentioned vaccinia virus recombinant surface showing plasmid expression vectors to construct in vaccinia virus recombinant
Application in being separated with vaccinia virus recombinant.
The beneficial effects of the present invention are: the table of vaccinia virus recombinant surface display system vector plasmid pVTK-CZ of the present invention
Include (5 ' → 3 ') up to frame core group point: the vaccinia virus H5 promoter (mH5) of modification, Escherichia coli EM7 promoter are concatenated
Histidine tag (6 × His-tag), can be in conjunction with the polypeptide fragment Nano-tag15 of Streptavidin, DsRed
(mCherry), Zeocin resistance protein and vaccinia virus D8 albumen transmembrane domains.In addition, with above-mentioned display systems expression cassette string
Connection there are also for driving the artificial synthesized vaccinia virus morning-late promoter P-s/l and downstream of destination gene expression
Cloning site.Vaccinia virus recombinant based on above-mentioned plasmid construction can be in outer virionic membrane surface display Nano-tag15, and nationality
This is captured recombinant virus and surface display DsRed mCherry and Zeocin resistance mark by Streptavidin MagneSphere
Will object.The present invention is individually to be made by magnetic bead sorting, fluorescent marker tracer and the methods of selected by flow cytometry apoptosis and drug resistance
With or be used in combination and quickly screen vaccinia virus recombinant and provide new powerful measure.
Detailed description of the invention
Fig. 1 vaccinia virus recombinant surface display system vector plasmid pVTK-CZ map;
Fig. 2 vaccinia virus recombinant surface display system vector plasmid pVTK-CZ core component ideograph, in figure, mH5 is to repair
The vaccinia virus H5 promoter of decorations, EM7 are Escherichia coli EM7 promoter, and 6 × His is series connection histidine tag, Nano-tag15
For Streptavidin binding peptide, mCherry is DsRed, and Zeocin is Zeocin resistance protein, and D8-TMD is bovine vaccine disease
Malicious D8 albumen transmembrane domains, P-se/l are the vaccinia virus early late phase promoter of synthesis;
Fig. 3 is that ELISA detects VV-mC/Z-D8 virus surface and shows His-tag polypeptide histogram, in figure, Histag+D8
+: expression His-tag is more in the vaccinia virus recombinant VV-mC/Z-D8, Histag+D8-: coating of surface display His-tag polypeptide
The vaccinia virus recombinant VV-GFP of peptide;
Fig. 4 is the sensibility schematic diagram that vaccinia virus recombinant VV-mC/Z-D8 surface display fusion protein digests pancreatin;
In figure, VV-mC/Z-D8: VV-GFP: the vaccinia virus recombinant of surface display DsRed expresses green fluorescent protein in coating
Vaccinia virus recombinant, VV-WR: wild type vaccinia virus (WR plants).
Specific embodiment
The nucleotide sequence of vaccinia virus recombinant surface showing plasmid expression vector of the present invention as shown in SEQ ID No.22,
Its expression cassette successively includes following core component (5 ' → 3 ') and its function: the vaccinia virus H5 promoter (mH5) of modification is used for
Drive the expression of marker gene;Escherichia coli EM7 promoter, for driving external source purpose track fusion to be particularly used for
The expression of the marker gene, that is, DsRed (mCherry) and Zeocin resistance protein gene in fusion is driven, with side
Just construction of recombinant plasmid;Concatenated histidine tag (6 × His-tag), the expression for detection fusion gene;Strepto- can be combined
The polypeptide fragment Nano-tag15 of Avidin, for combining the magnetic bead of coupling Streptavidin, fast to separate recombinant vaccinia disease
Poison;DsRed (mCherry) is used for vaccinia virus recombinant tracer, flow cytometric sorting and plaque purification;Zeocin is anti-
Property albumen, be used for vaccinia virus recombinant resistance screening;And vaccinia virus D8 albumen transmembrane domains, it is used for above-mentioned all element tables
Face presenting and expressing is in vaccinia virus recombinant peplos.In addition, concatenated also for driving mesh with above-mentioned display systems expression cassette
Gene expression artificial synthesized vaccinia virus morning-late promoter P-s/l and cloning site downstream.
The core component encoding gene nucleotide sequence of the recombinant vaccinia surface display expression vector plasmid, which is respectively as follows:, to be repaired
Vaccinia virus H5 promoter (mH5) sequence of decorations is as shown in SEQ ID No.1, Escherichia coli EM7 promoter sequence such as SEQ ID
Shown in No.2, concatenated histidine tag (6 × His-tag) sequence is as shown in SEQ ID No.3, and Nano-tag15 sequence is such as
Shown in SEQ ID No.4.MCherry gene order is as shown in SEQ ID No.5, Zeocin resistance protein gene order such as SEQ
Shown in ID No.6, vaccinia virus D8 albumen transmembrane domains gene order is as shown in SEQ ID No.7.Artificial synthesized vaccinia virus
Morning-late promoter P-s/l sequence is as shown in SEQ ID No.8.
The core component amino acid sequence of the recombinant vaccinia surface display expression vector plasmid is respectively as follows: concatenated group of ammonia
Acidity scale label (6 × His-tag) sequence is as shown in SEQ ID No.9, and Nano-tag15 sequence is as shown in SEQ ID No.10.
MCherry sequence is as shown in SEQ ID No.11, and Zeocin resistance protein sequence is as shown in SEQ ID No.12, vaccinia virus D8
Albumen transmembrane domains sequence is as shown in SEQ ID No.13.
The present invention is amplified the PCR fragment comprising each core component first, is then gradually superimposed by overlapping PCR method
Extend, assemble fusion, then clones into the basic vaccinia vectors matter for including the left and right other sequencing column of vaccinia virus TK gene
Grain pVTK, specific steps are described below.
The present invention provides use pVTK-CZ plasmid construction vaccinia virus recombinant and fast screen using magnetic bead sorting method to divide
Method from vaccinia virus recombinant.
Embodiment 1: the building of recombinant plasmid pVTK-CZ
(1) PCR primer
HN-1 (SEQ ID No.14): atcatgatgtagaagcttggttaggagctagagtaccattagtagaaac
tgtgagcaagggcgaggag
HN-2 (SEQ ID No.15): taatacgactcactataggagggccaccccaccatgcaccatcatcatc
atcatgatgtagaagcttg
HN-3 (SEQ ID No.16): gctgcagcacgtgttgacaattaatcatcggcatagtatatcggcatag
tataatacgactcactatag
HN-4 (SEQ ID No.17): aggttcttgagggttgtgttaaattgaaagcgagaaataatcataaata
agctgcagcacgtgttgac
HN-5 (SEQ ID No.18): gtctagaactagtaaaaattgaaaataaatacaaaggttcttgagggtt
gtg
TMD-1 (SEQ ID No.19): ctatggcaataattgcgaatgttttattctcttcgatatatttttggt
cctgctcctcggccacgaag
TMD-2 (SEQ ID No.20): tcgtcgactcataaaaaagagaatagcggtaagtataaacacgaatac
tatggcaataattgcgaatg
TMD-3 (SEQ ID No.21): tcgactagatctattagttttgtttttctcgcgaatatcgtcgactca
taaaaaagag
(2) general PCR reaction system is as follows:
(3) PCR reaction process are as follows: 94 DEG C of initial denaturation 2min;94 DEG C of denaturation 50s, 55 DEG C of annealing 30s, 72 DEG C of extension 2min,
Repeat 30 circulations;72 DEG C of extension 10min.PCR product is taken to run 1% agarose gel electrophoresis, gel image analyser observation note
Record is as a result, purpose band gel extraction.It is recycled using plastic recovery kit (Sangon Biotech (Shanghai) Co., Ltd.)
Target gene fragment.
(4) construction step of recombinant plasmid pVTK-CZ
1) with LeGO-C/Zeo plasmid (fusion containing mCherry-Zeocin) for template, with primer HN-1 and TMD-1
And pfu enzyme makees PCR, 18 circulation of operation amplifies about 1170bp segment (segment -1), electrophoresis verifies it.
2) it is template with above-mentioned segment -1, makees PCR with primer HN-2 and TMD-2 and pfu enzyme, 18 circulation of operation amplifies
About 1266bp segment (segment -2), electrophoresis verifies it.
3) it is template with above-mentioned segment -2, makees PCR with primer HN-3 and TMD-3 and pfu enzyme, 18 circulation of operation amplifies
About 1339bp segment (segment -3), electrophoresis verifies it.
4) it is template with above-mentioned segment -3, makees PCR with primer HN-4 and TMD-3 and pfu enzyme, 18 circulation of operation amplifies
About 1389bp segment (segment -4), electrophoresis verifies it.
5) it is template with above-mentioned segment -4, makees PCR with primer HN-5 and TMD-3 and pfu enzyme, 30 circulation of operation amplifies
About 1423bp segment (segment -5), cuts glue purification.
6) carrier is carrier pVTK plasmid, -5 wine of segment are expressed with Bgl II and Spe I difference double digestion segment -5 and bovine vaccine
Smart deposition and purification, vector plasmid cut glue purification, reconnect target fragment and carrier.
7) by attachment transformed competence colibacillus bacterium, the choosing colony in the Double plate of Amp and Zeocin.Recombinant plasmid name
For pVTK-CZ
(5) identification of recombinant plasmid pVTK-CZ:
1) with after Bgl II and Spe I double digestion recombinant plasmid, 1.4kb and 4.9 two segment can be obtained.
2) recombinant bacterium red color visible fluorescence under ultraviolet light even white light.
3) Transfected Recombinant Plasmid is by 293 cells of vaccinia virus infection, it is seen that red fluorescence.
Embodiment 2: vaccinia virus recombinant building and screening
Method one: classical resistance-fluorescence plaque purification screening
It is inoculated with Vero cell in 6 orifice plates, grows its next day to 80% in flakes.Lipofectamine2000 liposome transfection
PVTK-CZ recombinant plasmid takes 4 μ g pVTK-CZ plasmids to be diluted in the DMEM culture medium of 250 μ L serum-frees, as A liquid, takes 10
μ L liposome is diluted in the DMEM culture medium of 250 μ L serum-frees, is incubated at room temperature after mixing A liquid and B liquid as B liquid
20min adds 300 μ L serum-free DMEM, mixes, and mixed liquor is added in the cell for washing 2 times through HanKs liquid, 37 DEG C, 5%
CO2After cultivating 4h in incubator, WR plants of wild type vaccinia virus of 10 μ L, 37 DEG C, 5%CO are added in every hole2Continue to be incubated for 2h in incubator
Afterwards, DMEM culture medium of the 2mL containing 2%FCS, 37 DEG C, 5%CO are added in every hole2Continue to cultivate in incubator, infection is collected after 48h
The cell of vaccinia virus, in -80 DEG C and 37 DEG C multigelation 3 times, the as infection cell lysate containing recombinant virus saves
It is spare in -80 DEG C.
Then, sieve recombinant virus 2 times blind first.It is inoculated with Vero cell in 6 orifice plates, grows to 80%- to next day cell
Culture medium is discarded when 90%, is washed twice with Hank ' s liquid, the employing virus cracking liquid generated in addition 0.2mL above-mentioned steps, 37 DEG C,
5%CO22h is cultivated in incubator and abandons supernatant, is washed twice with Hank ' s liquid, and containing 1 × gpt, (initial concentration: 400 × secondary Huang is fast for addition
Purine 10mg/ml, 40 × xanthine 10mg/ml, 670 × mould phenol 10mg/ml) and 200 μ g/mL Zeocin 2%FCS DMEM
Culture medium.Vero cell red fluorescence expression is observed under fluorescence inverted microscope, after the complete lesion of cell, collects disease
Venom.It repeats the above steps primary.
The screening of vaccinia virus recombinant plaque purification: it is inoculated with Vero cell in 6 orifice plates, grows to 80- to next day cell
Culture medium is discarded when 90%, is washed twice with Hank ' s liquid, and the 200 μ l of virus liquid being serially diluted through 10 times, 37 DEG C, 5%CO are added2
2h is cultivated in incubator, is during which then abandoned supernatant every the 15min shaking several seconds to disperse viral agglomerate, is washed two with Hank ' s liquid
Time, the DMEM culture medium for containing 1 × gpt and 200 μ g/mL Zeocin and 2%FCS is added.It is observed under fluorescence inverted microscope
Vero cell red fluorescence expression, is fixed after having typical Plaque Formation with agar.Default 45 DEG C of water-baths are spare, by concentration
For 2% low melting-point agarose (every hole needs 1.5mL) set micro-wave oven melt after, with isometric 2 × DMEM culture solution mix, set 45
DEG C water-bath is stand-by.The above-mentioned prepared every hole 2mL of agarose is carefully added into each hole, after room temperature or 4 DEG C solidify, picking expression is red
Single plaque at color fluorescence in the DMEM culture medium of 500 μ L 2%FCS, in -80 DEG C and 37 DEG C multigelation 3 times.Hereafter,
Each plaque infects a hole, remaining step is same as above, and repeats above step, until the vaccinia virus recombinant purified, name
For VV-mC/Z-D8.
Method two: magnetic bead screening method separates vaccinia virus recombinant
Following experimental procedure requires sterile working, and the product Streptavidin Magnetic of NEB company is used in experiment
Beads kit (article No.: S1420S;Content: 4mg/ml).
1, routinely (contain the Nano-tag15 with D8 protein fusion with bovine vaccine expression plasmid pVTK-CZ and related plasmids
Polypeptide) wild type vaccinia virus infection cell in 6 well culture plates of transfection, cell is collected after 48 hours, -70 DEG C/37 DEG C freeze thawing are thin
3 lytic cells of born of the same parents, the frozen-thaw lysate will contain vaccinia virus recombinant, immediately using or freeze spare.
2, magnetic bead sorting buffer: the PBS buffer solution without Ca without Mg is prepared, 0.1%BSA, 2mM EDTA, pH7.4 are contained, or
Person directlys adopt the Wash/Binding Buffer of NEB company kit
3, Beads bottles of Streptavidin Magnetic are shaken up, draws 10-30 μ L, addition has had 0.5ml sorting
The small centrifuge tube of buffer shakes after mixing 30 seconds, EP pipe is placed in magnet frame 1 minute, buffer is sucked, repeats
Step is stated to wash one time.
4, the above-mentioned frozen-thaw lysate about 0.5-1ml containing virus is transferred to a sterile EP tube, the ultrasound 3 in edta buffer liquid
It is secondary, 15 seconds every time, above-mentioned washed magnetic bead is added, slowly shakes incubation 10 minutes.
5, small centrifuge tube is placed in magnet frame 1 minute, carefully sucks supernatant, 1ml is added to sort buffer, magnetic is resuspended
Pearl repeats to place and wash after 1 minute one time in magnet frame.
6, the magnetic bead that absorption vaccinia virus recombinant has been hanged with serum-free DMEM culture solution 200ul adds in 6 orifice plates about
80% sheet of cell, 6 orifice plates bottom can place magnet frame with the infectivity of enhanced virus, cultivate 24-48 hours, observe daily
Viral index (Virus plaque or fluorescence etc.).
7, it repeats the above steps 1-2 times, until the concentration of vaccinia virus recombinant progressive, purifying.
Embodiment 3: the vaccinia virus recombinant verifying of surface display target gene
It is illustrated by taking vaccinia virus recombinant VV-mC/Z-D8 as an example below.
(1) ELISA detects VV-mC/Z-D8 virus surface and shows His-tag polypeptide
Vero cell expands vaccinia virus recombinant VV-mC/Z-D8, and making up to virus titer is 108Pfu/mL is dense with end
37 DEG C of inactivation of viruses of formalin that degree is 0.4%, pH9.6 carbonate buffer solution are resuspended, and are coated with 96 hole elisa plates, 100 μ L/
Hole, 4 DEG C overnight, and PBST is washed 3 times, and each 2min is patted dry, and the 300 μ L of PBST confining liquid containing 5%FCS, room temperature closing is added in every hole
4h, PBST are washed 3 times, and each 2min is patted dry, and the anti-His-tag of mouse that the PBST dilution (1:200) containing 0.5%FCS is added in every hole is anti-
Body (" primary antibody "), 37 DEG C of effect 2h, PBST are washed 3 times, and each 2min is patted dry, be added containing 0.5%FCS PBST dilution (1:
1000) HRP marks sheep anti-mouse igg antibody (" secondary antibody "), 100 holes μ L/, and 37 DEG C of effect 1h, PBST are washed 5 times, each 2min, bat
It is dry, the colour developing of EL-ABTS colour reagent box, microplate reader 405nm wavelength detecting.Histag+D8- is arranged in experiment to compare, that is, recombinates
Vaccinia virus expresses His-tag label, but without the outer virionic membrane surface display expression based on D8-TMD.Experimental result such as Fig. 3 institute
Show, the His-tag reading of ELISA detection VV-mC/Z-D8 virus is significantly higher than control virus (expression His-tag but non-surface exhibition
Show), prompt the fusion protein containing His-tag in VV-mC/Z-D8 virus surface presenting and expressing.
(2) sensibility that vaccinia virus recombinant VV-mC/Z-D8 surface display fusion protein digests pancreatin
Vero cell expands VV-mC/Z-D8 virus, and making up to virus titer is 108Pfu/mL takes 10 μ L virus liquids to add
Enter in EP pipe, 300 μ L pancreatin (containing 0.25% pancreatin and 0.02%EDTA) is added, 37 DEG C act on 4min, 30min respectively,
60min, 90min add 10%FCS cell culture fluid to terminate reaction, and high speed centrifugation abandons supernatant, and PBS is washed once, 580nm/610nm
Survey fluorescence intensity.And to carry the vaccinia virus recombinant of fluorescent marker but fluorescin is not showed in virus surface and compares,
As a result as shown in figure 4, the fluorescence intensity of VV-mC/Z-D8 virus extends at any time and progressive decline, and compare virus fluorescence
It is hardly influenced by pancreatin digestion, fusion protein of the strong indication containing fluorescin is showed in VV-mC/Z-D8 virus surface
Rather than inside peplos.
(3) the magnetic bead sorting experiment of hybrid virus
Contain Nano-tag15 polypeptide in the fusion protein of vaccinia virus recombinant VV-mC/Z-D8 surface display, it can be with chain
Mould Avidin high-affinity combines, and therefore, the magnetic bead that coupling has Streptavidin can be used, by VV-mC/Z-D8 virus from mixing
" capture " sorts out in solution.By identical titre (106Pfu/mL the vaccinia virus recombinant of surface display DsRed)
VV-mC/Z-D8 and the vaccinia virus recombinant vvGFP of expression green fluorescent protein (but non-surface display) are digested through 0.02%EDTA
(not having to pancreatin to digest in order to avoid destroying surface protein) combines ultrasonic treatment to disperse virion, then respectively by 1:1,1:10 and
1:100 is by red, green two kinds of virus mixing, then viral, the ginseng with the VV-mC/Z-D8 in Streptavidin MagneSphere screening hybrid virus
Streptavidin MagneSphere (article No. S1420S) product description for examining NEB company is operated.Take 30 μ L magnetic beads through Wash/
Binding Buffer is washed 2 times, and after being resuspended with 30 μ L Wash/Binding Buffer, the pipe of Xiang Shangshu 3 is equipped with hybrid virus
EP pipe in 10 μ L are respectively added, room temperature shakes 30min, mixes well, then EP pipe is placed on magnetic frame, and fixed magnetic bead is abandoned
Supernatant is removed, is washed magnetic bead 2 times with Wash/Binding Buffer, after magnetic bead is resuspended with 200 μ L DMEM culture solutions, infection Vero is thin
Born of the same parents.Hybrid virus liquid separately is prepared in above-mentioned same ratio, but handles without magnetic bead sorting but is directly infected with hybrid virus
Vero cell.Virus infection for 24 hours after, in fluorescence microscopy microscopic observation fluorescence and take pictures.The results show that target viral with
In the case of non-targeted virus 1:1 mixes, only through a magnetic bead sorting, it can almost 100% purity sub-elects target disease
Poison can also be only through a magnetic bead sorting, i.e., even if mixing (i.e. target viral only account for hybrid virus 1%) with 1:100 height
Most target virals can be sorted out.
Sequence table
<110>Zhejiang Academy of Medical Sciences
<120>a kind of vaccinia virus recombinant surface display system vector plasmid and application
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 71
<212> DNA
<213>engineer (Unknown)
<400> 1
aaaaattgaa aataaataca aaggttcttg agggttgtgt taaattgaaa gcgagaaata 60
atcataaata a 71
<210> 2
<211> 78
<212> DNA
<213>engineer (Unknown)
<400> 2
ctgcagcacg tgttgacaat taatcatcgg catagtatat cggcatagta taatacgact 60
cactatagga gggccacc 78
<210> 3
<211> 18
<212> DNA
<213>engineer (Unknown)
<400> 3
caccatcatc atcatcat 18
<210> 4
<211> 45
<212> DNA
<213>engineer (Unknown)
<400> 4
gatgtagaag cttggttagg agctagagta ccattagtag aaact 45
<210> 5
<211> 705
<212> DNA
<213>engineer (Unknown)
<400> 5
gtgagcaagg gcgaggagga taacatggcc atcatcaagg agttcatgcg cttcaaggtg 60
cacatggagg gctccgtgaa cggccacgag ttcgagatcg agggcgaggg cgagggccgc 120
ccctacgagg gcacccagac cgccaagctg aaggtgacca agggtggccc cctgcccttc 180
gcctgggaca tcctgtcccc tcagttcatg tacggctcca aggcctacgt gaagcacccc 240
gccgacatcc ccgactactt gaagctgtcc ttccccgagg gcttcaagtg ggagcgcgtg 300
atgaacttcg aggacggcgg cgtggtgacc gtgacccagg actcctccct gcaggacggc 360
gagttcatct acaaggtgaa gctgcgcggc accaacttcc cctccgacgg ccccgtaatg 420
cagaagaaga ccatgggctg ggaggcctcc tccgagcgga tgtaccccga ggacggcgcc 480
ctgaagggcg agatcaagca gaggctgaag ctgaaggacg gcggccacta cgacgctgag 540
gtcaagacca cctacaaggc caagaagccc gtgcagctgc ccggcgccta caacgtcaac 600
atcaagttgg acatcacctc ccacaacgag gactacacca tcgtggaaca gtacgaacgc 660
gccgagggcc gccactccac cggcggcatg gacgagctgt acaag 705
<210> 6
<211> 369
<212> DNA
<213>engineer (Unknown)
<400> 6
gccaagttga ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg agcggtcgag 60
ttctggaccg accggctcgg gttctcccgg gacttcgtgg aggacgactt cgccggtgtg 120
gtccgggacg acgtgaccct gttcatcagc gcggtccagg accaggtggt gccggacaac 180
accctggcct gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg gtcggaggtc 240
gtgtccacga acttccggga cgcctccggg ccggccatga ccgagatcgg cgagcagccg 300
tgggggcggg agttcgccct gcgcgacccg gccggcaact gcgtgcactt cgtggccgag 360
gagcaggac 369
<210> 7
<211> 114
<212> DNA
<213>engineer (Unknown)
<400> 7
caaaaatata tcgaagagaa taaaacattc gcaattattg ccatagtatt cgtgtttata 60
cttaccgcta ttctcttttt tatgagtcga cgatattcgc gagaaaaaca aaac 114
<210> 8
<211> 53
<212> DNA
<213>engineer (Unknown)
<400> 8
aagcttaaaa attgaaattt tatttttttt ttttggaata taaataagct cga 53
<210> 9
<211> 6
<212> PRT
<213>engineer (Unknown)
<400> 9
His His His His His His
1 5
<210> 10
<211> 15
<212> PRT
<213>engineer (Unknown)
<400> 10
Asp Val Glu Ala Trp Leu Gly Ala Arg Val Pro Leu Val Glu Thr
1 5 10 15
<210> 11
<211> 235
<212> PRT
<213>engineer (Unknown)
<400> 11
Val Ser Lys Gly Glu Glu Asp Asn Met Ala Ile Ile Lys Glu Phe Met
1 5 10 15
Arg Phe Lys Val His Met Glu Gly Ser Val Asn Gly His Glu Phe Glu
20 25 30
Ile Glu Gly Glu Gly Glu Gly Arg Pro Tyr Glu Gly Thr Gln Thr Ala
35 40 45
Lys Leu Lys Val Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile
50 55 60
Leu Ser Pro Gln Phe Met Tyr Gly Ser Lys Ala Tyr Val Lys His Pro
65 70 75 80
Ala Asp Ile Pro Asp Tyr Leu Lys Leu Ser Phe Pro Glu Gly Phe Lys
85 90 95
Trp Glu Arg Val Met Asn Phe Glu Asp Gly Gly Val Val Thr Val Thr
100 105 110
Gln Asp Ser Ser Leu Gln Asp Gly Glu Phe Ile Tyr Lys Val Lys Leu
115 120 125
Arg Gly Thr Asn Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr
130 135 140
Met Gly Trp Glu Ala Ser Ser Glu Arg Met Tyr Pro Glu Asp Gly Ala
145 150 155 160
Leu Lys Gly Glu Ile Lys Gln Arg Leu Lys Leu Lys Asp Gly Gly His
165 170 175
Tyr Asp Ala Glu Val Lys Thr Thr Tyr Lys Ala Lys Lys Pro Val Gln
180 185 190
Leu Pro Gly Ala Tyr Asn Val Asn Ile Lys Leu Asp Ile Thr Ser His
195 200 205
Asn Glu Asp Tyr Thr Ile Val Glu Gln Tyr Glu Arg Ala Glu Gly Arg
210 215 220
His Ser Thr Gly Gly Met Asp Glu Leu Tyr Lys
225 230 235
<210> 12
<211> 123
<212> PRT
<213>engineer (Unknown)
<400> 12
Ala Lys Leu Thr Ser Ala Val Pro Val Leu Thr Ala Arg Asp Val Ala
1 5 10 15
Gly Ala Val Glu Phe Trp Thr Asp Arg Leu Gly Phe Ser Arg Asp Phe
20 25 30
Val Glu Asp Asp Phe Ala Gly Val Val Arg Asp Asp Val Thr Leu Phe
35 40 45
Ile Ser Ala Val Gln Asp Gln Val Val Pro Asp Asn Thr Leu Ala Trp
50 55 60
Val Trp Val Arg Gly Leu Asp Glu Leu Tyr Ala Glu Trp Ser Glu Val
65 70 75 80
Val Ser Thr Asn Phe Arg Asp Ala Ser Gly Pro Ala Met Thr Glu Ile
85 90 95
Gly Glu Gln Pro Trp Gly Arg Glu Phe Ala Leu Arg Asp Pro Ala Gly
100 105 110
Asn Cys Val His Phe Val Ala Glu Glu Gln Asp
115 120
<210> 13
<211> 38
<212> PRT
<213>engineer (Unknown)
<400> 13
Gln Lys Tyr Ile Glu Glu Asn Lys Thr Phe Ala Ile Ile Ala Ile Val
1 5 10 15
Phe Val Phe Ile Leu Thr Ala Ile Leu Phe Phe Met Ser Arg Arg Tyr
20 25 30
Ser Arg Glu Lys Gln Asn
35
<210> 14
<211> 68
<212> DNA
<213>engineer (Unknown)
<400> 14
atcatgatgt agaagcttgg ttaggagcta gagtaccatt agtagaaact gtgagcaagg 60
gcgaggag 68
<210> 15
<211> 68
<212> DNA
<213>engineer (Unknown)
<400> 15
taatacgact cactatagga gggccacccc accatgcacc atcatcatca tcatgatgta 60
gaagcttg 68
<210> 16
<211> 69
<212> DNA
<213>engineer (Unknown)
<400> 16
gctgcagcac gtgttgacaa ttaatcatcg gcatagtata tcggcatagt ataatacgac 60
tcactatag 69
<210> 17
<211> 68
<212> DNA
<213>engineer (Unknown)
<400> 17
aggttcttga gggttgtgtt aaattgaaag cgagaaataa tcataaataa gctgcagcac 60
gtgttgac 68
<210> 18
<211> 52
<212> DNA
<213>engineer (Unknown)
<400> 18
gtctagaact agtaaaaatt gaaaataaat acaaaggttc ttgagggttg tg 52
<210> 19
<211> 68
<212> DNA
<213>engineer (Unknown)
<400> 19
ctatggcaat aattgcgaat gttttattct cttcgatata tttttggtcc tgctcctcgg 60
ccacgaag 68
<210> 20
<211> 68
<212> DNA
<213>engineer (Unknown)
<400> 20
tcgtcgactc ataaaaaaga gaatagcggt aagtataaac acgaatacta tggcaataat 60
tgcgaatg 68
<210> 21
<211> 58
<212> DNA
<213>engineer (Unknown)
<400> 21
tcgactagat ctattagttt tgtttttctc gcgaatatcg tcgactcata aaaaagag 58
<210> 22
<211> 1400
<212> DNA
<213>engineer (Unknown)
<400> 22
aaaaattgaa aataaataca aaggttcttg agggttgtgt taaattgaaa gcgagaaata 60
atcataaata actgcagcac gtgttgacaa ttaatcatcg gcatagtata tcggcatagt 120
ataatacgac tcactatagg agggccaccc accatcatca tcatcatgat gtagaagctt 180
ggttaggagc tagagtacca ttagtagaaa ctgtgagcaa gggcgaggag gataacatgg 240
ccatcatcaa ggagttcatg cgcttcaagg tgcacatgga gggctccgtg aacggccacg 300
agttcgagat cgagggcgag ggcgagggcc gcccctacga gggcacccag accgccaagc 360
tgaaggtgac caagggtggc cccctgccct tcgcctggga catcctgtcc cctcagttca 420
tgtacggctc caaggcctac gtgaagcacc ccgccgacat ccccgactac ttgaagctgt 480
ccttccccga gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggtga 540
ccgtgaccca ggactcctcc ctgcaggacg gcgagttcat ctacaaggtg aagctgcgcg 600
gcaccaactt cccctccgac ggccccgtaa tgcagaagaa gaccatgggc tgggaggcct 660
cctccgagcg gatgtacccc gaggacggcg ccctgaaggg cgagatcaag cagaggctga 720
agctgaagga cggcggccac tacgacgctg aggtcaagac cacctacaag gccaagaagc 780
ccgtgcagct gcccggcgcc tacaacgtca acatcaagtt ggacatcacc tcccacaacg 840
aggactacac catcgtggaa cagtacgaac gcgccgaggg ccgccactcc accggcggca 900
tggacgagct gtacaaggcc aagttgacca gtgccgttcc ggtgctcacc gcgcgcgacg 960
tcgccggagc ggtcgagttc tggaccgacc ggctcgggtt ctcccgggac ttcgtggagg 1020
acgacttcgc cggtgtggtc cgggacgacg tgaccctgtt catcagcgcg gtccaggacc 1080
aggtggtgcc ggacaacacc ctggcctggg tgtgggtgcg cggcctggac gagctgtacg 1140
ccgagtggtc ggaggtcgtg tccacgaact tccgggacgc ctccgggccg gccatgaccg 1200
agatcggcga gcagccgtgg gggcgggagt tcgccctgcg cgacccggcc ggcaactgcg 1260
tgcacttcgt ggccgaggag caggaccaaa aatatatcga agagaataaa acattcgcaa 1320
ttattgccat agtattcgtg tttatactta ccgctattct cttttttatg agtcgacgat 1380
attcgcgaga aaaacaaaac 1400
Claims (4)
1. a kind of vaccinia virus recombinant surface showing plasmid expression vector, which is characterized in that its nucleotide sequence such as SEQ ID
Shown in No.22.Vaccinia virus H5 promoter, Escherichia coli EM7 promoter, concatenated histidine including sequentially connected modification
Label, can in conjunction with the polypeptide fragment Nano-tag15 of Streptavidin, DsRed mCherry, Zeocin resistance protein, with
And vaccinia virus D8 albumen transmembrane domains.The nucleotide sequence of the vaccinia virus H5 promoter of the modification such as SEQ ID No.1 institute
Show, the nucleotide sequence of Escherichia coli EM7 promoter is as shown in SEQ ID No.2, the nucleotides sequence of concatenated histidine tag
Column, can be in conjunction with the nucleotide sequence such as SEQ ID of the polypeptide fragment Nano-tag15 of Streptavidin as shown in SEQ ID No.3
Shown in No.4, the nucleotide sequence of DsRed mCherry is as shown in SEQ ID No.5, the nucleosides of Zeocin resistance protein
Acid sequence is as shown in SEQ ID No.6, and the nucleotide sequence of vaccinia virus D8 albumen transmembrane domains is as shown in SEQ ID No.7.
2. vaccinia virus recombinant surface showing plasmid expression vector according to claim 1, which is characterized in that can also wrap
It includes and is connected to the vaccinia virus D8 albumen transmembrane domains subsequent artificial synthesized vaccinia virus morning-for being used to drive destination gene expression
Late promoter P-s/l and cloning site downstream.The nucleosides of artificial synthesized vaccinia virus morning-late promoter P-s/l
Acid sequence is as shown in SEQ ID No.8.
3. vaccinia virus recombinant surface showing plasmid expression vector according to claim 1, which is characterized in that the series connection
Histidine tag amino acid sequence as shown in SEQ ID No.9, can in conjunction with Streptavidin polypeptide fragment Nano-
The amino acid sequence of tag15 is as shown in SEQ ID No.10.The amino acid sequence of DsRed mCherry such as SEQ ID
Shown in No.11, the amino acid sequence of Zeocin resistance protein as shown in SEQ ID No.12, vaccinia virus D8 albumen transmembrane domains
Amino acid sequence is as shown in SEQ ID No.13.
4. vaccinia virus recombinant surface showing plasmid expression vector described in a kind of claim 1 is in vaccinia virus recombinant building and again
Application in group vaccinia virus separation.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910069596.3A CN109706177A (en) | 2019-01-24 | 2019-01-24 | A kind of vaccinia virus recombinant surface display system vector plasmid and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910069596.3A CN109706177A (en) | 2019-01-24 | 2019-01-24 | A kind of vaccinia virus recombinant surface display system vector plasmid and application |
Publications (1)
Publication Number | Publication Date |
---|---|
CN109706177A true CN109706177A (en) | 2019-05-03 |
Family
ID=66261786
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910069596.3A Pending CN109706177A (en) | 2019-01-24 | 2019-01-24 | A kind of vaccinia virus recombinant surface display system vector plasmid and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109706177A (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109069613A (en) * | 2016-04-22 | 2018-12-21 | 瓦西尼斯公司 | Integrated membrane protein on the extracellular enveloped virus particles of poxvirus is shown |
-
2019
- 2019-01-24 CN CN201910069596.3A patent/CN109706177A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109069613A (en) * | 2016-04-22 | 2018-12-21 | 瓦西尼斯公司 | Integrated membrane protein on the extracellular enveloped virus particles of poxvirus is shown |
Non-Patent Citations (2)
Title |
---|
ADDIE EMBRY ET AL.: "Enhancement of immune response to an antigen delivered by vaccinia virus by displaying the antigen on the surface of intracellular mature virion", 《VACCINE》 * |
房有荣等: "以GFP-Zeocin为筛选标志的重组痘苗病毒载体质粒的构建", 《2011年浙江省医学会医学病毒学分会、医学微生物与免疫学分会学术年会论文汇编》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113881704A (en) | Recombinant newcastle disease virus vector containing novel coronavirus double-antigen target sequence combination, corresponding vaccine strain and vaccine | |
KR20160102024A (en) | A method of making adenovirus and corresponding plasmids | |
CN107630009A (en) | It is a kind of to be attenuated blast, replicate controllable HSV recombinant viruses and preparation method and application | |
CN114891074B (en) | Seasonal influenza A universal virus-like particle and preparation method and application thereof | |
CN107190013A (en) | A kind of zika virus disease vaccine using people Ad5 replication-defective adenovirals as carrier | |
CN114258399A (en) | Protein container, polynucleotide, vector, expression cassette, cell, method for producing container, method for identifying pathogen or diagnosing disease, use of container, and diagnostic kit | |
CN110951699B (en) | Recombinant rabies virus for expressing canine distemper virus structural protein and application thereof | |
CN104130977B (en) | A kind of screening anti-tumor medicine cell model and its application | |
AU2012348332B2 (en) | Vectors harboring toxic genes, methods and uses therefor | |
CN105481984B (en) | Transposase for efficiently mediating exogenous gene integration and application thereof | |
CN114014940A (en) | Preparation method of 2019-nCoV surface protein receptor binding region fusion protein | |
Zheng et al. | Construction of a highly efficient display system for baculovirus and its application on multigene co-display | |
Sari‐Ak et al. | VLP‐factory™ and ADDomer©: Self‐assembling Virus‐Like Particle (VLP) Technologies for Multiple Protein and Peptide Epitope Display | |
JPH04500312A (en) | Self-assembling defective non-self-replicating virus particles | |
KR950001993B1 (en) | Production of specific polypeptide in virally infected insect cells | |
US8334095B2 (en) | Compositions and methods for monosynaptic transport | |
CN111925998A (en) | System for simulating SARS-CoV-2 infection and its preparation method and application | |
CN114317606A (en) | Adenovirus vector targeting human NK (natural killer) cells and application thereof | |
CN110526979A (en) | Target single-chain antibody, the Chimeric antigen receptor T cell and its preparation method and application of FAP | |
CN104293740B (en) | Recombinant baculovirus of surface display SARS bivalent antigens and its preparation method and application | |
CN109706177A (en) | A kind of vaccinia virus recombinant surface display system vector plasmid and application | |
EP0542466A2 (en) | Baculovirus transfer vectors | |
CN113061167B (en) | Rabbit hemorrhagic disease virus recombinant antigen and application thereof | |
CN110804627B (en) | Recombinant pseudorabies virus for expressing E2-crimson and preparation method and application thereof | |
CN107893081A (en) | Gene order, expression vector and the production method of a kind of people source keratin cell growth factor 2 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |