CN105481984B

CN105481984B - Transposase for efficiently mediating exogenous gene integration and application thereof

Info

Publication number: CN105481984B
Application number: CN201510880843.XA
Authority: CN
Inventors: 钱其军; 金华君; 李林芳; 吕赛群; 左明辉; 王颖; 吴红平; 吴孟超
Original assignee: Oriental Hepatobiliary Surgery Hospital Second Military Medical University Of Chinese Pla; Shanghai Cell Therapy Research Institute; Shanghai Cell Therapy Group Co Ltd
Current assignee: Oriental Hepatobiliary Surgery Hospital Second Military Medical University Of Chinese Pla; Shanghai Cell Therapy Research Institute; Shanghai Cell Therapy Group Co Ltd
Priority date: 2015-12-03
Filing date: 2015-12-03
Publication date: 2020-09-22
Anticipated expiration: 2035-12-03
Also published as: CN105481984A

Abstract

The invention belongs to the field of molecular biology, and relates to a transposase for efficiently mediating exogenous gene integration and application thereof. The transposase is a fusion protein which is fused with a human c-myc protein nuclear localization signal and can effectively guide the transposase to be aggregated in a cell nucleus. The transposase is loaded into a transposon integration system, can mediate the high-efficiency integration of exogenous genes in host cells, and can express stably and efficiently.

Description

Transposase for efficiently mediating exogenous gene integration and application thereof

Technical Field

The invention belongs to the field of molecular biology, and relates to a transposase for efficiently mediating exogenous gene integration and application thereof. The transposase is an artificial transposase, and is a fusion protein. In particular to a PiggyBac transposase fused with a human c-myc protein nuclear localization signal, which can mediate the high-efficiency integration of exogenous genes in host cells and express the exogenous genes with high efficiency and stability. The invention also relates to a nucleic acid construct, a recombinant vector and a recombinant cell containing the nucleic acid construct, and uses thereof, such as the use of transposase in transgenic T cell therapy.

Background

The expression form of the foreign gene in the host cell can be divided into transient expression and stable expression, wherein the stable expression refers to: (1) the expression of the foreign gene after transfection into eukaryotic cells and integration into the genome. The stable expression level of the recombinant gene is generally 1-2 orders of magnitude lower than that of transient expression. (2) Although the host cell is subjected to multiple passages or condition changes, the expression level of the host cell is still stable.

In view of the fact that stable expression can maintain long-term sustained expression of exogenous genes with cell division, the expression vector has important significance in ex vivo cell modification (ex vivo), such as the research of transgenic Chimeric Antigen Receptor T-cell immunotherapy (CAR-T) treatment. The CAR-T cell can specifically recognize and kill tumor cells expressing specific cell surface antigens with high efficiency, and has remarkable clinical curative effect. For example, CAR-T against CD19 can kill B cell lymphoma expressing CD19 surface antigen with high efficiency, and the effective remission rate of patients with advanced refractory B cell lymphoma reaches 90% (Maude SL, Frey N, Shaw PA, Aplenc R, Barrett DM, Bunin NJ, Chew A, Gonzalez VE, Zheng Z, Lacey SF, Mahnke YD, Melenhorst JJ, Rheinoloid SR, Shen A, Teache DT, Levine BL, June CH, Porter DL, Grupp SA. Chimeric anti-receptor T cells for refractory responses in Leukem. N Engl J Med. 2014.; 371 (16: 1507-17)).

To achieve stable expression of foreign genes in host cells, commonly used vector systems include: 1. retroviral system: can effectively infect host cells and mediate the high-efficiency integration of the genome of an exogenous gene expression frame, but has limited loading capacity and complex preparation process of recombinant virus particles. 2. Eukaryotic expression plasmid system: the preparation process is relatively simple, but the integration efficiency is extremely low when the DNA is inserted into a host genome by random DNA recombination. 3. Transposon system: the plasmid system is adopted, the preparation process is relatively simple, and the integration efficiency is relatively low by integrating the exogenous gene into the genome through the transposase.

The mammalian transposon system used in the earliest was the fish-derived "sleeping beauty" transposon (sleeping beauty), but the "sleeping beauty" transposon has the defects of excessive inhibitory effect and small carrying fragment (about 5 kb), which limits its application in the transgenic field. The piggybac (pb) transposon derived from a lepidopteran insect is currently the most active transposon in mammals. The host range is extremely wide, and the single-cell organisms to mammals can play a role; can carry large exogenous DNA fragments, and when the transposition fragment is within 14kb, the transposition efficiency is not reduced obviously. The PB transposon mainly adopts a 'cut-past' mechanism to carry out transposition, a spot (focprint) cannot be left at an in-situ point after a transposition fragment is excised, a genome can be accurately repaired after excision, and the PB transposon has an important role in application of reversible genes. In addition, the PB transposase has high plasticity, and can change the activity and action mode of the transposase and improve the targeting property of foreign gene transposition by fusing with other functional proteins or changing the functional region of the transposase. In recent years, the integration efficiency of PB in mammalian cells is further improved through codon optimization, site-specific amino acid site-directed mutation and the like, so that the system is widely applied to the fields of genome research, gene therapy, cell therapy, stem cell induction, post-induction differentiation and the like.

In the PB transposase system, PB transposase plays a central role. The PB transposon has an asymmetric Inverted Terminal Repeat (ITR) at each of its 5 'and 3' ends. When the transposition is carried out, the PB transposase carries out single-strand cutting (nick) on the T-G between the TTAA and the GGG at the tail end of the transposition segment to generate 3' -OH; the TTAA of the complementary strand is attacked by 3' -OH to form a transient hairpin structure (hairpin), and the transposition fragment is cut out; the transposition fragment forming the hairpin structure is singly cut again under the action of transposase to generate a sticky end of TTAA; finally, the TTAA attacks the target site with 3' -OH, and the target gene is inserted into the target site.

Therefore, the PB transposase functions, and the cutting and the inserting of the transposable fragments are required to be completed in the nucleus, so that the improvement of the nuclear entering opportunity of the PB transposase can help to improve the integration efficiency of the PB transposon. Research shows that the PB transposase has a natural nuclear localization signal sequence and is positioned between 551-571 amino acids at the C end of the transposase. There are researchers that fuse a nuclear localization signal sequence derived from the TAT protein of HIV virus with transposase, and can guide transposase to accumulate in the nucleus, thereby improving integration efficiency (Adv Drug Deliv Rev.2005,57(4): 559-77; PLoS one.2014,9(2): e 89396). However, HIV-TAT is a protein derived from viruses, which would increase the immunogenicity of the fusion protein and is not suitable for in vivo applications in humans.

Disclosure of Invention

The inventors have conducted a great deal of experiments and creative work to construct a transposase that can efficiently enter the nucleus. The transposase fuses with a human c-myc protein nuclear localization signal and can effectively guide the transposase to gather in a cell nucleus. The transposase is loaded into a transposon integration system, and can mediate the high-efficiency integration and stable expression of exogenous genes (including but not limited to CAR19, GM-CSF, EGFP, luc luciferase and the like) in host cells. The inventors have surprisingly found that the use of this transposase system mediates high expression of foreign genes, in one embodiment of the invention, the expression intensity is approximately 29 times higher than that of the recombinant lentiviral system. The following invention is thus provided:

one aspect of the invention relates to a fusion protein comprising the amino acid sequence of a transposase and the amino acid sequence of a nuclear localization signal of human origin.

The fusion protein according to any one of the present invention, characterized by any one or more of the following items (1) to (4):

(1) the fusion protein is an artificial transposase;

(2) the transposase has one or more copies (e.g., 2, 3, 4, or 5 copies) of the amino acid sequence, and/or the human nuclear localization signal has one or more copies (e.g., 2, 3, 4, or 5 copies);

(3) one or more protein linkers (e.g., 2, 3, 4, or 5 protein linkers) are linked between the amino acid sequence of the transposase and the human nuclear localization signal; preferably, the protein linker is one or more glycines (e.g. 2, 3, 4 or 5 glycines) and/or one or more alanines (e.g. 2, 3, 4 or 5 alanines);

(4) the human nuclear localization signal is located upstream or downstream, preferably upstream, of the transposase.

The fusion protein of any one of the invention, wherein the transposase is a PB transposase and/or the human-derived nuclear localization signal is a human c-myc nuclear localization signal.

The fusion protein of any one of the invention, wherein the amino acid sequence of the PB transposase is shown as SEQ ID NO. 24, and/or the amino acid sequence of the human c-myc nuclear localization signal is shown as SEQ ID NO. 20 or SEQ ID NO. 22.

The fusion protein of any one of the present invention has the amino acid sequence shown in SEQ ID No. 25.

Another aspect of the invention relates to a nucleic acid construct encoding a fusion protein according to any of the invention, or comprising a nucleic acid sequence encoding a fusion protein according to any of the invention.

The nucleic acid construct according to any of the invention, wherein the nucleic acid sequence encoding the PB transposase is as shown in SEQ ID NO. 23 and/or the nucleic acid sequence encoding the human c-myc nuclear localization signal is as shown in SEQ ID NO. 19 or SEQ ID NO. 21; preferably, the amino acid sequence of the nucleic acid construct is shown as SEQ ID NO. 5. Preferably, the nucleotide encoding the protein linker is GGC.

Yet another aspect of the present invention relates to a recombinant vector comprising the nucleic acid construct according to any one of the present invention;

specifically, the recombinant vector is a recombinant cloning vector, a recombinant eukaryotic expression plasmid or a recombinant virus vector;

specifically, the recombinant cloning vector is a recombinant vector obtained by recombining the nucleic acid construct of any one of the invention with pUC18, pUC19, pMD18-T, pMD19-T, pGM-T vector, pUC57, pMAX or pDC315 series vectors;

specifically, the recombinant expression vector is a recombinant vector obtained by recombining the nucleic acid construct of any one of the invention with a pCDNA3 series vector, a pCDNA4 series vector, a pCDNA5 series vector, a pCDNA6 series vector, a pRL series vector, a pUC57 vector, a pMAX vector or a pDC315 series vector;

specifically, the recombinant viral vector is a recombinant adenovirus vector, a recombinant adeno-associated virus vector, a recombinant retrovirus vector, a recombinant herpes simplex virus vector or a recombinant vaccinia virus vector.

Yet another aspect of the invention relates to a recombinant host cell comprising a nucleic acid construct according to any of the invention or a recombinant vector according to the invention; in particular, the recombinant host cell is a recombinant mammalian cell; for example recombinant primary cultured T cells, Jurkat cells, K562 cells, embryonic stem cells, tumor cells, HEK293 cells or CHO cells.

Yet another aspect of the present invention relates to the use of a fusion protein according to any of the present invention, a nucleic acid construct according to any of the present invention, a recombinant vector according to any of the present invention, or a recombinant host cell according to the present invention, selected from any of (1) to (4) as follows:

(1) use in the preparation of, or as a medicament or agent for integrating a foreign gene expression cassette into the genome of a host cell; in particular, the host cell is a mammalian cell, such as a primary culture T cell, Jurkat cell, K562 cell, embryonic stem cell, tumor cell or HEK293 cell or CHO cell;

(2) use in the preparation or as a means for integrating a foreign gene expression cassette into the genome of a host cell; in particular, the host cell is a mammalian cell, such as a primary culture T cell, Jurkat cell, K562 cell, embryonic stem cell, tumor cell, HEK293 cell, or CHO cell;

(3) use in the preparation or as a medicament or formulation for genomic research, gene therapy, cell therapy or stem cell induction and differentiation following induction;

(4) use in the preparation or as a tool for genomic research, gene therapy, cell therapy or stem cell induction and differentiation following induction.

The above use can be achieved by inserting a foreign gene having a corresponding function, which has a function corresponding to a specific use, such as a therapeutic function or an inducing function.

Yet another aspect of the invention relates to methods of introducing the nucleic acid constructs or recombinant vectors of the invention into mammalian cells, including virus-mediated transformation, microinjection, particle bombardment, biolistic transformation, electroporation, and the like. In one embodiment of the invention, the method is electroporation.

Some terms related to the present invention are explained below.

In the present invention, the term "expression cassette" refers to the complete elements required for expression of a gene, including the promoter, gene coding sequence, PolyA tailed signal sequence.

The term "nucleic acid construct", defined herein as a single-or double-stranded nucleic acid molecule, preferably refers to an artificially constructed nucleic acid molecule. Optionally, the nucleic acid construct further comprises operably linked 1 or more control sequences capable of directing the expression of the coding sequence in a suitable host cell under conditions compatible therewith. Expression is understood to include any step involved in the production of a protein or polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

The term "operably inserted/linked" is defined herein as a conformation in which a control sequence is located at an appropriate position relative to the coding sequence of the DNA sequence such that the control sequence directs the expression of a protein or polypeptide. In the nucleic acid construct of the present invention, for example, a promoter of a foreign gene and a coding sequence of the foreign gene are placed at the multiple cloning site by a DNA recombination technique. Said "operably linked" may be achieved by means of DNA recombination, in particular, the nucleic acid construct is a recombinant nucleic acid construct.

The term "coding sequence" is defined herein as that portion of a nucleic acid sequence which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by a ribosome binding site immediately upstream of the 5 'open reading frame of the mRNA (for prokaryotic cells) and a transcription termination sequence immediately downstream of the 3' open reading frame of the mRNA. A coding sequence can include, but is not limited to, DNA, cDNA, and recombinant nucleic acid sequences.

The term "regulatory sequence" is defined herein to include all components necessary or advantageous for expression of the peptides of the invention. Each control sequence may be native or foreign to the nucleic acid sequence encoding the protein or polypeptide. These regulatory sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. In order to introduce specific restriction sites for linking the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein or polypeptide, regulatory sequences with linkers may be provided.

The control sequence may be an appropriate promoter sequence, a nucleic acid sequence which is recognized by a host cell in which the nucleic acid sequence is expressed. The promoter sequence contains transcriptional regulatory sequences that mediate the expression of the protein or polypeptide. The promoter may be any nucleic acid sequence which is transcriptionally active in the host cell of choice, including mutant, truncated, and hybrid promoters, and may be derived from genes encoding extracellular or intracellular protein or polypeptide polypeptides either homologous or heterologous to the host cell.

The control sequence may also be a suitable transcription termination sequence, i.e., a sequence recognized by a host cell to terminate transcription. The termination sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the protein or polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence that functions in the host cell of choice may be used in the present invention.

The control sequence may also be a signal peptide coding region, which codes for an amino acid sequence linked to the amino terminus of a protein or polypeptide and which directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding region of the nucleic acid sequence may naturally contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding region may contain a signal peptide coding region which is foreign to the coding sequence. Where the coding sequence does not normally contain a signal peptide coding region, it may be desirable to add a foreign signal peptide coding region. Alternatively, the native signal peptide coding region may simply be replaced by a foreign signal peptide coding region in order to enhance polypeptide secretion. However, any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of interest may be used in the present invention.

The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resulting polypeptide is referred to as a proenzyme or propolypeptide. A propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.

Where the polypeptide has both a signal peptide and a propeptide region at the amino terminus, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.

It may also be desirable to add regulatory sequences which regulate the expression of the polypeptide depending on the growth of the host cell. Examples of regulatory systems are those that respond to a chemical or physical stimulus, including in the presence of a regulatory compound, to open or close gene expression. Other examples of regulatory sequences are those which enable gene amplification. In these instances, the nucleic acid sequence encoding the protein or polypeptide should be operably linked to the control sequence.

Advantageous effects of the invention

A transposase which can efficiently enter a cell nucleus is constructed. The transposase fuses with a human c-myc protein nuclear localization signal and can effectively guide the transposase to gather in a cell nucleus. The transposase is loaded into a transposon integration system, can efficiently mediate the integration of exogenous foreign genes in host cells, and can efficiently and stably express.

Drawings

FIG. 1 map of pNB vector.

FIG. 2 is a subcellular localization map of c-myc-PB fusion transposase. FIG. 2A is a Jurkat cell transfected with a plasmid pcDNA3.1-cPB. FIG. 2B is a Jurkat cell transfected with pcDNA3.1-PB control plasmid.

FIG. 3: time curve for EGFP-positive cell proportion after transfection of Jurkat cells with pN 328-EGFP.

FIG. 4 fluorescent detection of pNB328-EGFP transfected 4 cells. FIGS. 4A-4B are Jurkat cells, FIGS. 4C-4D are K562 cells, FIGS. 4E-4F are primary T cells, and FIGS. 4G-4H are mouse embryonic stem cells (ES). 4A, 4C, 4E, and 4G on the left are photographs taken under white light to show cell morphology; the right panels 4B, 4D, 4F, 4H were photographed under fluorescence and showed green fluorescence. The field of view taken by the left and right images was the same for the same cell.

FIG. 5 flow-cytometry map of pNB328-EGFP transfected Jurkat cells (5A), K562 cells (5B), primary T cells (5C), mouse ES cells (5D).

FIG. 6: luciferase assay of pNB328-luc transfected Huh7 cells.

FIG. 7: and (3) comparing the integration efficiency of the PB containing the c-myc nuclear localization signal and the PB mediated EGFP expression box containing the TAT nuclear localization signal.

FIG. 8: and (3) a detection diagram of fluorescence expression intensity of EGFP gene expression after pNB328-EGFP transfection of primary T cells. 8A, 8C are photographs taken under white light, showing cell morphology; 8B, 8D are pictures taken under fluorescence, showing green fluorescence.

FIG. 9: integration site analysis after transfection of primary T cells with pNB 328-EGFP. The circle labeled part is the integration hotspot. 9A,9B and 9C, which respectively represent the primary T cell integration site detection of 3 normal persons from different sources. Triangles indicate that the integration site belongs to an intergenic segment, arrows indicate that the integration site belongs to an intragenic segment, and circles indicate integration hotspots.

FIG. 10: graph of killing of Raji cells after transfection of primary T cells with pNB328-CAR 19.

Sequence information:

sequence 1(SEQ ID NO:1, 67bp), PiggyBac transposon 5' terminal repeat sequence

TTAACCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGCGTAAAATTGACGCATG

Sequence 2(SEQ ID NO:2, 51bp), polyclonal insertion site

TCTAGAGTCGAATTCTGAGCTAGCGATGGATCCTGCACTAGTGCTGTCGAC

Sequence 3(SEQ ID NO:3, 222bp), polyA tailed signal sequence

CAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTA

Sequence 4(SEQ ID NO:4, 40bp), PiggyBac transposon 3' terminal repeat sequence

GCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAA

Sequence 5(SEQ ID NO:5, 1815bp), piggyBac transposase coding sequence containing human c-myc nuclear localization signal coding sequence, wherein the underline is human c-myc nuclear localization signal coding sequence.

ATG

CCTGCTGCCAAGAGGGTCAAGTTGGACGGCAGCAGCCTGGACGACGAGCACATCCTGAGCGCCCTGCTGCAGAGCGACGACGAGCTGGTGGGCGAGGACAGCGACAGCGAGGTGAGCGACCACGTGAGCGAGGACGACGTGCAGAGCGACACCGAGGAGGCCTTCATCGACGAGGTGCACGAGGTGCAGCCCACCAGCAGCGGCAGCGAGATCCTGGACGAGCAGAACGTGATCGAGCAGCCCGGCAGCAGCCTGGCCAGCAACCGCATCCTGACCCTGCCCCAGCGCACCATCCGCGGCAAGAACAAGCACTGCTGGAGCACCAGCAAGCCCACCCGCCGCAGCCGCGTGAGCGCCCTGAACATCGTGCGCAGCCAGCGCGGCCCCACCCGCATGTGCCGCAACATCTACGACCCCCTGCTGTGCTTCAAGCTGTTCTTCACCGACGAGATCATCAGCGAGATCGTGAAGTGGACCAACGCCGAGATCAGCCTGAAGCGCCGCGAGAGCATGACCAGCGCCACCTTCCGCGACACCAACGAGGACGAGATCTACGCCTTCTTCGGCATCCTGGTGATGACCGCCGTGCGCAAGGACAACCACATGAGCACCGACGACCTGTTCGACCGCAGCCTGAGCATGGTGTACGTGAGCGTGATGAGCCGCGACCGCTTCGACTTCCTGATCCGCTGCCTGCGCATGGACGACAAGAGCATCCGCCCCACCCTGCGCGAGAACGACGTGTTCACCCCCGTGCGCAAGATCTGGGACCTGTTCATCCACCAGTGCATCCAGAACTACACCCCCGGCGCCCACCTGACCATCGACGAGCAGCTGCTGGGCTTCCGCGGCCGCTGCCCCTTCCGCGTGTACATCCCCAACAAGCCCAGCAAGTACGGCATCAAGATCCTGATGATGTGCGACAGCGGCACCAAGTACATGATCAACGGCATGCCCTACCTGGGCCGCGGCACCCAGACCAACGGCGTGCCCCTGGGCGAGTACTACGTGAAGGAGCTGAGCAAGCCCGTGCACGGCAGCTGCCGCAACATCACCTGCGACAACTGGTTCACCAGCATCCCCCTGGCCAAGAACCTGCTGCAGGAGCCCTACAAGCTGACCATCGTGGGCACCGTGCGCAGCAACAAGCGCGAGATCCCCGAGGTGCTGAAGAACAGCCGCAGCCGCCCCGTGGGCACCAGCATGTTCTGCTTCGACGGCCCCCTGACCCTGGTGAGCTACAAGCCCAAGCCCGCCAAGATGGTGTACCTGCTGAGCAGCTGCGACGAGGACGCCAGCATCAACGAGAGCACCGGCAAGCCCCAGATGGTGATGTACTACAACCAGACCAAGGGCGGCGTGGACACCCTGGACCAGATGTGCAGCGTGATGACCTGCAGCCGCAAGACCAACCGCTGGCCCATGGCCCTGCTGTACGGCATGATCAACATCGCCTGCATCAACAGCTTCATCATCTACAGCCACAACGTGAGCAGCAAGGGCGAGAAGGTGCAGAGCCGCAAGAAGTTCATGCGCAACCTGTACATGGGCCTGACCAGCAGCTTCATGCGCAAGCGCCTGGAGGCCCCCACCCTGAAGCGCTACCTGCGCGACAACATCAGCAACATCCTGCCCAAGGAGGTGCCCGGCACCAGCGACGACAGCACCGAGGAGCCCGTGATGAAGAAGCGCACCTACTGCACCTACTGCCCCAGCAAGATCCGCCGCAAGGCCAGCGCCAGCTGCAAGAAGTGCAAGAAGGTGATCTGCCGCGAGCACAACATCGACATGTGCCAGAGCTGCTTCTAA

Sequence 6(SEQ ID NO:6, 531bp), CMV promoter

ATATACTGAGTCATTAGGGACTTTCCAATGGGTTTTGCCCAGTACATAAGGTCAATAGGGGTGAATCAACAGGAAAGTCCCATTGGAGCCAAGTACACTGAGTCAATAGGGACTTTCCATTGGGTTTTGCCCAGTACAAAAGGTCAATAGGGGGTGAGTCAATGGGTTTTTCCCATTATTGGCACGTACATAAGGTCAATAGGGGTGAGTCATTGGGTTTTTCCAGCCATTAAATTAAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTATTGAAACTAATGCAACGTGACCTTTAAACGGTACTTTCCCATAGCTGATTAATGGGAAAGTACCGTTCTCGAGCCAATACACGTCAATGGGAAGTGAAAGGGCAGCCAAAACGTAACACCGCCCCGGTTTTCCCCTGGAAATTCCATATTGGCACTCATTCTATTGGCTGAGCTGCGTTCTACGTGGGTATAAGAGGCGCGACCAGCGTCGGTACCGTCGCAGTCTTCGGTCTGACCACCGTAGAACGCAGATC

SEQ ID NO:7 (2760 bp) sequence, a long sequence spliced as described in example 1

GGCGCGCCTTAACCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGCGTAAAATTGACGCATGTCTAGAGTCGAATTCTGAGCTAGCGATGGATCCTGCACTAGTGCTGTCGACCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAAATCGATTTAGAAGCAGCTCTGGCACATGTCGATGTTGTGCTCGCGGCAGATCACCTTCTTGCACTTCTTGCAGCTGGCGCTGGCCTTGCGGCGGATCTTGCTGGGGCAGTAGGTGCAGTAGGTGCGCTTCTTCATCACGGGCTCCTCGGTGCTGTCGTCGCTGGTGCCGGGCACCTCCTTGGGCAGGATGTTGCTGATGTTGTCGCGCAGGTAGCGCTTCAGGGTGGGGGCCTCCAGGCGCTTGCGCATGAAGCTGCTGGTCAGGCCCATGTACAGGTTGCGCATGAACTTCTTGCGGCTCTGCACCTTCTCGCCCTTGCTGCTCACGTTGTGGCTGTAGATGATGAAGCTGTTGATGCAGGCGATGTTGATCATGCCGTACAGCAGGGCCATGGGCCAGCGGTTGGTCTTGCGGCTGCAGGTCATCACGCTGCACATCTGGTCCAGGGTGTCCACGCCGCCCTTGGTCTGGTTGTAGTACATCACCATCTGGGGCTTGCCGGTGCTCTCGTTGATGCTGGCGTCCTCGTCGCAGCTGCTCAGCAGGTACACCATCTTGGCGGGCTTGGGCTTGTAGCTCACCAGGGTCAGGGGGCCGTCGAAGCAGAACATGCTGGTGCCCACGGGGCGGCTGCGGCTGTTCTTCAGCACCTCGGGGATCTCGCGCTTGTTGCTGCGCACGGTGCCCACGATGGTCAGCTTGTAGGGCTCCTGCAGCAGGTTCTTGGCCAGGGGGATGCTGGTGAACCAGTTGTCGCAGGTGATGTTGCGGCAGCTGCCGTGCACGGGCTTGCTCAGCTCCTTCACGTAGTACTCGCCCAGGGGCACGCCGTTGGTCTGGGTGCCGCGGCCCAGGTAGGGCATGCCGTTGATCATGTACTTGGTGCCGCTGTCGCACATCATCAGGATCTTGATGCCGTACTTGCTGGGCTTGTTGGGGATGTACACGCGGAAGGGGCAGCGGCCGCGGAAGCCCAGCAGCTGCTCGTCGATGGTCAGGTGGGCGCCGGGGGTGTAGTTCTGGATGCACTGGTGGATGAACAGGTCCCAGATCTTGCGCACGGGGGTGAACACGTCGTTCTCGCGCAGGGTGGGGCGGATGCTCTTGTCGTCCATGCGCAGGCAGCGGATCAGGAAGTCGAAGCGGTCGCGGCTCATCACGCTCACGTACACCATGCTCAGGCTGCGGTCGAACAGGTCGTCGGTGCTCATGTGGTTGTCCTTGCGCACGGCGGTCATCACCAGGATGCCGAAGAAGGCGTAGATCTCGTCCTCGTTGGTGTCGCGGAAGGTGGCGCTGGTCATGCTCTCGCGGCGCTTCAGGCTGATCTCGGCGTTGGTCCACTTCACGATCTCGCTGATGATCTCGTCGGTGAAGAACAGCTTGAAGCACAGCAGGGGGTCGTAGATGTTGCGGCACATGCGGGTGGGGCCGCGCTGGCTGCGCACGATGTTCAGGGCGCTCACGCGGCTGCGGCGGGTGGGCTTGCTGGTGCTCCAGCAGTGCTTGTTCTTGCCGCGGATGGTGCGCTGGGGCAGGGTCAGGATGCGGTTGCTGGCCAGGCTGCTGCCGGGCTGCTCGATCACGTTCTGCTCGTCCAGGATCTCGCTGCCGCTGCTGGTGGGCTGCACCTCGTGCACCTCGTCGATGAAGGCCTCCTCGGTGTCGCTCTGCACGTCGTCCTCGCTCACGTGGTCGCTCACCTCGCTGTCGCTGTCCTCGCCCACCAGCTCGTCGTCGCTCTGCAGCAGGGCGCTCAGGATGTGCTCGTCGTCCAGGCTGCTGCCGTCCAACTTGACCCTCTTGGCAGCAGGGCCCATGGTGGCAAGCTTGATCTGCGTTCTACGGTGGTCAGACCGAAGACTGCGACGGTACCGACGCTGGTCGCGCCTCTTATACCCACGTAGAACGCAGCTCAGCCAATAGAATGAGTGCCAATATGGAATTTCCAGGGGAAAACCGGGGCGGTGTTACGTTTTGGCTGCCCTTTCACTTCCCATTGACGTGTATTGGCTCGAGAACGGTACTTTCCCATTAATCAGCTATGGGAAAGTACCGTTTAAAGGTCACGTTGCATTAGTTTCAATAGCCCATTGACGTCAATGGTGGGAAAGTACATGGCGTTTTAATTTAATGGCTGGAAAAACCCAATGACTCACCCCTATTGACCTTATGTACGTGCCAATAATGGGAAAAACCCATTGACTCACCCCCTATTGACCTTTTGTACTGGGCAAAACCCAATGGAAAGTCCCTATTGACTCAGTGTACTTGGCTCCAATGGGACTTTCCTGTTGATTCACCCCTATTGACCTTATGTACTGGGCAAAACCCATTGGAAAGTCCCTAATGACTCAGTATATTTAATTAA

Sequence 8(SEQ ID NO:8, 545bp), EF1 alpha promoter sequence

AGGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACGGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTGAAGCTTCGAGGGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCCGGCGCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTCTTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATCCAAGCTGTGACCGGCGCCTAC

Sequence 9(SEQ ID NO:9, 720bp), EGFP coding sequence

ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

Sequence 10(SEQ ID NO:10, 936bp), Luc luciferase coding sequence

ATGACTTCGAAAGTTTATGATCCAGAACAAAGGAAACGGATGATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGGCCTGATATTGAAGAAGATATTGCGTTGATCAAATCTGAAGAAGGAGAAAAAATGGTTTTGGAGAATAACTTCTTCGTGGAAACCATGTTGCCATCAAAAATCATGAGAAAGTTAGAACCAGAAGAATTTGCAGCATATCTTGAACCATTCAAAGAGAAAGGTGAAGTTCGTCGTCCAACATTATCATGGCCTCGTGAAATCCCGTTAGTAAAAGGTGGTAAACCTGACGTTGTACAAATTGTTAGGAATTATAATGCTTATCTACGTGCAAGTGATGATTTACCAAAAATGTTTATTGAATCGGACCCAGGATTCTTTTCCAATGCTATTGTTGAAGGTGCCAAGAAGTTTCCTAATACTGAATTTGTCAAAGTAAAAGGTCTTCATTTTTCGCAAGAAGATGCACCTGATGAAATGGGAAAATATATCAAATCGTTCGTTGAGCGAGTTCTCAAAAATGAACAATAA

Sequence 11(SEQ ID NO:11, 435bp), GM-CSF gene coding sequence

ATGTGGCTGCAGAGCCTGCTGCTCTTGGGCACTGTGGCCTGCAGCATCTCTGCACCCGCCCGCTCGCCCAGCCCCAGCACGCAGCCCTGGGAGCATGTGAATGCCATCCAGGAGGCCCGGCGTCTCCTGAACCTGAGTAGAGACACTGCTGCTGAGATGAATGAAACAGTAGAAGTCATCTCAGAAATGTTTGACCTCCAGGAGCCGACCTGCCTACAGACCCGCCTGGAGCTGTACAAGCAGGGCCTGCGGGGCAGCCTCACCAAGCTCAAGGGCCCCTTGACCATGATGGCCAGCCACTACAAGCAGCACTGCCCTCCAACCCCGGAAACTTCCTGTGCAACCCAGATTATCACCTTTGAAAGTTTCAAAGAGAACCTGAAGGACTTTCTGCTTGTCATCCCCTTTGACTGCTGGGAGCCAGTCCAGGAGTGA

Sequence 12(SEQ ID NO:12, 20bp), primer PB-F

GCGACAACATCAGCAACATC

Sequence 13(SEQ ID NO:13, 20bp), primer PB-R

CTTCTTCATCACGGGCTCCT

Sequence 14(SEQ ID NO:14, 17bp), primer Actin-F

GTTGTCGACGACGAGCG

Sequence 15(SEQ ID NO:15, 17bp), primer Actin-R

GCACAGAGCCTCGCCTT

Sequence 16(SEQ ID NO:16, 1542bp), CAR19 coding sequence

ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCGAGCGACATCCAGATGACACAGACTACATCCTCCCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCATACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTGCCAACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAACAGGCTCCACCTCTGGATCCGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGCGAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTGTAAGCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTAGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGACTGACCATCATCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCGGCCGCATTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGATATCTACATCTGGGCGCCCCTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGCAACCACAGGAACCGTTTCTCTGTTGTTAAACGGGGCAGAAAGAAGCTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTGATAA

Sequence 17(SEQ ID NO:17, 1833bp), coding sequence of myc-His-PB fusion protein

ATGGGCCCTGCTGCCAAGAGGGTCAAGTTGGACcatcatcaccatcaccatGGCAGCAGCCTGGACGACGAGCACATCCTGAGCGCCCTGCTGCAGAGCGACGACGAGCTGGTGGGCGAGGACAGCGACAGCGAGGTGAGCGACCACGTGAGCGAGGACGACGTGCAGAGCGACACCGAGGAGGCCTTCATCGACGAGGTGCACGAGGTGCAGCCCACCAGCAGCGGCAGCGAGATCCTGGACGAGCAGAACGTGATCGAGCAGCCCGGCAGCAGCCTGGCCAGCAACCGCATCCTGACCCTGCCCCAGCGCACCATCCGCGGCAAGAACAAGCACTGCTGGAGCACCAGCAAGCCCACCCGCCGCAGCCGCGTGAGCGCCCTGAACATCGTGCGCAGCCAGCGCGGCCCCACCCGCATGTGCCGCAACATCTACGACCCCCTGCTGTGCTTCAAGCTGTTCTTCACCGACGAGATCATCAGCGAGATCGTGAAGTGGACCAACGCCGAGATCAGCCTGAAGCGCCGCGAGAGCATGACCAGCGCCACCTTCCGCGACACCAACGAGGACGAGATCTACGCCTTCTTCGGCATCCTGGTGATGACCGCCGTGCGCAAGGACAACCACATGAGCACCGACGACCTGTTCGACCGCAGCCTGAGCATGGTGTACGTGAGCGTGATGAGCCGCGACCGCTTCGACTTCCTGATCCGCTGCCTGCGCATGGACGACAAGAGCATCCGCCCCACCCTGCGCGAGAACGACGTGTTCACCCCCGTGCGCAAGATCTGGGACCTGTTCATCCACCAGTGCATCCAGAACTACACCCCCGGCGCCCACCTGACCATCGACGAGCAGCTGCTGGGCTTCCGCGGCCGCTGCCCCTTCCGCGTGTACATCCCCAACAAGCCCAGCAAGTACGGCATCAAGATCCTGATGATGTGCGACAGCGGCACCAAGTACATGATCAACGGCATGCCCTACCTGGGCCGCGGCACCCAGACCAACGGCGTGCCCCTGGGCGAGTACTACGTGAAGGAGCTGAGCAAGCCCGTGCACGGCAGCTGCCGCAACATCACCTGCGACAACTGGTTCACCAGCATCCCCCTGGCCAAGAACCTGCTGCAGGAGCCCTACAAGCTGACCATCGTGGGCACCGTGCGCAGCAACAAGCGCGAGATCCCCGAGGTGCTGAAGAACAGCCGCAGCCGCCCCGTGGGCACCAGCATGTTCTGCTTCGACGGCCCCCTGACCCTGGTGAGCTACAAGCCCAAGCCCGCCAAGATGGTGTACCTGCTGAGCAGCTGCGACGAGGACGCCAGCATCAACGAGAGCACCGGCAAGCCCCAGATGGTGATGTACTACAACCAGACCAAGGGCGGCGTGGACACCCTGGACCAGATGTGCAGCGTGATGACCTGCAGCCGCAAGACCAACCGCTGGCCCATGGCCCTGCTGTACGGCATGATCAACATCGCCTGCATCAACAGCTTCATCATCTACAGCCACAACGTGAGCAGCAAGGGCGAGAAGGTGCAGAGCCGCAAGAAGTTCATGCGCAACCTGTACATGGGCCTGACCAGCAGCTTCATGCGCAAGCGCCTGGAGGCCCCCACCCTGAAGCGCTACCTGCGCGACAACATCAGCAACATCCTGCCCAAGGAGGTGCCCGGCACCAGCGACGACAGCACCGAGGAGCCCGTGATGAAGAAGCGCACCTACTGCACCTACTGCCCCAGCAAGATCCGCCGCAAGGCCAGCGCCAGCTGCAAGAAGTGCAAGAAGGTGATCTGCCGCGAGCACAACATCGACATGTGCCAGAGCTGCTTCTAA

In sequence 17 above, the c-myc nuclear localization signal sequence is underlined, the lower case portion is the 6 × His tag coding sequence followed by the PiggyBac transposase coding sequence.

Sequence 18(SEQ ID NO:18, 1806bp), His-PB fusion protein coding sequence

ATGGGCcatcatcaccatcaccatGGCAGCAGCCTGGACGACGAGCACATCCTGAGCGCCCTGCTGCAGAGCGACGACGAGCTGGTGGGCGAGGACAGCGACAGCGAGGTGAGCGACCACGTGAGCGAGGACGACGTGCAGAGCGACACCGAGGAGGCCTTCATCGACGAGGTGCACGAGGTGCAGCCCACCAGCAGCGGCAGCGAGATCCTGGACGAGCAGAACGTGATCGAGCAGCCCGGCAGCAGCCTGGCCAGCAACCGCATCCTGACCCTGCCCCAGCGCACCATCCGCGGCAAGAACAAGCACTGCTGGAGCACCAGCAAGCCCACCCGCCGCAGCCGCGTGAGCGCCCTGAACATCGTGCGCAGCCAGCGCGGCCCCACCCGCATGTGCCGCAACATCTACGACCCCCTGCTGTGCTTCAAGCTGTTCTTCACCGACGAGATCATCAGCGAGATCGTGAAGTGGACCAACGCCGAGATCAGCCTGAAGCGCCGCGAGAGCATGACCAGCGCCACCTTCCGCGACACCAACGAGGACGAGATCTACGCCTTCTTCGGCATCCTGGTGATGACCGCCGTGCGCAAGGACAACCACATGAGCACCGACGACCTGTTCGACCGCAGCCTGAGCATGGTGTACGTGAGCGTGATGAGCCGCGACCGCTTCGACTTCCTGATCCGCTGCCTGCGCATGGACGACAAGAGCATCCGCCCCACCCTGCGCGAGAACGACGTGTTCACCCCCGTGCGCAAGATCTGGGACCTGTTCATCCACCAGTGCATCCAGAACTACACCCCCGGCGCCCACCTGACCATCGACGAGCAGCTGCTGGGCTTCCGCGGCCGCTGCCCCTTCCGCGTGTACATCCCCAACAAGCCCAGCAAGTACGGCATCAAGATCCTGATGATGTGCGACAGCGGCACCAAGTACATGATCAACGGCATGCCCTACCTGGGCCGCGGCACCCAGACCAACGGCGTGCCCCTGGGCGAGTACTACGTGAAGGAGCTGAGCAAGCCCGTGCACGGCAGCTGCCGCAACATCACCTGCGACAACTGGTTCACCAGCATCCCCCTGGCCAAGAACCTGCTGCAGGAGCCCTACAAGCTGACCATCGTGGGCACCGTGCGCAGCAACAAGCGCGAGATCCCCGAGGTGCTGAAGAACAGCCGCAGCCGCCCCGTGGGCACCAGCATGTTCTGCTTCGACGGCCCCCTGACCCTGGTGAGCTACAAGCCCAAGCCCGCCAAGATGGTGTACCTGCTGAGCAGCTGCGACGAGGACGCCAGCATCAACGAGAGCACCGGCAAGCCCCAGATGGTGATGTACTACAACCAGACCAAGGGCGGCGTGGACACCCTGGACCAGATGTGCAGCGTGATGACCTGCAGCCGCAAGACCAACCGCTGGCCCATGGCCCTGCTGTACGGCATGATCAACATCGCCTGCATCAACAGCTTCATCATCTACAGCCACAACGTGAGCAGCAAGGGCGAGAAGGTGCAGAGCCGCAAGAAGTTCATGCGCAACCTGTACATGGGCCTGACCAGCAGCTTCATGCGCAAGCGCCTGGAGGCCCCCACCCTGAAGCGCTACCTGCGCGACAACATCAGCAACATCCTGCCCAAGGAGGTGCCCGGCACCAGCGACGACAGCACCGAGGAGCCCGTGATGAAGAAGCGCACCTACTGCACCTACTGCCCCAGCAAGATCCGCCGCAAGGCCAGCGCCAGCTGCAAGAAGTGCAAGAAGGTGATCTGCCGCGAGCACAACATCGACATGTGCCAGAGCTGCTTCTAA

In sequence 18 above, the lower case portion is the 6 × His tag coding sequence.

Sequence 19(SEQ ID NO:19, 27bp), human c-myc nuclear localization signal coding sequence 1

CCTGCTGCCAAGAGGGTCAAGTTGGAC

Sequence 20(SEQ ID NO:20, 9aa), human c-myc Nuclear localization Signal protein/polypeptide 1

PAAKRVKLD

Sequence 21(SEQ ID NO:21, 30bp), human c-myc nuclear localization signal coding sequence 2

GGCCCTGCTGCCAAGAGGGTCAAGTTGGAC

Sequence 22(SEQ ID NO:22, 10aa), human c-myc nuclear localization signal protein/polypeptide 2

GPAAKRVKLD

Sequence 23(SEQ ID NO:23, 1785bp), PiggyBac transposase coding sequence

ATGGGCAGCAGCCTGGACGACGAGCACATCCTGAGCGCCCTGCTGCAGAGCGACGACGAGCTGGTGGGCGAGGACAGCGACAGCGAGGTGAGCGACCACGTGAGCGAGGACGACGTGCAGAGCGACACCGAGGAGGCCTTCATCGACGAGGTGCACGAGGTGCAGCCCACCAGCAGCGGCAGCGAGATCCTGGACGAGCAGAACGTGATCGAGCAGCCCGGCAGCAGCCTGGCCAGCAACCGCATCCTGACCCTGCCCCAGCGCACCATCCGCGGCAAGAACAAGCACTGCTGGAGCACCAGCAAGCCCACCCGCCGCAGCCGCGTGAGCGCCCTGAACATCGTGCGCAGCCAGCGCGGCCCCACCCGCATGTGCCGCAACATCTACGACCCCCTGCTGTGCTTCAAGCTGTTCTTCACCGACGAGATCATCAGCGAGATCGTGAAGTGGACCAACGCCGAGATCAGCCTGAAGCGCCGCGAGAGCATGACCAGCGCCACCTTCCGCGACACCAACGAGGACGAGATCTACGCCTTCTTCGGCATCCTGGTGATGACCGCCGTGCGCAAGGACAACCACATGAGCACCGACGACCTGTTCGACCGCAGCCTGAGCATGGTGTACGTGAGCGTGATGAGCCGCGACCGCTTCGACTTCCTGATCCGCTGCCTGCGCATGGACGACAAGAGCATCCGCCCCACCCTGCGCGAGAACGACGTGTTCACCCCCGTGCGCAAGATCTGGGACCTGTTCATCCACCAGTGCATCCAGAACTACACCCCCGGCGCCCACCTGACCATCGACGAGCAGCTGCTGGGCTTCCGCGGCCGCTGCCCCTTCCGCGTGTACATCCCCAACAAGCCCAGCAAGTACGGCATCAAGATCCTGATGATGTGCGACAGCGGCACCAAGTACATGATCAACGGCATGCCCTACCTGGGCCGCGGCACCCAGACCAACGGCGTGCCCCTGGGCGAGTACTACGTGAAGGAGCTGAGCAAGCCCGTGCACGGCAGCTGCCGCAACATCACCTGCGACAACTGGTTCACCAGCATCCCCCTGGCCAAGAACCTGCTGCAGGAGCCCTACAAGCTGACCATCGTGGGCACCGTGCGCAGCAACAAGCGCGAGATCCCCGAGGTGCTGAAGAACAGCCGCAGCCGCCCCGTGGGCACCAGCATGTTCTGCTTCGACGGCCCCCTGACCCTGGTGAGCTACAAGCCCAAGCCCGCCAAGATGGTGTACCTGCTGAGCAGCTGCGACGAGGACGCCAGCATCAACGAGAGCACCGGCAAGCCCCAGATGGTGATGTACTACAACCAGACCAAGGGCGGCGTGGACACCCTGGACCAGATGTGCAGCGTGATGACCTGCAGCCGCAAGACCAACCGCTGGCCCATGGCCCTGCTGTACGGCATGATCAACATCGCCTGCATCAACAGCTTCATCATCTACAGCCACAACGTGAGCAGCAAGGGCGAGAAGGTGCAGAGCCGCAAGAAGTTCATGCGCAACCTGTACATGGGCCTGACCAGCAGCTTCATGCGCAAGCGCCTGGAGGCCCCCACCCTGAAGCGCTACCTGCGCGACAACATCAGCAACATCCTGCCCAAGGAGGTGCCCGGCACCAGCGACGACAGCACCGAGGAGCCCGTGATGAAGAAGCGCACCTACTGCACCTACTGCCCCAGCAAGATCCGCCGCAAGGCCAGCGCCAGCTGCAAGAAGTGCAAGAAGGTGATCTGCCGCGAGCACAACATCGACATGTGCCAGAGCTGCTTCTAA

Sequence 24(SEQ ID NO:24, 594aa), amino acid sequence of PiggyBac transposase

MGSSLDDEHILSALLQSDDELVGEDSDSEVSDHVSEDDVQSDTEEAFIDEVHEVQPTSSGSEILDEQNVIEQPGSSLASNRILTLPQRTIRGKNKHCWSTSKPTRRSRVSALNIVRSQRGPTRMCRNIYDPLLCFKLFFTDEIISEIVKWTNAEISLKRRESMTSATFRDTNEDEIYAFFGILVMTAVRKDNHMSTDDLFDRSLSMVYVSVMSRDRFDFLIRCLRMDDKSIRPTLRENDVFTPVRKIWDLFIHQCIQNYTPGAHLTIDEQLLGFRGRCPFRVYIPNKPSKYGIKILMMCDSGTKYMINGMPYLGRGTQTNGVPLGEYYVKELSKPVHGSCRNITCDNWFTSIPLAKNLLQEPYKLTIVGTVRSNKREIPEVLKNSRSRPVGTSMFCFDGPLTLVSYKPKPAKMVYLLSSCDEDASINESTGKPQMVMYYNQTKGGVDTLDQMCSVMTCSRKTNRWPMALLYGMINIACINSFIIYSHNVSSKGEKVQSRKKFMRNLYMGLTSSFMRKRLEAPTLKRYLRDNISNILPKEVPGTSDDSTEEPVMKKRTYCTYCPSKIRRKASASCKKCKKVICREHNIDMCQSCF

Sequence 25(SEQ ID NO:25, 604aa), amino acid sequence of PiggyBac transposase (containing human c-myc nuclear localization signal)

MGPAAKRVKLDGSSLDDEHILSALLQSDDELVGEDSDSEVSDHVSEDDVQSDTEEAFIDEVHEVQPTSSGSEILDEQNVIEQPGSSLASNRILTLPQRTIRGKNKHCWSTSKPTRRSRVSALNIVRSQRGPTRMCRNIYDPLLCFKLFFTDEIISEIVKWTNAEISLKRRESMTSATFRDTNEDEIYAFFGILVMTAVRKDNHMSTDDLFDRSLSMVYVSVMSRDRFDFLIRCLRMDDKSIRPTLRENDVFTPVRKIWDLFIHQCIQNYTPGAHLTIDEQLLGFRGRCPFRVYIPNKPSKYGIKILMMCDSGTKYMINGMPYLGRGTQTNGVPLGEYYVKELSKPVHGSCRNITCDNWFTSIPLAKNLLQEPYKLTIVGTVRSNKREIPEVLKNSRSRPVGTSMFCFDGPLTLVSYKPKPAKMVYLLSSCDEDASINESTGKPQMVMYYNQTKGGVDTLDQMCSVMTCSRKTNRWPMALLYGMINIACINSFIIYSHNVSSKGEKVQSRKKFMRNLYMGLTSSFMRKRLEAPTLKRYLRDNISNILPKEVPGTSDDSTEEPVMKKRTYCTYCPSKIRRKASASCKKCKKVICREHNIDMCQSCF

26(SEQ ID NO:26, 15bp), HIV-1TAT nuclear localization signal coding sequence

GGTCGCAAGAAACGT

Sequence 27(SEQ ID NO:27, 5aa), HIV-1TAT Nuclear localization Signal amino acid sequence

GRKKR

Sequence 28(SEQ ID NO:28, 1800bp), PiggyBac transposase nucleic acid sequence containing HIV-1TAT nuclear localization signal coding sequence, wherein the coding sequence of HIV-1TAT nuclear localization signal is underlined.

ATGGGTCGCAAGAAACGTGGCAGCAGCCTGGACGACGAGCACATCCTGAGCGCCCTGCTGCAGAGCGACGACGAGCTGGTGGGCGAGGACAGCGACAGCGAGGTGAGCGACCACGTGAGCGAGGACGACGTGCAGAGCGACACCGAGGAGGCCTTCATCGACGAGGTGCACGAGGTGCAGCCCACCAGCAGCGGCAGCGAGATCCTGGACGAGCAGAACGTGATCGAGCAGCCCGGCAGCAGCCTGGCCAGCAACCGCATCCTGACCCTGCCCCAGCGCACCATCCGCGGCAAGAACAAGCACTGCTGGAGCACCAGCAAGCCCACCCGCCGCAGCCGCGTGAGCGCCCTGAACATCGTGCGCAGCCAGCGCGGCCCCACCCGCATGTGCCGCAACATCTACGACCCCCTGCTGTGCTTCAAGCTGTTCTTCACCGACGAGATCATCAGCGAGATCGTGAAGTGGACCAACGCCGAGATCAGCCTGAAGCGCCGCGAGAGCATGACCAGCGCCACCTTCCGCGACACCAACGAGGACGAGATCTACGCCTTCTTCGGCATCCTGGTGATGACCGCCGTGCGCAAGGACAACCACATGAGCACCGACGACCTGTTCGACCGCAGCCTGAGCATGGTGTACGTGAGCGTGATGAGCCGCGACCGCTTCGACTTCCTGATCCGCTGCCTGCGCATGGACGACAAGAGCATCCGCCCCACCCTGCGCGAGAACGACGTGTTCACCCCCGTGCGCAAGATCTGGGACCTGTTCATCCACCAGTGCATCCAGAACTACACCCCCGGCGCCCACCTGACCATCGACGAGCAGCTGCTGGGCTTCCGCGGCCGCTGCCCCTTCCGCGTGTACATCCCCAACAAGCCCAGCAAGTACGGCATCAAGATCCTGATGATGTGCGACAGCGGCACCAAGTACATGATCAACGGCATGCCCTACCTGGGCCGCGGCACCCAGACCAACGGCGTGCCCCTGGGCGAGTACTACGTGAAGGAGCTGAGCAAGCCCGTGCACGGCAGCTGCCGCAACATCACCTGCGACAACTGGTTCACCAGCATCCCCCTGGCCAAGAACCTGCTGCAGGAGCCCTACAAGCTGACCATCGTGGGCACCGTGCGCAGCAACAAGCGCGAGATCCCCGAGGTGCTGAAGAACAGCCGCAGCCGCCCCGTGGGCACCAGCATGTTCTGCTTCGACGGCCCCCTGACCCTGGTGAGCTACAAGCCCAAGCCCGCCAAGATGGTGTACCTGCTGAGCAGCTGCGACGAGGACGCCAGCATCAACGAGAGCACCGGCAAGCCCCAGATGGTGATGTACTACAACCAGACCAAGGGCGGCGTGGACACCCTGGACCAGATGTGCAGCGTGATGACCTGCAGCCGCAAGACCAACCGCTGGCCCATGGCCCTGCTGTACGGCATGATCAACATCGCCTGCATCAACAGCTTCATCATCTACAGCCACAACGTGAGCAGCAAGGGCGAGAAGGTGCAGAGCCGCAAGAAGTTCATGCGCAACCTGTACATGGGCCTGACCAGCAGCTTCATGCGCAAGCGCCTGGAGGCCCCCACCCTGAAGCGCTACCTGCGCGACAACATCAGCAACATCCTGCCCAAGGAGGTGCCCGGCACCAGCGACGACAGCACCGAGGAGCCCGTGATGAAGAAGCGCACCTACTGCACCTACTGCCCCAGCAAGATCCGCCGCAAGGCCAGCGCCAGCTGCAAGAAGTGCAAGAAGGTGATCTGCCGCGAGCACAACATCGACATGTGCCAGAGCTGCTTCTAA

Sequence 29(SEQ ID NO:29, 600bp), amino acid sequence of PiggyBac transposase containing HIV-1TAT nuclear localization signal

MGRKKRGSSLDDEHILSALLQSDDELVGEDSDSEVSDHVSEDDVQSDTEEAFIDEVHEVQPTSSGSEILDEQNVIEQPGSSLASNRILTLPQRTIRGKNKHCWSTSKPTRRSRVSALNIVRSQRGPTRMCRNIYDPLLCFKLFFTDEIISEIVKWTNAEISLKRRESMTSATFRDTNEDEIYAFFGILVMTAVRKDNHMSTDDLFDRSLSMVYVSVMSRDRFDFLIRCLRMDDKSIRPTLRENDVFTPVRKIWDLFIHQCIQNYTPGAHLTIDEQLLGFRGRCPFRVYIPNKPSKYGIKILMMCDSGTKYMINGMPYLGRGTQTNGVPLGEYYVKELSKPVHGSCRNITCDNWFTSIPLAKNLLQEPYKLTIVGTVRSNKREIPEVLKNSRSRPVGTSMFCFDGPLTLVSYKPKPAKMVYLLSSCDEDASINESTGKPQMVMYYNQTKGGVDTLDQMCSVMTCSRKTNRWPMALLYGMINIACINSFIIYSHNVSSKGEKVQSRKKFMRNLYMGLTSSFMRKRLEAPTLKRYLRDNISNILPKEVPGTSDDSTEEPVMKKRTYCTYCPSKIRRKASASCKKCKKVICREHNIDMCQSCF

Detailed Description

Embodiments of the present invention will be described in detail with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not show the specific techniques or conditions, and the techniques or conditions are described in the literature in the art (for example, refer to molecular cloning, a laboratory Manual, third edition, scientific Press, written by J. SammBruker et al, Huang Petang et al) or according to the product instructions. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1: construction of pNB vector

Sequentially splicing a PiggyBac transposons 5 'terminal repetitive sequence (SEQ ID NO:1), a polyclonal insertion site (SEQ ID NO:2), a polyA tailing signal sequence (SEQ ID NO:3), a PiggyBac transposon 3' terminal repetitive sequence (SEQ ID NO:4), a PiggyBac transposase coding sequence (SEQ ID NO:5) containing c-myc nuclear localization signals and a CMV promoter sequence (SEQ ID NO:6) into a long sequence (SEQ ID NO:7), wherein the PiggyBac transposase coding sequence containing c-myc nuclear localization signals and the CMV promoter sequence are reversely complementary (the reverse complementation refers to that the reverse complementary sequences of the PiggyBac transposase coding sequence and the CMV promoter sequence are displayed because the directions of an exogenous gene expression frame and a PB gene expression frame are opposite), entrusting the Shanghai Jiehe biological limited technologies to synthesize, adding AscI and PacI sites at two ends respectively, pUC57 (purchased from a Jerry organism, Shanghai) was inserted and named pNB vector (map: FIG. 1).

Example 2: construction of pNB vector containing exogenous gene expression cassette

1. The vector was synthesized by substituting the EF1 alpha promoter sequence with the protease of Kyori, Shanghai, Biotech, Inc., and XbaI and EcoRI cleavage sites were added to both ends of the vector to incorporate the pNB vector prepared in example 1, which was named pNB 328.

The EF1 alpha promoter sequence is shown in SEQ ID NO. 8.

2. According to the EGFP coding sequence, the gene is synthesized by Shanghai Jiehui biological science and technology limited, EcoRI enzyme cutting sites and SalI enzyme cutting sites are respectively added at two ends, and the gene is loaded into a pNB328 vector which is named as a pNB328-EGFP vector.

The EGFP coding sequence is shown in SEQ ID NO. 9.

3. According to the Luc luciferase coding sequence, the vector is synthesized by Shanghai Jiehui biological science and technology limited, EcoRI enzyme cutting sites and SalI enzyme cutting sites are respectively added at two ends of the vector, and the vector is loaded into a pNB328 vector which is named as a pNB328-Luc vector.

The Luc luciferase coding sequence is shown as SEQ ID NO. 10.

4. According to the enzyme coding sequence of human GM-CSF gene, the DNA fragment is synthesized by Shanghai Jiehre biological science and technology limited, and EcoRI and SalI enzyme cutting sites are respectively added at two ends, and the DNA fragment is loaded into a pNB328 vector, which is named as pNB328-GM-CSF vector.

The coding sequence of the GM-CSF gene is shown in SEQ ID NO. 11.

Example 3: construction of PB vector and analysis of nuclear localization situation

The inventor adopts an immunofluorescence hybridization method to detect the change condition of protein subcellular localization before and after a PB transposase artificially increases a nuclear localization signal. Since no antibody to PB transposase is currently available on the market, the present inventors fused a His tag to the front of PB and used the His-tagged antibody to detect subcellular localization of the His-PB fusion protein.

The method comprises the following specific steps:

construction of pcDNA3.1-cPB vector

According to the coding sequence of human c-myc nuclear localization signal, 6 XHis tag coding sequence and PB transposase coding sequence, the coding sequence of myc-His-PB fusion protein (SEQ ID NO:17) is spliced, the whole sequence synthesis of Shanghai Jiehui biological technology GmbH is entrusted, HindIII and ClaI enzyme cutting sites are respectively added at two ends, and the vector is loaded into pcDNA3.1 vector (purchased from Invitrogen) and named as pcDNA3.1-cPB.

2. Construction of control vector pcDNA3.1-PB

A coding sequence (SEQ ID NO:18) of His-PB fusion protein is spliced according to a6 XHis tag coding sequence and a PB transposase coding sequence, the whole sequence synthesis of Shanghai Jiehui biological technology limited company is entrusted, HindIII and ClaI enzyme cutting sites are respectively added at two ends, and the mixture is loaded into a pcDNA3.1 vector (purchased from Invitrogen company) which is named as pcDNA3.1-PB.

3. Preparation 5 × 10⁶A low-generation Jurkat cell line (purchased from American Standard Collection of Biotechnology, ATCC) with good growth state was transfected into cells by 6. mu.g of pcDNA3.1-cPB and pcDNA3.1-PB respectively through a Lonza 2 b-Nuclear effector instrument (following the instruction of the instrument), placed at 37 ℃ and 5% CO₂And (5) incubator culture.

4. After 2 days of electrotransfer, centrifuging, discarding the culture medium, washing with PBS for 1 time, then discarding PBS, and repeating for 3 times; adding 5% paraformaldehyde, 50 μ l/hole, standing for 5-10 min; centrifuging, and carefully discarding the paraformaldehyde solution; 1 × BSA for 3 times, soaking for 2 minutes each time; His-Tag (2A8) Mouse mAb (100. mu.l, 100-fold diluted antibody from Abcam) was added to each well and left at room temperature for 1 hour; centrifuging, washing with 1 × BSA for 3 times, and soaking for 2 minutes each time; the antibody Alexa Fluor 594-conjugated Affinipure Donkey Anti-mouse IgG (H + L) (purchased from Jackson ImmunoResearch Laboratories, Inc., diluted at a ratio of 1: 200) was added to each well, 50. mu.l was placed in each well, protected from light, and left at room temperature for 60 minutes; washing with 1 × BSA for 3 times, soaking for 2 min each time, centrifuging, discarding the washing solution, and dyeing with 1 × DAPI 50 μ l for 10 min; wash 3 times with 1 × BSA, soak 2 min each time. Centrifugation, addition of 1 × BSA, 30 μ l/well, observation under a fluorescent microscope and photographing.

The results of the experiment showed that the detection signal of His-tag antibody (red) almost completely overlapped with the DAPI signal (blue, showing the nucleus) in Jurkat cells transfected with the plasmid pcDNA3.1-cPB, indicating that the cmyc-His-PB fusion protein mainly accumulated in the nucleus (FIG. 2A). In Jurkat cells transfected with the pcDNA3.1-PB control plasmid, a red signal was also present in addition to the blue signal, indicating that the his-PB fusion protein was also present in the cytoplasm in addition to being distributed in the nucleus (FIG. 2B).

The result shows that the c-myc nuclear localization sequence is increased, and the enrichment degree of the PB transposase in the cell nucleus can be effectively improved.

Example 4: quantitative detection of integration efficiency of pNB vector in Jurkat cells

Preparation 5 × 10⁶The generation number of vigorous Jurkat cells was determined by transfecting 6. mu.g of pNB328-EGFP and 5. mu.g of PB513B-1 (providing an EGFP expression plasmid containing an ITR element, available from SystemBioscience Inc. + 2. mu.g of PB210PA-1 plasmid (providing an expression plasmid for PB transposase)) into the cell nucleus by means of a Lonza 2b-Nucleofector instrument, respectively, and setting the cell nucleus at 37 ℃ with 5% CO₂And (5) incubator culture. After the cells were confluent, subculture was carried out at a ratio of 1: 10. Changes in the ratio of EGFP-positive cells were detected by flow cytometry at 12 hours (P0), 5 days (P0+5), 1 passage (P1), 2 passages (P2), and 3 passages (P3) after transfection, respectively.

Since T cells proliferate very rapidly, the non-integrated plasmid is lost rapidly as the cells divide, by dilution at a ratio of 1: 10. Thus, after 3 passages, cells positive for green fluorescence can be considered to have stably integrated the green fluorescence expression cassette. The efficiency of integration can be determined by flow-detecting the proportion of green fluorescent positive cells.

As shown in FIG. 3, the proportion of EGFP-positive Jurkat cells decreased gradually with successive passages at a 1:10 ratio. After 3 passages, Jurkat T cells transfected by binary system PB transposon (PB513B-1+ PB210PA-1) had an EGFP-positive cell proportion of 6.5% (integration efficiency 6.5%); in the case of the engineered monadic PB transposon pNB 328-EGFP-transfected Jurkat T cells, the EGFP-positive cell proportion was 36.4% (integration efficiency 36.4%).

The results show that the modified PB transposon-pNB vector system of the monadic system can efficiently mediate the integration of the foreign gene.

Example 5: integration analysis of pNB328-EGFP vector in Jurkat, K562 cells

Preparation 5 × 10⁶Low-generation Jurkat and K562 cell lines (purchased from American Standard Biotech Collection, ATCC) with good growth state were transfected into cell nucleus by 6. mu.g of pNB328-EGFP and pcDNA3.1-EGFP (purchased from Addgene) plasmids respectively through a Lonza 2 b-Nuclear effector instrument (according to the instruction of the instrument operation), and the cell nucleus was cultured at 37 ℃ in 5% CO₂Culturing in incubator, subculturing at a ratio of 1:10 after the cells grow full, recording the expression condition of green fluorescence in the cells by using a fluorescence microscope after 3 generations, and collecting 1 × 10⁵And (3) detecting the proportion of the EGFP positive cells by using a flow cytometer.

The results show that after 3 generations of Jurkat and K562 transfected by the control plasmid pcDNA3.1-EGFP, a green fluorescent signal can hardly be detected, which indicates that the non-integrated plasmid transfected into cells and existing in a free state is completely lost along with cell division; in contrast, after 3 passages, Jurkat and K562 after pNB328-EGFP transfection still detected strong green fluorescence signals (FIGS. 4A, 4B, 4C and 4D), indicating that the EGFP expression cassette has been integrated into the cell genome and stably exists and is expressed with cell division.

Flow results showed that the integration efficiencies of 36.4% and 40.54% after transfection of Jurkat and K562 with pNB328-EGFP plasmid (FIGS. 5A and 5B), respectively.

Example 6: integration analysis of pNB328-EGFP vector in primary T cells

Preparation 1 × 10⁷Freshly isolated Peripheral Blood Mononuclear Cells (PBMC) were transfected into the nucleus with 6. mu.g of pNB328-EGFP and pcDNA3.1-EGFP plasmids, respectively, by means of a Lonza 2b-Nucleofector instrument, at 37 ℃ with 5% CO₂Culturing an incubator; after 6 hours, the cells were transferred to a 6-well plate containing 30ng/mL of an anti-CD 3 antibody and 3000IU/mL of IL-2 (obtained from Novoprotein Co.), and placed at 37 ℃ in a 5% CO atmosphere₂Culturing in incubator, subculturing at a ratio of 1:10 after the cells grow full, recording the expression condition of green fluorescence in the cells by using a fluorescence microscope after 3 generations, and collecting 1 × 10⁵And (3) detecting the proportion of the EGFP positive cells by using a flow cytometer.

The result shows that almost no green fluorescent signal can be detected after 3 generations of the primary T cell transfected by the control plasmid pcDNA3.1-EGFP, which indicates that the non-integrated plasmid transfected into the cell and existing in a free state is completely lost along with cell division; in contrast, the primary T cells after pNB328-EGFP transfection still detected strong green fluorescence signals after 3 passages, indicating that the EGFP expression cassette has integrated into the cell genome, and is stably present and expressed following cell division (fig. 4E, 4F).

Flow-through results showed that the integration efficiency was 56.9% after transfection of primary T cells with the pNB328-EGFP plasmid (FIG. 5C).

Example 7: integration analysis of pNB328-EGFP vector in mouse embryonic stem cells

Preparation 5 × 10⁶Mouse H9 embryonic stem cell line (purchased from ATCC), 6. mu.g of pNB328-EGFP plasmid was transfected into the nucleus by Lonza 2b-Nucleofector instrument, placed at 37 ℃ and 5% CO₂Culturing in incubator, subculturing at a ratio of 1:10 after the cells grow full, recording the expression condition of green fluorescence in the cells by using a fluorescence microscope after 3 generations, and collecting 1 × 10⁵And (3) detecting the proportion of the EGFP positive cells by using a flow cytometer.

The results show that after the pNB328-EGFP transfection, the mouse embryonic stem cells still can detect strong green fluorescence signals after 3 generations, which indicates that the EGFP expression frame is integrated into the cell genome and can stably exist and express along with cell division (FIGS. 4G, 4H). Flow results showed that the integration efficiency was 73.12% after transfection of mouse ES cells with pNB328-EGFP plasmid (FIG. 5D).

Example 8: integration analysis of pNB328-luc vector in tumor cells

Preparation 5 × 10⁶Human hepatoma cell line Huh7 (purchased from ATCC) was transfected into the cell nucleus with 6. mu.g of pNB328-luc and pGL4.75-CMV (purchased from Promega) plasmids by Lonza 2b-Nucleofector instrument, respectively, and the transfected cells were incubated at 37 ℃ under 5% CO₂Culturing in incubator, subculturing at a ratio of 1:10 after the cells grow full, and collecting 1 × 10 after 3 generations⁵The Luc luciferase activity was measured using a luciferase assay kit (purchased from Promega) after cell lysis.

The results show that almost no luciferase activity can be detected after the Huh7 cells are transfected by the control plasmid pGL4.75-CMV after 3 generations, which indicates that the non-integrated plasmid which is transfected into cells and exists in a free state is completely lost along with cell division; in contrast, Huh7 cells transfected with pNB328-luc still detected strong luciferase activity after 3 passages, indicating that the luc expression cassette has been integrated into the cell genome and is stably present and expressed following cell division (fig. 6).

Example 9: integration analysis of pNB328-GM-CSF vector in HEK293 cells

Preparation 5 × 10⁶Human HEK293 cells (purchased from ATCC) were transfected into the nucleus of cells with 6. mu.g of pNB328-GM-CSF plasmid by means of a Lonza 2b-Nucleofector instrument, respectively, and placed at 37 ℃ in 5% CO₂Culturing in incubator, subculturing at a ratio of 1:10 after the cells grow full, and collecting 1 × 10 after 3 generations⁶The supernatants of the cells after 2 days of culture were diluted by a certain fold and used for the secretion of GM-CSF protein in HEK293 cells after transfection of the pNB328-GM-CSF plasmid with the human GM-CSF ELISA MAX Deluxe detection kit (purchased from Biolegend).

The results showed that HEK293 cells transfected with pNB328-GM-CSF still expressed GM-CSF protein at high levels (1253.7ng/ml) after 3 passages, indicating that the GM-CSF expression cassette has been integrated into the cell genome and is stably present and expressed following cell division.

Example 10: comparison of mediated integration efficiency of C-myc-containing nuclear localization signal PB and TAT-containing nuclear localization signal PB

According to the coding sequence (SEQ ID NO:28) of PB transposase containing HIV 1TAT nuclear localization signal (SEQ ID NO:26, the coded amino acid sequence is shown as SEQ ID NO: 27), the whole sequence synthesis of the PB transposase is entrusted to Shanghai Jieli biotechnology limited, HindIII and ClaI enzyme cutting sites are respectively added at two ends of the PB transposase, and the PB transposase coding sequence containing c-myc nuclear localization signal in the original pNB vector is replaced, and the pNB-T is named. The EF1 alpha promoter (shown in SEQ ID NO: 8) was inserted into the pNB-T vector (digested simultaneously with EcoRI by XbaI) and designated as pNB 328T. The EGFP coding sequence (shown in SEQ ID NO: 9) was then inserted into the pNB328T vector (double digested with SalI by EcoRI) and designated pNB 328T-EGFP.

Preparation 5 × 10⁶Jurkat, K562 cell line, mouse H9 embryonic stem cell line, HEK293 cell line, and Huh7 cell line (purchased from American Standard Collection of biologicals, ATCC) in good growth status were transfected into the cell nucleus by 6. mu.g of pNB328-EGFP and pNB328T-EGFP plasmids, respectively, using a Lonza 2b-Nucleofector instrument. Placing at 37 ℃ and 5% CO₂Culturing in incubator, subculturing at a ratio of 1:10 after the cells grow full, and collecting 1 × 10 after 3 generations⁵And (3) detecting the proportion of the EGFP positive cells by using a flow cytometer.

Flow results show that after the pUNB 328-EGFP plasmids are transfected with Jurkat, K562, H9, HEK293 and Huh7, the integration efficiencies are 36.4%, 40.54%, 73.12%, 38.47%, 36.1% and 51.38%, respectively; after the transfection of Jurkat, K562, H9, HEK293 and Huh7 by pNB328T-EGFP plasmids, the integration efficiencies were 28.3%, 31.8%, 58.2%, 17.5% and 36.1%, respectively, which were significantly lower than those of the pNB328-EGFP plasmid transfection group (FIG. 7).

The results show that the PB transposase containing the c-myc nuclear localization signal can mediate the integration of exogenous genes in target cells more efficiently than the PB transposase containing the TAT nuclear localization signal (SEQ ID NO: 29).

Example 11: comparative analysis of exogenous gene expression level of pNB328-EGFP vector after primary T cell integration

Group 1 preparation 1 × 10⁷The obtained Peripheral Blood Mononuclear Cells (PBMC) were freshly isolated. Respectively transfecting 6 mu g of pNB328-EGFP and pcDNA3.1-EGFP plasmids into cell nucleus by a Lonza 2b-Nucleofector instrument, placing the cell nucleus at 37 ℃ and 5% CO₂Culturing an incubator; after 6 hours, the cells were transferred to a 6-well plate containing 30ng/mL of an anti-CD 3 antibody and 3000IU/mL of IL-2 (obtained from Novoprotein Co.), and placed at 37 ℃ in a 5% CO atmosphere₂And (5) incubator culture.

Group 2 preparation 1 × 10⁶PBMC cells derived from the same healthy human are cultured under the conditions of 30ng/mL anti-CD 3 antibody and 3000IU/mLIL-2 for 3 days, and then 5 × 10 cells are taken⁶The activated T cells were infected with a recombinant lentivirus rLV-EGFP (available from shanghaien biomedical science and technology limited, MOI ═ 100) carrying green fluorescent protein.

After the cells are full, subculturing two groups of treated cells according to the proportion of 1:10, after 3 generations, observing the expression condition of green fluorescence by using a fluorescence microscope, and simultaneously, respectively collecting 1 × 10⁵Cells, Mean Fluorescence Intensity (MFI) in EGFP-positive cells was detected using flow cytometry. The result shows that the fluorescence intensity of the T cells integrated by the pNB328-EGFP vector is high (FIGS. 8A and 8B), and the MFI reaches 1507.63; whereas, in T cells after lentivirus infection, green fluorescence was lower in intensity and the MFI was 50.34 (FIGS. 8C and 8D), which was approximately 29-fold different. The result shows that the high-efficiency expression of the exogenous gene can be promoted after the pNB328-EGFP vector mediates the exogenous gene to be integrated into the transfected primary T cells.

Example 12: integration site analysis of pNB328-EGFP vector in primary T cells

3 fresh PMBC of different human origin were prepared, 6. mu.g of pNB328-EGFP plasmid was transfected into the nucleus by means of a Lonza 2b-Nucleofector instrument, placed at 37 ℃ and 5% CO₂Culturing an incubator; after 6 hours, the cells were transferred to a 6-well plate containing 30ng/mL of an anti-CD 3 antibody and 3000IU/mL of IL-2 (obtained from Novoprotein Co.), and placed at 37 ℃ in a 5% CO atmosphere₂Culturing in incubator, subculturing at a ratio of 1:10 after the cells are overgrown, and collecting 5 × 10⁷Extracting genomic DNA, entrusting cloud health gene technology (Shanghai) Limited to carry out whole genome sequencing, and analyzing the distribution of EGFP insertion sites in a genome. The results showed that 18 insertion sites were detected in total for sample 1, 36 insertion sites were detected for sample 2, and 61 insertion sites were detected for sample 3 (insertion sites refer to all genomic sites in one sample where genomic integration was detected; and repeated detection at the same site is the number of detected sites) (FIGS. 9A,9B, and 9C). Surprisingly, there was an integration hotspot in the 5 th chromosome 5p15.1, 7 th chromosome 7p15.1, 9 th chromosome 9q34.3 intervals (FIGS. 8A, 8B, 8C, circles indicate integration hotspots. Note: in general, the number detected at one site is between 1 and 3.), and the number detected at adjacent positions in the 3 intervals for each of the three samples reached 50/66/50 (note: the number detected for integration at 5 th chromosome 5p15.1, the first sample was 50, the second sample was 66, the third sample was 50, and the following 68/82/64, 78/59/54, similarly understood), 68/82/64, 78/59/54.

Since the human genome annotation is complete at present, it can be determined by bioinformatics whether the interval is an intergenic sequence or a intergenic sequence. Through analysis, the three intervals all belong to intergenic segments, and the insertion of the exogenous gene expression frame cannot form inactivation and insertion mutation of related genes.

Example 13: construction of pNB328-CAR19 vector and genetic modification of primary T cells

1. According to a Chimeric Antigen Receptor (CAR) sequence aiming at a CD19 antigen, the DNA fragment is synthesized by Shanghai Jieery biotechnology limited, EcoRI enzyme cutting sites and SalI enzyme cutting sites are respectively added at two ends of the DNA fragment, and the DNA fragment is loaded into a pNB328 vector which is named as a pNB328-CAR19 vector.

The CAR19 coding sequence is shown in SEQ ID NO: 16.

2. Preparation 1 × 10⁷Freshly isolated human PBMC were transfected into the nucleus by 6. mu.g of pNB328-CAR19 plasmid, respectively, by means of a Lonza 2b-Nucleofector instrument, and placed 37℃、5％CO₂Culturing an incubator; after 6 hours, the cells were transferred to a 6-well plate containing 30ng/mL of an anti-CD 3 antibody and 3000IU/mL of IL-2 (obtained from Novoprotein Co.), and placed at 37 ℃ in a 5% CO atmosphere₂And (5) incubator culture. After the cells stably grow, the T cells (CAR19-T) which are genetically modified by CAR19 are obtained.

Example 14: detection of in vitro killing effect of CAR19-T cells on target cells

CAR19-T and unmodified T cells were co-cultured with Raji cells (purchased from ATCC) at different effective-to-target ratios (8:1, 4:1, 2:1, 1:1, 0.5:1, 0.25:1, 0.125:1,0.0625:1) and the in vitro killing ability of the T cells to the Raji cells before and after genetic modification was tested using LDH-lactate dehydrogenase-Cytotoxicity Assay Kit (LDH-Cytotoxicity Assay Kit, Biovision) by laying target cells in 96-well plates (5 × 10)³Per well), setting culture medium background, volume correction, target cell spontaneous LDH release, target cell maximum LDH release, effector cell spontaneous LDH release control wells, treating group wells, repeating 3 wells in each group, wherein the final volume of each well is the same and is not less than 100 mu L. Centrifuging at 250g for 4min at 37 deg.C with 5% CO₂Incubate at least 4h 45min before centrifugation, add 10 × lysate to the maximum release well of target cells, add equal amount of lysate to volume corrected wells, re-centrifuge, transfer 50 μ L of supernatant from each well to a new 96 well plate, add 50 μ L of substrate solution, incubate for 30min at room temperature in the dark, add 50 μ L of stop solution to each well, measure D490 within 1h cytotoxicity (%) - (D experimental well-D media background well) - (D effector cells spontaneous LDH release well-D media background well) - (D target cells spontaneous LDH release well-D media background well)]V [ (D target cell maximum LDH Release well-D volume corrected well) - (D target cell spontaneous LDH Release well-D Medium background well)]×100％。

The results show that pNB328-CAR19 mediated modification of the obtained CAR19-T had a significant killing effect on CD19 positive Raji cells relative to unmodified T cells (figure 10, p < 0.001).

Those skilled in the art will appreciate that Raji cells can be representative of cells positive for CD 19. Therefore, the pNB328-CAR19 mediated and modified CAR19-T can kill Raji cells efficiently, can kill CD19 positive tumor cells efficiently, and has clinical application value, such as high-efficiency killing of B cell lymphoma expressing CD19 surface antigen, and particularly has high curative effect on late refractory B cell lymphoma.

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate. Various modifications and substitutions of those details may be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A fusion protein consisting of a transposase, a nuclear localization signal of human origin, and one or more protein linkers;

wherein,

the fusion protein is not a fusion protein with an amino acid sequence shown as SEQ ID NO. 25;

the human nuclear localization signal is upstream of the transposase;

the transposase is PB transposase, and the human-derived nuclear localization signal is human c-myc nuclear localization signal;

the one or more protein linkers are connected between the transposase and the human nuclear localization signal;

the amino acid sequence of the PB transposase is shown as the 2 nd to 594 nd sites of SEQ ID NO. 24, and the amino acid sequence of the human c-myc nuclear localization signal is shown as SEQ ID NO. 20 or SEQ ID NO. 22.

2. The fusion protein according to claim 1, characterized by any one or more of the following items (1) - (2):

(1) the fusion protein is an artificial transposase;

(2) the transposase is in one or more copies, and/or the nuclear localization signal of human origin is in one or more copies.

3. The fusion protein of claim 1, wherein the protein linker is one or more glycines and/or one or more alanines.

4. A nucleic acid construct encoding the fusion protein of any one of claims 1 to 3,

wherein the nucleotide sequence of the nucleic acid construct is not shown in SEQ ID NO. 5.

5. The nucleic acid construct of claim 4, wherein the nucleic acid sequence encoding PB transposase is as shown in SEQ ID NO. 23 and/or the nucleic acid sequence encoding human c-myc nuclear localization signal is as shown in SEQ ID NO. 19 or SEQ ID NO. 21.

6. A recombinant vector comprising the nucleic acid construct of claim 4 or 5.

7. The recombinant vector according to claim 6, wherein the recombinant vector is a recombinant cloning vector, a recombinant eukaryotic expression plasmid or a recombinant viral vector.

8. The recombinant vector according to claim 7, wherein the recombinant cloning vector is the recombinant vector obtained by recombining the nucleic acid construct of claim 4 or 5 with pUC18, pUC19, pMD18-T, pMD19-T, pGM-T vector or pUC 57.

9. The recombinant vector according to claim 7, wherein the recombinant eukaryotic expression plasmid is the recombinant vector obtained by recombining the nucleic acid construct of claim 4 or 5 with pCDNA3 series vector, pCDNA4 series vector, pCDNA5 series vector, pCDNA6 series vector, pRL series vector, pMAX vector or pDC315 series vector.

10. The recombinant vector according to claim 7, wherein the recombinant viral vector is a recombinant adenoviral vector, a recombinant adeno-associated viral vector, a recombinant retroviral vector, a recombinant herpes simplex viral vector or a recombinant vaccinia viral vector.

11. A recombinant host cell comprising the nucleic acid construct of claim 4 or 5 or the recombinant vector of any one of claims 6 to 10.

12. The recombinant cell of claim 11, wherein the recombinant host cell is a recombinant mammalian cell.

13. The recombinant cell according to claim 12, wherein the recombinant mammalian cell is a recombinant primary culture T cell, a recombinant Jurkat cell, a recombinant K562 cell, a recombinant tumor cell, a recombinant HEK293 cell, or a recombinant CHO cell.

14. Use of the nucleic acid construct of claim 4 or 5, the recombinant vector of any one of claims 6 to 10 or the recombinant host cell of any one of claims 11 to 13, selected from any one of (1) to (4) as follows:

(1) use in the manufacture of a medicament or agent for integrating an exogenous gene expression cassette into the genome of a host cell;

(2) use in the preparation of a means for integrating an exogenous gene expression cassette into the genome of a host cell;

(3) use in the manufacture of a medicament or formulation for genomic research, gene therapy, cell therapy or stem cell induction and differentiation following induction;

(4) the use in the manufacture of a tool for genomic research, gene therapy, cell therapy or stem cell induction and differentiation following induction.

15. The use according to claim 14, wherein in item (1) or (2), the host cell is a mammalian cell.

16. The use of claim 15, wherein the mammalian cell is a primary culture T cell, Jurkat cell, K562 cell, tumor cell, HEK293 cell, or CHO cell.

17. Use of a fusion protein selected from any one of (1) to (4) as follows:

(4) use in the manufacture of a tool for genomic research, gene therapy, cell therapy or stem cell induction and differentiation following induction;

wherein,

the fusion protein of any one of claims 1 to 3.

18. The use according to claim 17, wherein in item (1) or (2), the host cell is a mammalian cell.

19. The use of claim 18, wherein the mammalian cell is a primary culture T cell, Jurkat cell, K562 cell, tumor cell, HEK293 cell, or CHO cell.