CN107630009A - It is a kind of to be attenuated blast, replicate controllable HSV recombinant viruses and preparation method and application - Google Patents

Abstract

The invention discloses a kind of attenuation blast, replicate controllable HSV recombinant viruses and preparation method and application.It must and be the thymidine kinase of Major Virulence Factors that applicant is replicated virus using methods of homologous recombination in neuron（TK）Gene knockout, red or green fluorescence genes amplification expression cassette is subsequently recombined into viral genome structure Novel series recombinant virus.Such recombinant virus shows that obvious hypotoxicity, infecting mouse are in good condition, fluorescence signal is strong in animal maincenter in vivo marker and is limited in injection site expression；Joint Cre is relied on, compensation expression TK AAV helper viruses realize cell-specific, direct motion across single synaptic neural loop tracer.Restructuring HSV is with a wide range of applications in the transduction of nervous system target gene, across the cynapse tracer of neutral net direct motion, oncolytic, virus replication and pathogenesis, antiviral drugs screening etc..

Description

It is a kind of to be attenuated blast, replicate controllable HSV recombinant viruses and preparation method and application

Technical field

The invention belongs to biological technical field, and in particular to a kind of to be attenuated blast, replicate controllable HSV recombinant viruses and system Preparation Method and application, it is related to structure of the auxiliary HSV recombinant viruses across the AAV helper virus systems of single cynapse tracer, and the work Has virus system in the direct motion of cerebral nerve loop across in single cynapse tracer, the transduction of nervous system target gene and oncolytic therapy etc. Using.

Background technology

Brain is the most complicated organ of human body, and we still know little about it to it so far, and it is section to disclose function of brain mechanism The target that scholars dream of.USA and EU " brain plan " successively startup in 2013 has started the upsurge of brain science research. The structure of researching neural network be understand brain working mechanism and treat disease or injury under the conditions of brain disorder it is important Basis, but parse the huge and extremely complex neutral net not a duck soup of brain, it is necessary first to establish efficiently tracking nerve The tracer instrument and method of loop structure." the promoting innovation Neural Technology brain project (BRAIN) " in the U.S. is a kind of first New technology, research new technology and new tool are the emphasis of this plan.Study the new technology of neural network 26S Proteasome Structure and Function and new The emergence of instrument will greatly promote the research and development of brain science.

The tracer for parsing neural circuitry is mainly the axonal transport function using neuron.Traditional compound tracer (such as FluoroGold, PHAL) can be along axonal transport but the form because that across cynapse, can not can only mark local neuron.Previous generation Researcher's seventies that records starts with neurotropic virus and does loop tracer.This technology mainly can infect nerve with neurotropic virus Progeny virus that is first and replicating is capable of the characteristic of the connected neuron of across cynapse infection, and virus can be certainly in each neuron in addition I, which replicates, to decay, while is also exaggerated the marking signal of neuron in loop, chased after so neurotropic virus turns into natural The carrier tool of track neural network structure.Across the cynapse tracer of virus has turned into the strong technology of parsing neural circuitry, obtains Extensive use.Instrument virus is optimized using technologies such as Molecular Virology, reverse geneticses transformation have been developed that it is more next More tracer virus, has played important function in the identification of accurate Complex Neural Network, structure and functional study already, and And the appearance of new tracer instrument provides many new research viewpoints of brain science.

Currently used neurotropic virus mainly has the Pseudorabies virus (Pseudorabies from α herpetoviridaes Virus, PRV) and the rabies viruses of herpes simplex virus (Herpes simplex virus, HSV) and rhabdoviridae (Rabies virus, RV), it is other to also have vesicular stomatitis virus (vesicular stomatitis virus, VSV), Xin De Than this viral (Sindbis virus, SV) etc..Neurotropic virus is realized by genetic modification and orients transport along aixs cylinder, mostly Such as PRV Bartha strains and RV of number virus is inversely across cynapse infection, and VSV both directions can be propagated.In transgenic mice By using Cre recombinases or avian cells TVA-Env A systems, realized by RV targetings mark specific neuron type and Inversely across single cynapse tracer.The special direct motion of relative energy is HSV-1H129 strains across cynapse tracer, but to its Optimizing Reconstruction Other neurotropic viruses are now also much lagged behind, particularly still lack direct motion at present across single cynapse instrument virus tracing system.Mesh Before have been reported it is middle with expression fluorescin H129 tracking loop structure document it is less, Liching Lo etc. are in H129 thymidines LoxP-STOP-LoxP (LSL) control sequence, red fluorescence and TK genes are inserted in kinase gene, is only cut by Cre recombinases Red fluorescence after cutting behind LSL could express.Recombinant virus is in Cre transgenic mices Cerebellar Cortex Purkinje Cell, vision etc. Neural circuitry has carried out tracer study.Alice E.McGovern etc. construct expression EGFP recombinant virus HSV-1H129- EGFP, pass through the up sensory nerve path of infection animal upper respiratory tract tracer.J.Patrick Card etc. construct 3 kinds of expression not With the restructuring H129 viruses of fluorescin, by the trace labelling to basal ganglia loop and visual system, further demonstrate,prove Real H129 and its recombinant virus have across the cynapse propagation characteristic of good direct motion.

Herpes simplex virus is one of mankind's susceptible virus, and it has the complexity of latent, morbidity and recurrence after infecting. HSV belongs to herpetoviridae, Alphaherpesvirinae, there is two kinds of hypotypes of HSV-1 and HSV-2, and amphitypy nucleic acid sequence homology is up to 50%, but mode of infection differs with clinical manifestation.HSV virion core is double-stranded DNA gene group, and outsourcing is with 20 faces Body capsid, capsid are outside the interstitial cortex containing a large amount of virus proteins, and outermost layer is the coating of grappling viral glycoprotein.HSV genes Group is linear DNA molecule, size about 152kb, is made up of the long segment (L) and short-movie section (S) that are covalently attached, each fragment contains Unique sequence and Inverted repeat, virus infection Post genome can be cyclized.HSV genome alkalescence nucleotide guanosine acid and cytidine The content (G/C content) of acid is higher, and up to 68.3%, certain difficulty is constituted for molecular cloning and genetic modification.HSV-1 genomes Encode more than 70 kinds of ORFs, the encoding gene transcriptional orientation of about half is that from left to right, but have the reading frame direction of 37 genes It is from right to left.HSV-1H129(Dix RD,et al.Comparative neurovirulence of herpes simplex virus type 1strains after peripheral or intracerebral inoculation of BALB/c mice.Infect Immun 1983；40(1):103-12) be from the strain of Patients With Encephalitis brain separation, In rodent research H129 be strictly by forward being propagated across cynapse, it is consistent with the direction of nerve impulse transmission, fit very much Together in the tracer and functional study of nerve output loop such as sensory nerve network.Other HSV has big DNA genomes, heredity The space of transformation is big, is easy to large fragment foreign gene or multiple transgenosis while introduces viral genome.HSV infection host models Enclose extensively, can effectively infect rodent and primate etc., so H129 turns into the direct motion loop that people receive much attention and shown Track antivirus tool.But it is presently available for the H129 instruments virus of loop tracer seldom and generally existing toxicity is big, sensitivity is weak The problems such as, thus carry out to HSV H129 Optimizing Reconstruction, less toxic, highlighted, special, the flexible HSV instruments virus of structure and It is necessary across single cynapse HSV tracing systems to establish direct motion.

The content of the invention

Object of the present invention is to provide a kind of attenuation blast, replicate controllable new HSV recombinant viruses.

Object of the present invention is to provide a kind of construction method for being attenuated blast, replicating controllable HSV recombinant viruses and It expands preparation, concentrating and purifying process.

Object of the present invention is to provide a kind of application for being attenuated blast, replicating controllable HSV recombinant viruses, the restructuring HSV viruses can be applied to animal brain neural circuitry mark, direct motion across single cynapse tracer, gene target transduction, oncolytic, vaccine structure Build, virus replication and pathogenesis analysis, antiviral drugs screening etc., be with a wide range of applications.

In order to realize the above object the present invention adopts the following technical scheme that：

The present invention mentality of designing be：

HSV-1H129 strains are encephalitis patients clinical separation strains, have the strict characteristic forward propagated across cynapse.It is but wild Type virus virulence is strong, can only survive 3-5 days as mouse maincenter infection H129 is latter, be unfavorable for carrying out neural circuitry tracer and function Activity etc. is studied.The H129 recombinant viruses of controllable, flexible foreign gene-carrying are attenuated, replicated for structure, are designed viral UL23 The thymidine kinase (thymidine kinase, TK) of gene code knocks out.TK is that the nondividing type cells such as HSV infection neurons are answered The indispensable gene of system, belong to early gene, encode 376 amino acid.Thymidine kinase is institute in thymidine synthesis remedial pathway Required enzyme, by making thymidine phosphorylase be dTTP, DNA synthesis is participated in, in nerve fiber infection duplication and resting form Play an important roll in infection.

Applicant lacks H129TK genes completely, design primer clone's UL23 (TK) genes both sides upstream and downstream homology arm sequence Row, homology arm is free of any TK gene orders, so as to build the recombinant virus H129 Δs TK of TK gene delections.For ease of by gene Expression cassette or a variety of gene of interest are cloned into genome recombination target spot, and design, which introduces, contains multiple restriction enzyme digestion sites Multiple cloning sites (MCS) joint, can so significantly facilitate follow-up molecular genetic manipulation.

The controllable HSV recombinant virus construction methods of a kind of attenuation blast, duplication include：

(1) homology arm clone and targeting plasmid construction

Extracting and purifying HSV-1H129 virus genom DNAs, using it as template, clone TK upstream region of gene homology arm sequences 1465bp, the primer UHAS-F：5'GCTAGCAGTGGGCCAAAAAGCCTAGC 3'；UHAS-R：5' AAGCTTACGCACGGGTGTTGGGTCGTTTG 3'；Cloned downstream homology arm sequence 1476bp, the primer DHAS-F：5' AAGCTTGTTCGAGGCCACACGCGTCAC 3'；DHAS-R：5'CTCGAGGGGAAAGTCCGTGATGGTGC 3'；Clone's Upstream and downstream homology arm fragment is carried by being connected into pcDNA3.1+ after Nhe I, Hind III and Xho I, Hind III digestions respectively Body, it is named as pH129 Δs TK；

Using pH129 Δs TK as template, primer pair H129 Δs TK-linker-F is utilized：5' TCAAGCTTAATTAAGTTAACATCGATCCTGCAGGCGCGCCGTTCGAGGCCACACGCGTC 3'；H129ΔTK- linker-R：5'GCCGGATCCAAATGAGTCTTCGGAC 3'；Expanded, amplified production is through Hind III, BamHI digestions The pH129 Δ TK skeleton carriers through same digestion are connected into after recovery, structure, which obtains, inserts polyclonal position among upstream and downstream homology arm The targeting plasmid of point joint, is named as pH129 Δ TK-linker, sequence verification is completely correct；

(2) the foreign gene Enhanced expressing box between clone's structure insertion homology arm

Using pcDNA3.1 (+) cloning vector, by ubiquitin promoter (hUbC) fragment with NheI, KpnI restriction enzyme site With the transcription enhancer elements WPRE with XbaI, ApaI restriction enzyme site, it is connected into pcDNA3.1 (+) carrier through digestion and obtains PcDNA3.1-hUbC-WPRE carriers；Then fluorogene is connected among hUbC and WPRE by KpnI, XbaI enzyme cutting site； Follow-up overall clone PCR obtains the whole expression cassette large fragments of hUbC- fluorogenes-WPRE-PA, passes through PacI and AscI digestions position Point is connected into the knockouts TK built early stage targeting vector pH129 Δ TK-linker, through digestion, sequencing proof vector construction into Work(, it is named as pH129 Δ TK-hUbC- fluorogenes-WPRE-PA.

Recombinant virus structure fluorogene selection green fluorescence gene (EGFP) or red fluorescent gene (tdTomato).

(3) prepared by attenuation, TK missings, highly sensitive HSV recombinant viruses

Extracting targeting shuttle vector pH129 Δ TK-hUbC- fluorogene-WPRE-PA, after linearization for enzyme restriction and extraction H129 viral genome cotransfection 293T cells, receipts sample is placed in -80 DEG C of refrigerators after cell whole lesion；Sampled through multigelation Infection neoblast determines whether that recombinant virus produces, and recombinates successful viral sample and removes wild-type virus by choosing spot purifying Remove, obtain the recombinant virus of purifying.

The controllable HSV recombinant viruses of attenuation blast, duplication can do following several respects application：

(1) application in nervous system gene transfer or loop tracer：

It is in confirmatory experiment that recombinant virus rH129 Δ TK-hUbC-tdTomato-WPRE 300nl stereotaxical injections is small Mouse hippocampus DG brain areas, perfusion slice imaging after 3 days.Recombinant virus is only confined to injection site hippocampus DG areas expression red fluorescence, The other brain areas of full brain are unmarked, and it is replication defect type to illustrate that TK lacks recombinant virus in axoneuron, and across cynapse ability is lost； The restructuring H129 viruses of missing TK genes show obvious hypotoxicity, in good condition, nothing after maincenter infecting mouse is observed 2 weeks in addition Dead mouse, and mouse death in general 3-5 days after wild strain H129 infection, illustrate that TK missing recombinant virus toxicity significantly reduces, The attenuation type recombinant virus can be used as nervous system gene transfer vector.

(2) direct motion is across single cynapse loop tracer study

HSV instruments virus progress cell-specific, direct motion are lacked across single cynapse tracer using TK to realize, are constructed in addition and are The auxiliary adeno-associated virus that Cre is relied on, compensated expression TK albumen is arranged, two kinds of virus combinations can carry out specific brain area specific cells class The direct motion one-level output loop tracks of type.Helper virus stereotaxical injection DAT-Cre mouse veutros are covered in confirmatory experiment Area (ventral tegmental area, VTA) brain area, mouse is in good condition after infection；With site injection rH129 Δs after 3 weeks TK-hUbC-tdTomato-WPRE viruses, perfusion slice imaging after 10 days.VTA dopaminergic neuron one-level output tokens arrive Brain area include the core groups such as basal nuclei group, incertitude zone, hypothalamus, central thalamus, outside habenular nucleus.Across the nerve of single cynapse mark First form is clear, and with specificity well.

Helper virus is that fusion is inserted into pAAV-EF1a-double floxed-hChR2 (H134R)-EYFP- Obtained between WPRE-HGHp A AscI and NheI restriction enzyme sites；Described fusion is among fluorogene and TK genes Introducing is separated with self cleavage peptide T 2A (self-cleaving 2A peptide, 2A) sequence.

The application of neural circuitry tracer study is not limited only to mouse, moreover it is possible to applied to zebra fish, rat, cavy, snow The neural circuitry mark of the animals such as ermine, tree shrew, non-human primates monkey.

(3) oncolytic activity research

The Unseparated Cell that TK missing HSV virus infection is dedifferented is replication defect type, it is impossible to replicates amplification progeny virus. And the virus can effectively infect division rich cells such as tumour cell etc. and realize self-replication.With the restructuring HSV energy of structure Infecting mouse neuroblastoma Neuro-2A cell lines simultaneously replicate amplification, and oncocyte is killed in final cracking.

The present invention compared with prior art, has advantages below and effect：

1. establishing flexible, efficient TK missings recombinant virus constructing system, by cloning homologous arm and introduce polyclonal Site joint, it is highly convenient for follow-up molecular genetic manipulation and inserts big gene or multiple transgenosis；

2. the present invention is prepared for the HSV recombinant viruses of a pair of stable high abundance expression greens or red fluorescence, it has sense Visualization feature is contaminated, is easy to carry out correlative study；

3. the novel recombinant viral toxicity of structure is greatly lowered, the expression of foreign gene-carrying energy high abundance, for nerve ring Road tracer does not have to as that need to do SABC with provirus version；The highly sensitive new HSV viruses of low toxicity can be used as nervous system high The gene transfer and gene therapy vector of effect；

4. rigorous, efficient, special direct motion is established across single cynapse tracer system based on new rHSV and AAV helper viruses System, the single-stage output regulated and control network of specific brain area particular type neuron can be effectively followed the trail of in the range of full brain；

5. HSV instruments virus infection host scope of the present invention is wide, rodent, mice, rat are not limited only to, is also applicable In the brain science research of the animals such as zebra fish, ferret, tree shrew, non-human primates monkey.

Brief description of the drawings

Fig. 1 is attenuation, TK missings, the targeting plasmid construction schematic diagram for being easy to exogenous gene expression frame to insert.

TK genes are located at genome antisense strand, expression direction from right to left；Compare for TK in shown homology arm direction.External source Gene expression frame direction and former TK genes are in opposite direction.

Fig. 2 is to carry green or the TK deletion form H129 recombinant viruses of red fluorescent protein gene build schematic diagram and its again It is prepared by group, purifying.

A：The H129 recombinant virus construction strategy schematic diagrames of TK missings, high expression fluorescence；

B：Recombinant virus chooses spot purifying and prepared by amplification.

Fig. 3 is novel recombinant viral rH129 Δ TK-hUbC-tdTomato-WPRE Infection label hippocampus of mice DG areas, 3 days Perfusion slice imaging result afterwards.

Fig. 4 be structure 3 kinds of Cre rely on, containing different fluorescence and express TK AAV core plasmid transfection 293T cells checking As a result.

A：Cre is relied on, the AAV core plasmid construction schematic diagrames of TK and EGFP amalgamation and expressions；

B：Cre relies on, containing different fluorescence and expresses TK AAV core plasmid transfection 293T cell fluorescence expressions.

Fig. 5 is the one-level output that VTA dopaminergic neurons are followed the trail of in the direct motion based on new HSV across single cynapse tracing system Loop.

A：Cre is relied on, compensation expression TK AAV helper virus stereotaxical injection DAT-Cre mouse VTA brain areas, after 3 weeks With site injection rH129 Δ TK-hUbC-tdTomato-WPRE recombinant viruses, perfusion slice imaging after 10 days；

B：Ventral tegmental area VTA dopaminergic neuron direct motion list cynapses are tagged to bed nucleus of stria terminalis (BNST) neuron；

C：VTA dopaminergic neuron direct motion list cynapses are tagged to outside habenular nucleus (LHb) neuron；

D：VTA dopaminergic neurons one-level output regulation and control thalamic paraventricular nucleus (PV) neuron.

Fig. 6 is rH129 Δs TK-hUbC-EGFP-WPRE recombinant viruses efficient infection and cracks neuroblastoma Neuro- 2A cytological maps.

Embodiment

Technical scheme of the present invention, it is the ordinary skill in the art if not otherwise specified.The reagent or material, If not otherwise specified, commercial channel is derived from.

Embodiment 1：

TK is knocked out, the flexible targeting shuttle plasmid for carrying foreign gene, and its construction method is as follows：

To build the recombinant virus of TK gene delections, the H129 genome sequences (GenBank inquired about first according to NCBI: GU734772.1), primer clone's TK genes both sides homology arm sequence is designed, wherein not retaining any TK CDS sequences.Selection gram Grand upstream homology arm sequence 1465bp, downstream homology arm sequence 1476bp.

Extracting and purifying HSV-1H129 virus genom DNAs, using it as template, as shown in figure 1, the homologous arm pieces of cloned upstream Section 1465bp, the primer UHAS-F：5'GCTAGCAGTGGGCCAAAAAGCCTAGC 3'；UHAS-R：5' AAGCTTACGCACGGGTGTTGGGTCGTTTG 3'；Cloned downstream homology arm piece segment length 1476bp, the primer DHAS-F： 5'AAGCTTGTTCGAGGCCACACGCGTCAC 3'；DHAS-R：5'CTCGAGGGGAAAGTCCGTGATGGTGC 3'；Due to HSV genome entirety G/C content is high, and homology arm sequence G/C content nearly 70%, fragment simultaneously is not easy to clone.Grope condition successful clone Two homology arms, then carried respectively by being connected into pcDNA3.1+ after Nhe I, Hind III and Xho I, Hind III digestions Body, it is named as pH129 Δs TK；

To introduce the multiple cloning sites joint containing multiple restriction enzyme sites among homology arm, using pH129 Δs TK as template, if Count primer pair H129 Δs TK-linker-F：5' TCAAGCTTAATTAAGTTAACATCGATCCTGCAGGCGCGCCGTTCGAGGCCACACGCGTC 3'；H129ΔTK- linker-R：5'GCCGGATCCAAATGAGTCTTCGGAC 3'；Design the 6 kinds of restriction endonuclease-Hind III-PacI- introduced HpaI-ClaI-SbfI-AscI- recognition sequences are located at forward primer 5' ends, the long 773bp of pcr amplified fragment, through Hind III, The pH129 Δ TK skeleton carriers through same digestion are connected into after BamHI digestions recovery, structure is obtained and inserted among upstream and downstream homology arm The targeting plasmid of multiple cloning sites joint, is named as pH129 Δ TK-linker, and sequence verification is completely correct；Build the target completed There is this multiple cloning sites joint to meet a variety of clone's needs to plasmid, greatly facilitate follow-up cloned foreign gene or control Expression element processed inserts targeting vector.

Embodiment 2：

Foreign gene high abundance expression cassette is cloned and structure insertion targeting vector, its step are as follows：

Exogenous gene expression frame is inserted into the targeting vector of the sequence containing homology arm by multiple cloning sites joint.It is outer to realize Source gene high abundance expression, promoter selection efficiently start the ubiquitin promoter of transcription, and ubiquitin system is widely present in eucaryon life Thing, the ubiquitin promoter in its gene family can significantly increase the long-term effect of gene expression, stability, and substantially thinless by tissue The limitation of born of the same parents.Groundhog hepatitis virus posttranscriptional regulatory element (WPRE) is introduced in gene ORF downstream simultaneously, WPRE can stablize RNA, it is remarkably reinforced exogenous protein expression ability.To prepare the H129tracer of tracer neural circuit, fluorescent reporter gene selection Most bright tdTomato genes in the strong enhanced green fluorogene EGFP of signal or red.

Specific steps include：By ubiquitin promoter (hUbC) (Genbank ID, GI with NheI, KpnI restriction enzyme site: 1304127) fragment and transcription enhancer elements WPRE (Genbank ID, GI with XbaI, ApaI restriction enzyme site: 939058940) fragment, it is connected into pcDNA3.1 (+) carrier through digestion and obtains pcDNA3.1-hUbC-WPRE carriers；

By EGFP or tdTomato genes, pcDNA3.1-hUbC-WPRE carriers are connected to by KpnI, XbaI enzyme cutting site HUbC and WPRE among；Subsequent design primer PCR clone obtains hUbC-EGFP-WPRE-PA or hUbC-tdTomato- The whole expression cassette large fragments of WPRE-PA, the primer UFWPA-F：5' CCTTAATTAAGCGCCGGGTTTTGGCGCCTCCCGCG 3' and UFWPA-R：5' TTGGCGCGCCATAGAGCCCACCGCATCCCCAGC 3'.Through AscI after gel extraction purifying fluorescence gene expression frame large fragment With the knockout TK gene targeting vector pH129 Δ TK-linker that build early stage are connected into after PacI double digestions, through digestion, sequencing Prove that the targeting shuttle vector of load fluorogene successfully constructs, obtain targetting shuttle vector pH129 Δs TK-hUbC-EGFP- WPRE-PA or targeting shuttle vector pH129 Δs TK-hUbC-tdTomato-WPRE-PA.

Embodiment 3：

It is attenuated blast, replicates the acquisition of controllable HSV recombinant viruses：

Extracting targeting shuttle vector pH129 Δ TK-hUbC-EGFP-WPRE-PA or pH129 Δs TK-hUbC-tdTomato- WPRE-PA, after linearization for enzyme restriction and extraction H129 viral genome cotransfection HEK 293T cells, liquid is changed after 6 hours containing 2% The maintenance culture medium of hyclone；(24-48 hours after nonspecific infection) receipts sample is placed in -80 DEG C after observation cell is all rounded lesion Refrigerator；Centrifuged through multigelation three times, 6500g and remove within 10 minutes cell fragment, draw 10 μ l viral supernatants vero cells infections, Observe infection cell whether there is luciferase expression to determine whether new virus recombinates success after 1 day；Later stage takes restructuring successfully virus The continuous 10 times of gradient dilutions postoperative infection Vero cells of supernatant, absorption spreads agar after 1 hour, and (DMEM containing 5% hyclone is cultivated Base and 2% agar 1：1 mixing).After 48-72hr after viral plaque is formed, carry out choosing spot under inverted fluorescence microscope；Novel heavy Group virus removes wild-type virus by the spot purifying of choosing of 6 wheel left and right, obtains the novel recombinant viral rH129 Δs TK- of purifying HUbC-EGFP-WPRE or rH129 Δs TK-hUbC-tdTomato-WPRE.The structure schematic diagram of two kinds of recombinant viruses, to choose spot pure Change and Fig. 2 is shown in amplification preparation.

Embodiment 4：

RH129 Δ TK-hUbC-EGFP-WPRE or rH129 Δs TK-hUbC-tdTomato-WPRE viruses expand, are dense Contracting, purifying：

African green monkey kidney epithelium Vero cell line or newborn hamster kidney cell BHK-21 are used to breed HSV viruses.Subculture Ratio is 1：3-6.Cell culture condition：Containing 10%FBS, 1% dual anti-DMEM culture mediums, virus is prepared by recombinant and expanded with containing 2%FBS maintenance culture medium；37 DEG C, 5%CO₂Condition of culture under cultivated.

HSV recombinant viruses (rH129 Δ TK-hUbC-EGFP-WPRE or rH129 Δ TK-hUbC-tdTomato-WPRE) with MOI=0.01 inoculation Vero cells, observation cell all expression fluorescence, after about 24-48 hours after cytopathy is rounded Cell conditioned medium is collected, -80 DEG C of refrigerators is placed in and keeps in；6500g is centrifuged 10 minutes and is removed cell fragment before concentration, through 0.45 μm of filter membrane 50000g centrifuges 3hr after filtering, and viral pellet centrifuges 3hr through 20% sucrose solution 50000g again after being resuspended, and removes supernatant, careful weight A small amount of multitube dispenses, is placed in -80 DEG C of refrigerators preservations after outstanding virus, avoids multigelation.

Embodiment 5：

Application of the HSV recombinant viruses in cranial nerve loop tracer：

To test the animal maincenter infection characterization of HSV recombinant viruses, by recombinant virus rH129 Δs TK-hUbC- TdTomato-WPRE 300nl stereotaxical injection hippocampus of mice DG brain areas, 3 days anesthetized animals after infection, with 0.9% (V/ V) Saline perfusion；Then fixed with 4% (V/V) paraformaldehyde, it is molten that taking-up brain tissue is soaked in 4% (V/V) paraformaldehyde In liquid, then brain tissue is first placed in 20% (V/V) sucrose solution 1 day, be subsequently placed in 30% (V/V) sucrose solution 2 days； Brain tissue bottom is cut flat with, embedding frost on base is placed in and is cut into slices after 1 hour；Brain piece is micro- using confocal fluorescent after preparing Sem observation.

Imaging results as shown in figure 3, HSV virus infection axoneuron after fluorescence obtain high efficient expression, can direct mirror Inspection is taken pictures, relative to need to do SABC before imaging from the HSV restructuring version labeled neurons of foreign procurement, need to further be put Big fluorescence signal.The recombinant virus of enhanced sensitivity be only confined to injection site hippocampus DG areas expression red fluorescence, the complete other brain areas of brain without Mark, illustrate that HSV recombinant viruses provided by the invention in axoneuron are replication defect types, across cynapse ability is lost, mark Pericaryon form understands, nerve fibre is also high-visible；Other HSV recombinant viruses neurotoxicity provided by the invention is notable Reduce, maincenter infecting mouse is in good condition after observing 2 weeks, without dead mouse, and general 3-5 days of mouse after wild strain H129 infection Death, illustrate that HSV recombinant viruses toxicity provided by the invention is greatly lowered really, these are all to establish HSV direct motions across single cynapse Tracing system has laid good basis, and the less toxic sensitizing type recombinant virus can also be used as nervous system Gene intervention or treatment in addition Carrier it is alternative.

Embodiment 6：

Cre is relied on, the AAV viral vectors structure containing different fluorescence and auxiliary expression TK

HSV instruments virus progress cell-specific, direct motion are lacked across single cynapse tracer using TK to realize, are constructed in addition and are Arrange three kinds of auxiliary adeno-associated viruses for containing different fluorogenes that Cre relied on, compensated expression TK albumen：

TK and green fluorescence gene co-expressing rAAV-EF1 α-DIO-EGFP2ATK-WPRE carriers；

TK and nuclear location red fluorescence coexpression rAAV-EF1 α-DIO- (HismCherry-2A-TK)-WPRE carriers；

RAAV-EF1 α-DIO- (HisBFP-2A-TK)-WPRE of TK and nuclear location blue-fluorescence gene co-expressing is aided in AAV carriers.

The present embodiment is illustrated exemplified by building rAAV-EF1 α-DIO-EGFP2ATK-WPRE carriers：

Construction method is as follows：Fluorescence protein gene and TK gene fusion expressions are designed, centre introduces and is separated with self cleavage polypeptide T2A (self-cleaving 2A peptide, 2A) sequence；EGFP-2A-TK fusion DNA vaccine fragments, its nucleotides sequence are classified as SEQ Shown in ID NO.1, it is connected into after the purifying of EGFP-2A-TK fusion DNA vaccine fragments glue reclaim after AscI and NheI digestions through same digestion AAV core skeleton carrier pAAV-EF1a-double floxed-hChR2 (H134R)-EYFP-WPRE-HGHpA (Addgene Plasmid#20298), hChR2 (H134R)-EYFP sequences original in 20298 plasmids are substituted for EGFP-2A-TK by the structure Sequence, and EGFP2ATK is swung to respect to EF1 α promoters；As shown in A in Fig. 4, EGFP-2A-TK both sides are DIO double LoxP sequences (Lox is in opposite direction in a pair of LoxP, a pair of Lox2722 and each team), DIO is double floxed Inverse ORF abbreviation.Cre recombinases can be specifically the sequence of swinging between double LoxP sequences is turned, external source base Cause is consistent with the change of promoter direction, so as to start the expression of target gene.

RAAV-EF1 α-DIO- (HismCherry-2A-TK)-WPRE construction method is same as described above, unique different It is that the fusion inserted between AscI and NheI restriction enzyme sites is separated with self cleavage to be introduced among HismCherry and TK genes Peptide T 2A (self-cleaving 2A peptide, 2A) sequence.

RAAV-EF1 α-DIO- (HisBFP-2A-TK)-WPRE construction method is same as described above, unique the difference is that inserting The fusion entered between AscI and NheI restriction enzyme sites is separated with self cleavage peptide T 2A to be introduced among HisBFP and TK genes (self-cleaving 2A peptide, 2A) sequence.

The three kinds of AAV core plasmid transfection 293T cell the results successfully constructed are as shown in B in Fig. 4.Three kinds of Cre according to Rely, carry the TK auxiliary expressions plasmid of different fluorescence only and during Cre plasmid co-transfections just to express corresponding fluorescence, no Cre plasmids Cotransfection does not express fluorescence then, No leakage expression, there is good specificity.The shaft-like disease that AAV viruses are established using laboratory The freshly prepared system of poison carries out packaging production.

Embodiment 7：

HSV recombinant viruses are in direct motion across the application in single cynapse loop tracer study：

TK genes are the indispensable genes that HSV is replicated in infection neuron, as previously described HSV restructuring disease provided by the invention Poison infection neuron can not start duplications, for replication defect type, will not across cynapse propagation.It is small in conventional Cre-line transgenosis In mouse model, the AAV helper viruses that HSV recombinant viruses provided by the invention rely on compensation expression TK with the use of Cre can be realized Specific brain area, cell type are special, the full brain tracking of across the one-level cynapse output loop of direct motion.

It is in confirmatory experiment that helper virus rAAV-EF1 α-DIO-EGFP2ATK-WPRE stereotaxical injections DAT-Cre is small Mouse VTA brain areas, mouse state after close observation infection, it is found that infecting mouse is in good condition；With site injection rH129 Δs after 3 weeks TK-hUbC-tdTomato-WPRE recombinant virus 300nl, mouse after observation infection daily, it is found that mouse is in good condition, do not occur Alarm the symptom such as hair, apocleisis, illustrate TK deletion forms HSV recombinant viruses provided by the invention in the case of conditionity duplication virulence compared with It is weak, infecting mouse will not be caused to produce obvious adverse reaction or symptom；Experience is marked according to early stage, the 10th after HSV infection Its processing anesthetized animal, it is abundant with 0.9% (V/V) Saline perfusion；Then fixed with 4% (V/V) paraformaldehyde, take out brain Sample is soaked in 4% (V/V) paraformaldehyde solution, then brain tissue is first placed in in 20% (V/V) sucrose solution 1 day, then It is placed in 30% (V/V) sucrose solution 2 days；Brain tissue bottom is cut flat with, embedding frost on base is placed in and is cut into slices after 1 hour；Brain Piece uses the micro- sem observation of confocal fluorescent after preparing.

As shown in figure 5, DAT-Cre mouse injection site only has VTA dopaminergic neuron specifically expressing Cre recombinases, TK the and GFP bases of AAV helper viruses carrying can only be started by Cre recombinases in these special dopaminergic neurons Because of expression, labeled upper green is visualized.After treating that AAV infection expression 3 weeks, fluorescin and TK albumen are given full expression to, together Site injection rH129 Δ TK-hUbC-tdTomato-WPRE recombinant viruses, HSV expression tdTomato red fluorescences.After 10 days There are many green red target yellow flag neurons altogether the visible injection site of perfusion slice imaging, and these are exactly real Starter Cell.Expressed in these Starter Cell because TK albumen compensates, rH129 Δs TK-hUbC-tdTomato- WPRE recombinant viruses are able to replicate amplification, and progeny virus direct motion is along axonal transport to the presynaptic, then across cynapse infection postsynaptic Neuron, and postsynaptic neuron is there is no the compensation of TK albumen, the HSV of genomic deletion TK genes can not realize duplication so as to not It can continue across the cynapse propagation of direct motion, and the tdTomato genes carried across the past defective virus of cynapse are because be by the general of wide spectrum Plain promoter driving normally high abundance can be expressed, and postsynaptic neuron is lighted, and be achieved that so as to overall from special Starter Cell direct motions export the full brain tracer of network across monosynaptic one-level.

In experiment VTA dopaminergic neurons one-level output token to brain area include basal nuclei group, incertitude zone, inferior colliculus The core groups such as brain, central thalamus, outside habenular nucleus.Clear across the neuron morphology of single cynapse mark, fiber, which marks, to be also clear that；From It is special well that habenular nucleus mark result can be seen that HSV recombinant viruses direct motion provided by the invention also has across single cynapse tracer Property, VTA dopaminergic neurons direct motion Habenular Neurons (LHb) on the outside of single cynapse is tagged to, and the neuron such as habenular nucleus middle part Unstressed configuration marks, and illustrates the neuron of VTA dopaminergic neuron specificity direct regulation and control habenular nucleus outside portion, rather than habenular nucleus whole Neuron.

Embodiment 8：

HSV recombinant virus oncolytic activity researchs, its step are：

8 ╳ 10 are inoculated with 6 porocyte culture plates⁵Individual tumor cell line Neuro-2A cells, in 37 DEG C, 5% (v/v) CO₂ Condition of culture cultivated.When degree of converging reaches 90% within second day, rH129 Δ TK-hUbC-EGFP-WPRE viruses are pressed According to MOI=0.1 infected tumors cell line Neuro-2A, distinguish 0h, 24h after infection, observed using inverted fluorescence microscope.Knot Fruit as shown in fig. 6, rH129 Δs TK-hUbC-EGFP-WPRE can effective feeling transfected tumor cell system, and stable express green fluorescence egg In vain.The gradual lesion of infected cell is rounded, and cell can crack death within 3 days or so.Illustrate TK deletion forms HSV weights provided by the invention Group virus can efficient infection tumour cell, and realize virus replication, cracking kill tumour cell.

Finally, it is also necessary to it is noted that the experimental method in above-described embodiment, is conventional method unless otherwise specified, And listed above is only several embodiments of the present invention.It is clear that the invention is not restricted to above example, can also have perhaps Shape changeable.All deformations that one of ordinary skill in the art directly can export or associate from present disclosure, It is considered as protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhan Inst. of Physics and Mathematics, Chinese Academy of Sciences

<120>It is a kind of to be attenuated blast, replicate controllable HSV recombinant viruses and preparation method and application

<130>It is a kind of to be attenuated blast, replicate controllable HSV recombinant viruses and preparation method and application

<160> 7

<170> PatentIn version 3.1

<210> 1

<211> 1902

<212> DNA

<213>Artificial sequence

<400> 1

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaaggag 720

ggcagaggaa gtctgctaac atgcggtgac gtcgaggaga atcctggccc aatggcttcg 780

tacccctgcc atcaacacgc gtctgcgttc gaccaggctg cgcgttctcg cggccatagc 840

aaccgacgta cggcgttgcg ccctcgccgg caacaagaag ccacggaagt ccgcctggag 900

cagaaaatgc ccacgctact gcgggtttat atagacggtc ctcacgggat ggggaaaacc 960

accaccacgc aactgctggt ggccctgggt tcgcgcgacg atatcgtcta cgtacccgag 1020

ccgatgactt actggcaggt gctgggggct tccgagacaa tcgcgaacat ctacaccaca 1080

caacaccgcc tcgaccaggg tgagatatcg gccggggacg cggcggtggt aatgacaagc 1140

gcccagataa caatgggcat gccttatgcc gtgaccgacg ccgttctggc tcctcatatc 1200

gggggggagg ctgggagctc acatgccccg cccccggccc tcaccctcat cttcgaccgc 1260

catcccatcg ccgccctcct gtgttacccg gccgcgcgat accttatggg cagcatgacc 1320

ccccaggccg tgctggcgtt cgtggccctc atcccgccga ccttgcccgg cacaaacatc 1380

gtgttggggg cccttccgga ggacagacac atcgaccgcc tggccaaacg ccagcgcccc 1440

ggcgagcggc ttgacctggc tatgctggcc gcgattcgcc gcgtttacga gctgcttgcc 1500

aatacggtgc ggtatctgca gggcggcggg tcgtggcggg aggattgggg acagctttcg 1560

gggacggccg tgccgcccca gggtgccgag ccccagagca acgcgggccc acgaccccat 1620

atcggggaca cgttatttac cctgtttcgg gcccccgagt tgctggcccc caacggcgac 1680

ctgtataacg tgtttgcctg ggccttggac gtcttggcca aacgcctccg tcccatgcac 1740

gtctttatcc tggattacga ccaatcgccc gccggctgcc gggacgccct gctgcaactt 1800

acctccggga tggtccagac ccacgtcacc acccccggct ccataccgac gatctgcgac 1860

ctggcgcgca cgtttgcccg ggagatgggg gaggctaact ga 1902

<210> 2

<211> 26

<212> DNA

<213>Artificial sequence

<400> 2

gctagcagtg ggccaaaaag cctagc 26

<210> 3

<211> 29

<212> DNA

<213>Artificial sequence

<400> 3

aagcttacgc acgggtgttg ggtcgtttg 29

<210> 4

<211> 27

<212> DNA

<213>Artificial sequence

<400> 4

aagcttgttc gaggccacac gcgtcac 27

<210> 5

<211> 26

<212> DNA

<213>Artificial sequence

<400> 5

ctcgagggga aagtccgtga tggtgc 26

<210> 6

<211> 59

<212> DNA

<213>Artificial sequence

<400> 6

tcaagcttaa ttaagttaac atcgatcctg caggcgcgcc gttcgaggcc acacgcgtc 59

<210> 7

<211> 25

<212> DNA

<213>Artificial sequence

<400> 7

gccggatcca aatgagtctt cggac 25

Claims (6)

1. a kind of be attenuated blast, replicate controllable HSV recombinant viruses, its preparation method includes：

（1）Homology arm is cloned and targeting plasmid construction

Extracting and purifying HSV-1 H129 virus genom DNAs, using it as template, clone TK upstream region of gene homology arm sequences 1465bp, the primer UHAS-F：5' GCTAGCAGTGGGCCAAAAAGCCTAGC 3'；UHAS-R：5' AAGCTTACGCACGGGTGTTGGGTCGTTTG 3'；Cloned downstream homology arm sequence 1476bp, the primer DHAS-F：5' AAGCTTGTTCGAGGCCACACGCGTCAC 3'；DHAS-R：5' CTCGAGGGGAAAGTCCGTGATGGTGC 3'；Clone's Upstream and downstream homology arm fragment is carried by being connected into pcDNA3.1+ after Nhe I, Hind III and Xho I, Hind III digestions respectively Body, it is named as pH129 Δs TK；

Using pH129 Δs TK as template, primer pair H129 Δs TK-linker-F is utilized：5' TCAAGCTTAATTAAGTTAACATCGATCCTGCAGGCGCGCCGTTCGAGGCCACACGCGTC 3'；H129ΔTK- linker-R：5' GCCGGATCCAAATGAGTCTTCGGAC 3'；Expanded, amplified production is through Hind III, BamHI enzymes The pH129 Δ TK skeleton carriers through same digestion are connected into after cutting back to close, it is polyclonal that structure obtains insertion among upstream and downstream homology arm The targeting plasmid of site joint, is named as pH129 Δ TK-linker, and sequence verification is completely correct；

（2）The ubiquitin promoter with NheI, KpnI restriction enzyme site will be designed（hUbC）Fragment and with XbaI, ApaI digestion position The transcription enhancer elements WPRE of point, it is connected into pcDNA3.1 (+) carrier through digestion and obtains pcDNA3.1-hUbC-WPRE carriers；Then Fluorogene is connected among hUbC and WPRE by KpnI, XbaI enzyme cutting site；It is glimmering that follow-up overall clone PCR obtains hUbC- The whole expression cassette large fragments of photogene-WPRE-PA, carrier pH129 Δs TK- is connected into by PacI and AscI restriction enzyme sites Linker, vector construction success is proved through digestion, sequencing, is named as pH129 Δ TK-hUbC- fluorogenes-WPRE-PA；

Described fluorogene is green fluorescence gene or red fluorescent gene；

（3）It is prepared by attenuation, TK missings, highly sensitive HSV recombinant viruses

Extract and target shuttle vector pH129 Δ TK-hUbC- fluorogene-WPRE-PA, the H129 after linearization for enzyme restriction with extraction Viral genome cotransfection 293T cells, receipts sample is placed in -80 DEG C of refrigerators after cell whole lesion；Sample and infect through multigelation Neoblast determines whether that recombinant virus produces, and recombinates successful viral sample and removes wild-type virus by choosing spot purifying, Obtain the recombinant virus of purifying.

2. application of the HSV recombinant viruses in the research of cranial nerve loop described in claim 1.

3. application according to claim 2, the object of described neural circuitry tracer study includes mouse, zebra fish, big Mouse, cavy, ferret, tree shrew, the neural circuitry mark of non-human primates monkey.

4. the HSV recombinant viruses described in claim 1 are in direct motion across the application in single cynapse loop tracer study.

5. application according to claim 4, described application process includes helper virus, and the helper virus is that will merge base Because inserting pAAV-EF1a-double floxed-hChR2 (H134R)-EYFP-WPRE-HGHpA AscI and NheI digestions position Obtained between point；Described fusion is to introduce to be separated with self cleavage peptide T 2A among fluorogene and TK genes（self- cleaving 2A peptide, 2A）Sequence.

6. the application in the research of HSV recombinant viruses oncolytic described in claim 1.