WO2022232348A1 - Angiotensin-converting enzyme ii (ace2) transgenic animal and uses thereof - Google Patents

Abstract

The present invention relates to an angiotensin-converting enzyme II (ACE2) transgenic animal and uses thereof. Specifically, the ACE2 transgenic animals of the present invention are susceptible to SARS-CoV-2 infection and the infected animals exhibit clinic features of human with SARS-CoV-2 infection which are useful in the development of relevant vaccines and therapeutic treatments.

Description

TITLE OF THE INVENTION

ANGIOTENSIN-CONVERTING ENZYME II (ACE2) TRANSGENIC ANIMAL AND USES THEREOF

RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. provisional application number 63/180,861, filed April 28, 2021 under 35 U.S.C. §119, the entire content of which is incorporated herein by reference.

TECHNOLOGY FIELD

[0002] The present invention relates to an angiotensin-converting enzyme II (ACE2) transgenic animal and uses thereof. Specifically, the ACE2 transgenic animals of the present invention are susceptible to SARS-CoV-2 infection and the infected animals exhibit clinic features of human with SARS-CoV-2 infection which are useful in the development of relevant vaccines and therapeutic treatments.

BACKGROUND OF THE INVENTION

[0003] Since the outbreak of Coronavirus disease 2019 (COVID-19), more than 84 million cases have been confirmed worldwide and almost 1.8 million people have died (https://covidl9.who.int/, WHO Coronavirus Disease (COVID-19) Dashboard, 2021/1/4 updated). COVID-19 is a novel infectious disease caused by SARS-CoV-2 virus [1, 2] SARS-CoV-2 binds to the receptors angiotensin-converting enzyme 2 (ACE2) and neuropilin-1 (NRPl) on host cells via its Spike envelope glycoprotein [3] Small animal models that respond to SARS-CoV-2 infection and mimic resulting clinical symptoms and pathologies are crucial to model COVID-19 for mechanistic study, vaccine development and potential therapy.

[0004] To date, mustelids, some felids and rodents, and various nonhuman primates have exhibited susceptibility to SARS-CoV-2 infection. However, infection in those species does not result in clinical diseases resembling those reported for human [4, 5] Mice are not susceptible to SARS-CoV-2 infection because of Ace2 sequence variation [5] Thus, establishing a genetically-modified mouse model that expresses hACE2 would provide valuable insights into clinically-relevant disease pathogenesis. Accordingly, several mouse models have already been established to study COVID-19. First, K18-ACE2 transgenic mice that express a hACE2 transgene under the control of the human K18 promoter were established for SARS-CoV study a decade ago, representing the first available mouse model for SARS-CoV-2 infection [6, 7] Later, adenovirus type 5 was used to deliver and transiently express hACE2 in mice [8, 9], and inducible hACE2 expression was established in rtTA-hACE2 transgenic mice [10] for SARS-CoV-2 study. HFH4-hACE2 transgenic mice that express ahACE2 transgene driven by the hepatocyte nuclear factor-3/forkhead homologue 4 (HFH4) promoter have since been developed [11] In addition to ectopic expression of hACE2 under the control of other gene promoters, mAce2-hACE2 transgenic mice [12] and hACE2- knockinmice [13] in which the mouse Ace2 promoter is used to drive hACE2 transgene expression have also been generated. However, certain human specific responses to SARS-CoV-2 infection e.g. sex-biased responses observed among human patients and severe clinical symptoms including neurological symptoms have not been investigated in mouse models.

[0005] There is a need to provide a suitable animal model which not only is susceptibility to SARS-CoV-2 infection but also exhibits clinical symptoms for human.

SUMMARY OF THE INVENTION

[0006] In the present invention, a transgene cassette that expresses human angiotensin-converting enzyme 2 (hACE2) under control of a CAG promoter is provided and a transgenic non-human animal using the cassette is generated as an animal model for SARS-CoV-2 infection. Particularly, the transgenic animals of the present invention are highly susceptible to SARS-CoV-2 infection and the animals after viral challenging exhibit clinic features of human with SARS-CoV-2 infection e.g. sex-biased responses observed among human patients and severe clinical symptoms such as neurological symptoms, which are useful in the development of relevant vaccines and therapeutic treatments.

[0007] Therefore, in one aspect, the present invention provides a transgenic non human animal having a genome comprising an expression cassette which comprises a transgene encoding hACE2 under the control of a CAG promoter. Preferably, the expression cassette is optionally flanked by at least one insulator.

[0008] In some embodiments, the insulator is a chicken beta-globin 5'HS4 insulator (HS4 insulator). [0009] In some embodiments, the expression cassette is flanked by two copies of the HS4 insulator at 5'end and two copies of the HS4 insulator at 3'end.

[00010] In some embodiments, the expression cassette further comprises a nucleic acid sequence encoding a marker or tag fused with hACE2. In certain examples, the tag is a hemagglutinin (HA) tag.

[00011] In some embodiments, the expression cassette further comprises a Kozak sequence at the start of the hACE2 coding sequence in the transgene.

[00012] In some particular embodiments, the expression cassette comprises from 5' to 3' the following elements: two copies of a HS4 insulator; a CAG promoter; a Kozak sequence; a transgene encoding hACE2; a HA-tag coding sequence; and two copies of a HS4 insulator.

[00013] In some embodiments, the hACE2 comprises an amino acid sequence set forth in SEQ ID NO: 1.

[00014] In some embodiments, the transgene comprises a nucleotide sequence set forth in SEQ ID NO: 2; the CAG promoter comprises a nucleotide sequence set forth in SEQ ID NO: 3; and/or the insulator comprises a nucleotide sequence set forth in SEQ ID NO: 4.

[00015] In some embodiments, the Kozak sequence comprises a nucleotide sequence of GCCACC.

[00016] In some embodiments, the HA tag comprises an amino acid sequence set forth in SEQ ID NO: 5.

[00017] In some embodiments, the nucleic acid sequence encoding the HA tag comprises a nucleotide sequence set forth in SEQ ID NO: 6.

[00018] In some embodiments, the expression cassette comprises a nucleotide sequence set forth in SEQ ID NO: 7 or 8.

[00019] In some embodiments, the transgenic non-human animal is a mouse.

[00020] In some embodiments, the transgenic non-human animal exhibits protein expression of hACE2 in one or more organs including lung, kidney, brain, duodenum, heart and liver.

[00021] The present invention also provides an expression cassette including a hACE2 transgene under the control of a CAG promoter as above-described. Also provided is a nucleic acid construct comprising an expression cassette as described herein.

[00022] In another aspect, the present invention provides a method for producing a transgenic non-human animal expressing hACE2, comprising

(a) introducing an expression cassette including a hACE2 transgene as describe herein into a zygote of an animal;

(b) transplanting the zygote into a pseudopregnant animal;

(c) allowing the zygote to develop to term; and

(d)identifying a transgenic offspring containing the transgene.

[00023] In a further aspect, the present invention provides a method for generating an animal model for viral infection in a subject for which ACE2 is required, comprising

(a) providing a transgenic non-human animal as described herein; and

(b) challenging the animal with a virus which uses ACE2 for entry, said animal exhibiting one or more symptoms or condition characteristics associated with such viral infection.

[00024] In a still further aspect, the present invention provides a method of screening for a candidate agent for treating viral infection in a subject for which ACE2 is required, comprising

(a) providing a transgenic non-human animal as described herein;

(b) challenging the animal with a virus which uses ACE2 for entry, said animal exhibiting one or more symptoms or condition characteristics associated with such viral infection;

(c) administering a test agent to the animal; and

(d) determining whether at least one of the symptom or condition characteristics is reduced or alleviated in result of the administration of the agent.

[00025] Also provided is use of a transgenic non-human animal as described herein as an animal model for viral infection in a subject for which ACE2 is required, or for screening for a candidate agent for treating viral infection in a subject for which ACE2 is required. Specifically, the animal model exhibits one or more symptoms or condition characteristics associated with such viral infection observed in human. [00026] In some embodiments, the one or more symptoms or condition characteristics include damages in one or more organs selected from the group of lung, kidney, brain, duodenum, heart and liver.

[00027] In some embodiments, the one or more symptoms or condition characteristics include six-biased responses to the viral infection.

[00028] In some embodiments, the one or more symptoms or condition characteristics include neuropsychiatric symptoms.

[00029] In some embodiments, in step (c), the test agent is administrated to the animal prior to or after the virus challenging.

[00030] In some embodiments, the virus is a coronavirus.

[00031] In some embodiments, the coronavirus is selected from the group consisting of severe acute respiratory syndrome coronavirus (SARS-CoV) and novel coronavirus (SARS-CoV2).

[00032] The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention will be apparent from the following detailed description of several embodiments, and also from the appending claims.

BRIEF DESCRIPTION OF THE DRAWINGS [00033] The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities shown.

[00034] In the drawings:

[00035] Figs. 1A to 1C. Establishment of CAG-hACE2 transgenic mice. (Fig.

1A) Transgene design for generation of CAG-hACE2 transgenic mice. Corresponding positions of hACE2- specific primers for genomic PCR are indicated. (Fig. IB) Identification of CAG-hACE2 transgenic mice using genomic PCR. Human ACE2 cDNA fragment were detected in transgenic samples (lane #1,#5,#8 and #9). The reaming samples were wild-type control samples. (Fig. 1C) Transgene copy number analysis using ddPCR. The upper panels are one-dimensional plots of droplets measured for fluorescence signal (amplitude indicated on v- ax is) emitted from the hACE2 transgene and Tbpn (reference gene). The lower panels show the copy number evaluated in QuantaSoft^™ (left panel), with parallel PCR results (right panel). [00036] Figs. 2A to 2C. Human ACE2 protein expression in CAG-hACE2 transgenic mice. (Fig. 2A) Multiple tissue analysis of hACE2 protein expression in CAG-hACE2 transgenic mice (Tg) and WT littermates. (Fig. 2B) Multiple tissue analysis of hACE2 protein in female (F) and male (M) transgenic mice. In both (Fig. 2A) and (Fig. 2B), HA and human ACE2-specific antibodies were used to detect hACE2-HA proteins. HSP90 was used as a loading control. (Fig. 2C)

Immunostaining of hACE2 protein expression in male and female tissues of WT and CAG-hACE2 transgenic mice. Scale bars, 25 mm. Duod. = duodenum.

[00037] Figs. 3A to 3B. Susceptibility of CAG-hACE2 transgenic mice to SARS- CoV-2 infection. (Fig. 3A) The experimental scheme for SARS-CoV-2 infection of CAG-hACE2 transgenic mice. (Fig. 3B) Body weight changes of CAG-hACE2 transgenic mice (open bars) and control mice (filled bars) upon SARS-CoV-2 infection at 5x10⁵ PFU. The line GT5-027 and GT4-008 line are represented by closed and open circles, respectively. Dead mice were shown in red. Unpaired t-test: *,p< 0.05; **,/?<0.01; ***, p<0.005. D.P.I., days post-infection.

[00038] Figs. 4A to 4E. Differential responses of male and female CAG-hACE2 transgenic mice to different titers of SARS-CoV-2. (Fig. 4A) The experimental scheme for SARS-CoV-2 infection at 10⁵, 10⁴, 10³ and 10² PFU in CAG-hACE2 transgenic mice. (Fig. 4B) Changes in body weight of CAG-hACE2 transgenic mice after infection with 10⁵, 10⁴, 10³ or 10²PFU SARS-CoV-2. (Fig. 4C), (Fig. 4D) Survival curve of (Fig. 4C) male and (Fig. 4D) female CAG-hACE2 transgenic mice upon infection with 10⁵, 10⁴, 10³ and 10²PFU SARS-CoV-2. (Fig. 4E) Changes in body weight of CAG-hACE2 transgenic mice challenged with different titers of SARS-CoV-2. Five male and three female mice were assessed for each titer. Bars represent mean value and dots show data for individual mice. Unpaired t-test: *,p < 0.05; **; p < 0.01.

[00039] Fig. 5. The hACE2 transgene is expressed in primary neuronal culture.

Neuronal cultures were prepared using the dorsocaudal cortex and hippocampus of hACE2 transgenic mice and WT littermates. At DIV 10, WT and hACE2 transgenic neuronal cultures were subjected to immunofluorescent staining with HA and hACE2 antibodies to investigate hACE2 expression. Colocalization of HA and hACE2 immunoreactivities supports the specificity of immunostaining. Scale bar, 10 pm. [00040] Figs. 6A to 6B. The hACE2 transgene is expressed in both neurons and astrocytes. Similar to Fig. 5, neuronal cultures at DIV 10 were subjected to immunostaining using hACE2 (Fig. 6A and Fig. 6B upper panel) or HA (Fig. 6A and Fig. 6B lower panel) antibody, combined with neuronal marker MAP2 (Fig. 6A) or astrocyte marker GFAP (Fig. 6B) antibody. Scale bar, 10 pm.

[00041] Figs. 7A to 7B. Infection of a pseudovirus expressing SARS-CoV-2 Spike protein into hACE2 transgene-expressing neurons and astrocytes. At DIV 10, neuronal cultures of hACE2 transgenic mice were challenged with SARS-CoV-2 Spike pseudovirus carrying GFP as a reporter. Cells were fixed eight days later and immunostained using GFP antibody combined with MAP2 (Fig. 7A) or GFAP (Fig. 7B) antibodies. MAP2 and GFAP are neuronal and astrocyte markers, respectively. Scale bar, 20 pm.

[00042] Figs. 8A to 8C. Alteration of mEPSCs by SARS-CoV-2 Spike protein. (Fig. 8A) Representative traces illustrating mEPSCs of cultured neurons transfected with vector control (black) or SARS-CoV-2 Spike protein (red). (Fig. 8B) Summary plots of average mEPSC amplitude (left) and average mEPSC frequency (right) in control (n = 8) and Spike groups (n = 10). Each dot indicates the result of an individual recording. Mean ± SEM are also shown. Mann- Whitney U test; * p < 0.05. (Fig. 8C) Cumulative distribution of mEPSC amplitude (left) and inter-event intervals (right) recorded in control and Spike groups.

[00043] Fig. 9. The nucleotide sequences of the expression cassette of the present invention. Blue: Notl restriction site. Gray: insulator (SEQ ID NO: 4). Purple: CAG promoter (SEQ ID NO: 3). Underlined: Kozak sequence. Red: hACE2 cDNA (SEQ ID NO: 2). Green: HA tag coding sequence (SEQ ID NO: 6).

Borders: stop codon. Full length (without Notl restriction site) (SEQ ID NO: 7).

Full length (with Notl restriction site) (SEQ ID NO: 8).

[00044] Fig. 10. The amino acid sequence of hACE2 (SEQ ID NO: 1). The amino acid sequence of HA (SEQ ID NO: 5).

DETAILED DESCRIPTION OF THE INVENTION [00045] The following description is merely intended to illustrate various embodiments of the invention. As such, specific embodiments or modifications discussed herein are not to be construed as limitations to the scope of the invention.

It will be apparent to one skilled in the art that various changes or equivalents may be made without departing from the scope of the invention.

[00046] In order to provide a clear and ready understanding of the present invention, certain terms are first defined. Additional definitions are set forth throughout the detailed description. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as is commonly understood by one of skill in the art to which this invention belongs.

[00047] As used herein, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a component” includes a plurality of such components and equivalents thereof known to those skilled in the art.

[00048] The term “comprise” or “comprising” is generally used in the sense of include/including which means permitting the presence of one or more features, ingredients or components. The term “comprise” or “comprising” encompasses the term “consists” or “consisting of.”

[00049] As described herein, angiotensin-converting enzyme II (ACE2) is known as a peptidase of the renin-angiotensin system (RAS) components which regulate fluid balance, blood pressure and maintains vascular tone. ACE2 also has been reported to serve as the receptor for the entry of SARS-CoV and SARS-CoV-2 infection. The amino acid sequence of human ACE2 (hACE2) and the corresponding oligonucleotide sequence encoding the same can be readily available from publically available gene database. Specifically, hACE2 has the amino acid sequence as set forth in SEQ ID NO: 1 and the corresponding nucleotide coding sequence is as set forth in SEQ ID NO: 2.

[00050] As used herein, the term “nucleic acid” or “polynucleotide” can refer to a polymer composed of nucleotide units. Polynucleotides include naturally occurring nucleic acids, such as deoxyribonucleic acid (“DNA”) and ribonucleic acid (“RNA”) as well as nucleic acid analogs including those which have non-naturally occurring nucleotides. Polynucleotides can be synthesized, for example, using an automated DNA synthesizer. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which “U” replaces “T.” The term “cDNA” refers to a DNA that is complementary or identical to an mRNA, in either single stranded or double stranded form.

[00051] As used herein, the term “polypeptide” refers to a polymer composed of amino acid residues linked via peptide bonds. The term “protein” typically refers to relatively large polypeptides. The term “peptide” typically refers to relatively short polypeptides (e.g., containing up to 100, 90, 70, 50, 30, 20 or 10 amino acid residues). [00052] As used herein, the term “encoding” refers to the natural property of specific sequences of nucleotides in a polynucleotide (e.g., a gene, a cDNA, or an mRNA) to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a given sequence of RNA transcripts (i.e., rRNA, tRNA and mRNA) or a given sequence of amino acids and the biological properties resulting therefrom. Therefore, a gene encodes a protein if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system. As used herein, a “coding sequence” or a sequence “encoding” an expression product, such as a RNA or polypeptide, is a nucleotide sequence that, when expressed, results in the production of that RNA or polypeptide i.e., the nucleotide sequence encodes an amino acid sequence for that polypeptide. A coding sequence for a protein may include a start codon (usually ATG) and a stop codon. It is understood by a skilled person that numerous different polynucleotides and nucleic acids can encode the same polypeptide as a result of the degeneracy of the genetic code. It is also understood that skilled persons may, using routine techniques, make nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides described there to reflect the codon usage of any particular host organism in which the polypeptides are to be expressed. Therefore, unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” encompasses all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.

[00053] In general, a functional variant of a polynucleotide is substantially identical to the reference sequence e.g. nucleotide sequence identity of more than 50%, generally more than about 60%-70%, even more particularly about 80%-85% or more, such as at least about 90%-95% or more, when the two sequences are aligned. Also, a functional variant of a polypeptide is substantially identical to the reference sequence e.g. amino acid sequence identity of more than 50%, generally more than about 60%-70%, even more particularly about 80%-85% or more, such as at least about 90%-95% or more, when the two sequences are aligned. To determine the percent identity of two sequences, the sequences can be aligned for optimal comparison purpose. In calculating percent identity, typically exact matches are counted. The determination of percent homology or identity between two sequences can be accomplished using a mathematical algorithm known in the art, such as BLAST and Gapped BLAST programs, the NBLAST and XBLAST programs, or the ALIGN program.

[00054] As used herein, the term “gene” refers to a nucleic acid comprising an open reading frame encoding a polypeptide of interest, including both exon and (optionally) intron sequences. The term “transgene” refers to an exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal. A “transgenic animal” refers to an animal containing a transgene. A transgenic animal includes a non human animal, such as a mammal, e.g., a rodent such as guinea pig, rat, mouse or the like, or a lagomorph such as a rabbit, in which one or more of the cells of the animal includes a transgene.

[00055] As used herein, the term “nucleic acid construct” usually refers to a man made nucleic acid molecule having sequences that are not naturally joined together.

A nucleic acid construct may be present in the form of a vector, for example, for expressing the given nucleotide sequence (expression vector) or maintaining the given nucleotide sequence for replicating it, manipulating it or transferring it between different locations (e.g., between different organisms). Common types of vectors include plasmids, phages and viruses. A nucleic acid construct can include a gene of interest to be transcribed and elements that control the expression of the gene (e.g., a promoter). Particularly, a nucleic acid construct may further contain a marker sequence (e.g., an antibiotic resistant marker sequence) for the screening procedure. Examples of such markers include, but are not limited to, neomycin (neo), puromycin (Puro), the Herpes simplex virus type 1 thymidine kinase, adenine phosphoribosyltransferase and hypoxanthine phosphoribosyltransferase. For purpose of detection, a nucleic acid construct may further comprise a nucleic acid sequence encoding a detection tag enabling a convenient detection of the gene product as expressed. A detection tag is preferably in small in size that does not affect the desired activity of the gene product to which it is fused. Specifically, the tag is of about 30 amino acid residues or less, e.g. about 20 amino acid residues or less, about 10 amino acid residues or less. Examples of such tag include, but is not limited to a histidine (His)-tag, a Myc-tag and a HA-tag. A particular example of a nucleic acid sequence encoding a HA-tag is SEQ ID NO: 6. [00056] As used herein, the term "expression cassette" refers to a segment of a nucleic acid molecule which comprises a series of specified nucleic acid elements that permits transcription of a particular nucleotide sequence in a target cell. A typical expression cassette contains a promoter operably linked to the particular nucleotide sequence of choice. An expression cassette can be incorporated into a vector or chromosome.

[00057] As used herein, a “promoter” refers to a non-coding genomic DNA sequence that that directs the transcription of a gene. The term “constitutive promoter” refers to a promoter that continually or continuously allows for transcription of a nucleotide sequence operatively linked to it or under its control. A constitutive promoter may be a “ubiquitous promoter” that allows expression in a wide variety of cell and tissue types or a “tissue-specific promoter” that allows expression in a restricted variety of cell and tissue types. A CAG promoter is a ubiquitous promoter that comprises a hybrid CMV enhancer coupled to a modified chicken b-actin promoter. Specifically, a CAG promoter comprises: (i) the cytomegalovirus (CMV) early enhancer element, (ii) the promoter, first exon and the first intron of chicken beta-actin gene, and (iii) splice acceptor of the rabbit beta- globin gene. One certain example of the CAG promoter is represented by SEQ ID NO: 3. The CAG promoter also includes a functional variant of SEQ ID NO: 3 (e.g. having 70% identity or more, preferably 75% identity or more, more preferably 80% identity or more, even more preferably 85% identity or more, still even more preferably 90% identity or more, and most preferably 95% identity or more with SEQ ID NO: 3) as an active promoter as descried herein.

[00058] As used herein, the term “insulator” refers to a nucleic acid sequence which prevents the influence of other nearby regulatory sequences in the expression of the gene of interest. The insulator sequence can be placed upstream or downstream of the gene of interest to have the insulating effect on the gene. Preferably, at least one copy of the insulator sequence may be used in the invention. In some embodiments, the insulator is an insulator from a b-globin locus, such as chicken HS4, including the full-length insulator elements and elements that are derived therefrom such as fragments of the insulator elements (e.g. HS4 fragments) so long as they retain function as an insulator. The length of the insulator may generally be from 100, 200, 300 or 400 bases up 1000, 1500, 2000, 2500, 3000 or more bases in length. One certain example of an HS4 insulator is represented by SEQ ID NO: 4. The HS4 promoter may include a functional variant of SEQ ID NO: 4 (e.g. having 70% identity or more, preferably 75% identity or more, more preferably 80% identity or more, even more preferably 85% identity or more, still even more preferably 90% identity or more, and most preferably 95% identity or more with SEQ ID NO:4) as a functional insulator as descried herein.

[00059] As used herein, the term “Kozak sequence” is a short nucleotide sequence that facilitates efficient initiation of translation of mRNA. Atypical consensus Kozak sequence is GCCRCC where R is a purine (A or G) located directly upstream of the translation start codon ATG. One certain example of a Kozak sequence is represented by SEQ ID NO: 5 (gccaccATGt) where the ATG is the start codon.

[00060] The present invention is based, at least in part, on the development of a transgenic non-human animal in which a transgene encoding hACE2 has been inserted into the genome under control of a CAG promoter. It is surprisingly found that such transgenic animal confers at least the following features: high susceptibility to SARS-CoV-2 infection, expression of hACE2 in various organs and development of clinic features in human patients and more severe symptoms.

[00061] As demonstrated in the working examples as shown below, we first established a transgenic mouse line in which hACE2 is ubiquitously expressed under the control of the CAG promoter. The transgenic mice proved highly susceptible to SARS-CoV-2 challenge, with a virus titer of 100 PFU being sufficient to induce lethality. Moreover, the female and male transgenic mice exhibited differential responses to SARS-CoV-2 infection. Finally, we also show that cultured neurons and glial cells prepared from our CAG-hACE2 transgenic mice were readily infected by pseudovirus expressing SARS-CoV-2 Spike proteins. In conclusion, this new mouse line serves as an appropriate model for severe COVID-19 disease, enabling investigations of sex-biased responses to SARS-CoV-2 infection and its impact on various tissues, including the brain. The transgenic model will be valuable for vaccine development and evaluating COVID-19 therapies.

[00062] Therefore, the present invention provides a transgenic non-human animal having a genome comprising an expression cassette which comprises a transgene encoding hACE2 under the control of a CAG promoter. The present invention also provides an expression cassette including the hACE2 transgene under the control of a CAG promoter as described herein. Also provided is a nucleic acid construct comprising the expression cassette. [00063] Preferably, the expression cassette is flanked by at least one insulator, e.g. two insulators, three insulators, or four insulators. One exemplified insulator is a HS4 insulator. In some embodiments, the expression cassette is flanked by two copies of aHS4 insulator at 5'end and two copies of aHS4 insulator at 3'end.

[00064] In some embodiments, the expression cassette further comprises a nucleic acid sequence encoding a tag fused with hACE2. In some embodiments, the expression cassette further comprises a Kozak sequence at the start of the hACE2 coding sequence in the transgene.

[00065] In some particular embodiments, the expression cassette comprises from 5' to 3' the following elements: a HS4 insulator; a CAG promoter; a transgene encoding hACE2; and a HS4 insulator.

[00066] In some particular embodiments, the expression cassette comprises from 5' to 3' the following elements: two copies of a HS4 insulator; a CAG promoter; a transgene encoding hACE2; and two copies of a HS4 insulator.

[00067] In some particular embodiments, the expression cassette comprises from 5' to 3' the following elements: two copies of a HS4 insulator; a CAG promoter; a Kozak sequence; a transgene encoding hACE2; a HA-tag coding nucleotide sequence; and two copies of a HS4 insulator.

[00068] In some embodiments, the expression cassette comprises a nucleotide sequence set forth in SEQ ID NO: 7 or 8.

[00069] In another aspect, the present invention provides a method for producing a transgenic non-human animal expressing hACE2 as described herein. In particular, the method of the present invention comprises the steps as follows: (a) introducing an expression cassette including a hACE2 transgene as describe herein into a zygote of an animal;

(b) transplanting the zygote into a pseudopregnant animal;

(c) allowing the zygote to develop to term; and

(d) identifying a transgenic offspring containing the transgene.

[00070] Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009 and Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).

[00071] According to the present invention, a transgenic non-human animal expressing hACE2 as described herein is susceptibility to SARS-CoV-2 infection which therefore can be used as an animal model for SARS-CoV-2 infection.

[00072] Therefore, in a further aspect, the present invention describes a method for generating an animal model for viral infection in a subject for which ACE2 is required. In particular, the method of the present invention comprises the steps as follows:

(a) providing a transgenic non-human animal as described herein; and

(b) challenging the animal with a virus which uses ACE2 for entry, said animal exhibiting one or more symptoms or condition characteristics associated with such viral infection.

[00073] Specifically, in step (b), the animal is challenged with the virus at an effective dose. In some embodiments, the dose is lxl 0⁵ pfu, lxl 0⁴ pfu or lxl 0³ pfu. In some embodiments, a low dose is preferred, such as less than lxlO³ pfu, e.g. lxlO² pfu or less. After the viral challenging, an animal line exhibiting one or more symptoms or condition characteristics associated with such viral infection is identified and selected.

[00074] The animal model can be used for screening for a candidate agent for viral infection for which ACE2 is required. Therefore, the present invention further provides a method as a platform for screening for a candidate agent for viral infection for which ACE2 is required using the animal model as described herein. In particular, the method of the present invention comprises the steps as follows:

(a) providing a transgenic non-human animal as described herein;

(b) challenging the animal with a virus which uses ACE2 for entry, said animal exhibiting one or more symptoms or condition characteristics associated with such viral infection;

(c) administering a test agent to the animal; and

(d) determining whether at least one of the symptom or condition characteristics is reduced or alleviated in result of the administration of the agent.

[00075] Specifically, the virus which uses ACE2 for entry is a coronavirus.

Examples of such virus are SARS-CoV and SARS-CoV2.

[00076] Specifically, the animal model exhibits one or more symptoms or condition characteristics associated with such viral infection observed in human, and therefore can be used as a model for SARS-CoV-2 infection in human.

[00077] In some embodiments, the transgenic non-human animal after the viral challenge exhibits one or more symptoms or condition characteristics associated with such viral infection, including damages in diverse organs such as lung, kidney, brain, duodenum, heart and liver. Such symptoms or condition characteristics also include six-biased responses to the viral infection that female animals are relatively resistant to the viral infection e.g. lower lethality and a lower degree of body loss when compared to male animals. In one certain embodiment, the transgenic non-human animal after the viral challenge exhibits damages in brain and develops neuropsychiatric symptoms.

[00078] In some embodiments, in step (c), the test agent is administrated to the animal prior to or after the virus challenging.

[00079] In certain embodiments, the test agent is a small molecular compound or a vaccine.

[00080] The present invention is further illustrated by the following examples, which are provided for the purpose of demonstration rather than limitation. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[00081] Examples

[00082] The COVID-19 pandemic is caused by SARS-CoV-2 infection. Human angiotensin-converting enzyme II (hACE2) has been identified as the receptor enabling SARS-CoV-2 host entry. To establish a mouse model for COVID-19, we generated transgenic mouse lines using the (HS4)2-pCAG-hACE2-HA-(HS4)2 transgene cassette, which expresses HA-tagged hACE2 under control of the CAG promoter and is flanked by HS4 insulators. Expression levels of the hACE2 transgene are respectively higher in lung, brain and kidney of our CAG-hACE2 transgenic mice and relatively lower in duodenum, heart and liver. The CAG-hACE2 mice are highly susceptibility to SARS-CoV-2 infection, with 100 PFU of SARS-CoV-2 being sufficient to induce 87.5% mortality at 9 days post-infection and resulting in a sole (female) survivor. Mortality was 100% at the higher titer of 1000 PFU. At lower viral titers, we also found that female mice exposed to SARS-CoV-2 infection suffered much less weight loss than male mice, implying sex-biased responses to SARS-CoV-2 infection. We subjected neuronal cultures to SARS-CoV-2 pseudovirus infection to ascertain the susceptibilities of neurons and astrocytes. Moreover, we observed that expression of SARS-CoV-2 Spike protein alters the synaptic responses of cultured neurons. Our transgenic mice may serve as a model for severe COVID-19 and sex- biased responses to SARS-CoV-2 infection, aiding in the development of vaccines and therapeutic treatments for this disease.

[00083] 1. Material and Methods [00084] 1.1 Animals

[00085] Mice were bred and maintained in the animal facility of the Institute of Molecular Biology (IMB), Academia Sinica, under pathogen-free conditions. The mice were group-housed with their littermates and each cage contained 3 to 5 mice. All animal experiments were performed with the approval of the Academia Sinica Institutional Animal Care and Utilization Committee (IACUC Protocol No. 12-08- 391) and in strict accordance with its guidelines and those of the Council of Agriculture Guidebook for the Care and Use of Laboratory Animals. Viral challenge experiments with SARS-CoV-2 were performed in the P3 animal facility of the Genomic Research Center. The protocol for animal experiments at the P3 level was also evaluated and approved by the IACUC of Academia Sinica (Protocol No. 20-11 - 1538). Surviving mice after viral challenge were euthanized using carbon dioxide. [00086] 1.2 Plasmid constructions [00087] Pseudovirus

[00088] To generate pcDNA3. l-nCoV-SA18, the SARS-CoV-2 Spike gene with a 54-nucleotide deletion at the C-terminus was PCR-amplified from synthetic DNA (provided by Alex Ma, Academia Sinica, Taiwan) using the Kapa HiFi PCR kit (Kapa Biosystems) with a primer pair (Forward, 5’- AACTTAAGCTTGGTACCGCCACCATGTTCGTCTTCCTGGTCCTG-3’ (SEQ ID NO: 9); Reverse, 5’-

TGCTGGATATCTGCAGAATTCTTACTTACAGCAGGAGCCACAGCTACAGCA G-3’ (SEQ ID NO: 10)), and sub-cloned into Kpnl and EcoRI sites of pcDNA3.1™(+) expression vector using a GenBuilder™ Cloning kit (GeneS cript®). [00089] hACE2 transgenic mice

[00090] The full-length hAce2 gene was PCR-amplified from Mammalian Gene Collection cDNA clone (clone number MGC47598) using a Kapa HiFi PCR kit (Kapa Biosystems) with a primer pair (Forward, 5’-

GGGAGACCCAAGCTGGCTAGCCACCATGTCAAGCTCTTCCTGGCTCCTTC- 3’ (SEQ ID NO: 11) and Reverse, 5’-

TT GT CT C AAGAT CTAGAATTCCTA AA AGGAGGT CT GAAC AT C ATC AGT G-3 ’ (SEQ ID NO: 12)), and sub-cloned into the Nhel and EcoRI sites of pLAS2w.Pbsd (a lentiviral transfer vector from the RNAi Core of Academia Sinica, Taiwan) using a GenBuilderTM Cloning kit (GeneScript®). The hACE2 cDNA was further PCR- amplified and sub-cloned into pcDNA3.1 using the following primers: Forward, 5’- GCCCTCTAGGCCACCATGTCAAGCTCTTCCTGG-3’ (SEQ ID NO: 13); Reverse, 5’-

CTAAGCGGGCGCCACCTGGGAGGTCTCGGTACCAAAGGAGGTCTGAACAT CATCAGTGT-3’ (SEQ ID NO: 14). HA tag sequences were added to the 3’ end of the hACE2 transgenic cDNA using a Q5® Site-Directed Mutagenesis Kit (NEB#E0554S) according to the manufacturer’s instructions. Primers for site-directed mutagenesis were: Forward, 5’-

GTTCCAGATTACGCTTAAGCTTGGATCCGCGTTAAGTTTAAACCGCTG-3’ (SEQ ID NO: 15); Reverse, 5’-

ATCGTATGGGTATCCAGCGGGCGCCACCTGGGA-3’ (SEQ ID NO: 16). The pCAG-hACE2-HA DNA fragment was then subcloned into an insulator (HS4)- containing plasmid, as described previously [14] To generate transgenic mice, the entire (HS4)2-pCAG-hACE2-HA-(HS4)2 cassette was digested with Notl and isolated for pronuclei microinjection. The nucleotide sequences of the expression cassette are shown in Fig. 9.

[00091] Transient expression

[00092] The previously described construct GW1-SARS2 Spike-cHA [15] was used for transient expression of full-length SARS-CoV-2 Spike protein into cultured cells. [00093] 1.3 Generation of hACE2 transgenic mice

[00094] For mice production, we super-ovulated 3-4 week-old C57BL/6J female mice with 3.75-5 i.u. of pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich G4877), followed 46-h later by 3.75-5 i.u. of human chorionic gonadotropin (hCG, Sigma-Aldrich CGI 063). Super-ovulated female mice were mated to male mice and one-cell-stage zygotes were collected the following day. The (HS4)2-pCAG-hACE2- HA-(HS4)2 cassette (2 ng/mΐ) was microinjected into pronuclei of the zygotes.

Injected zygotes were transferred into the oviduct of 0.5-dpc (days post-coitum) pseudo-pregnant ICR female mice. Genotyping was performed using genomic PCR with primers specific for ACE2 cDNA (Forward 5’-

GAGACTATGAAGTAAATGGGGTAGATGGC-3 ’ (SEQ ID NO: 17); Reverse 5’- CTTC ATTAGCT C C ATTT CTTAGC AGAAAAGG-3 ’ (SEQ ID NO: 18)). Mice genotyped as having a 582-bp PCR product were identified as hACE2 transgenic mice.

[00095] 1.4 Copy number analysis of the transgene using droplet digital PCR (ddPCR)

[00096] To determine hACE2 transgene copy number, genomic DNA was extracted from mouse tail snips using a QuickGene DNA tissue kit S (KUTABO, Cat no.: DT- S). Purity and concentration of DNA samples were measured using a Nanodrop spectrophotometer (Thermo Fisher Scientific, ND-1000). Genomic DNA was digested with Spel-HF® (NEB, # R3133S) to completely release individual hACE2 transgene cassettes from possible tandem repeats and/or multiple integration sites in a final volume of 20 pL at 37 °C for 1 h, followed by heat inactivation at 65 °C for 20 mins. Tbp (TATA box binding protein, gene ID 21374) was used as the two-copy reference gene. The reaction mixtures contained ddPCR™ Supermix for Probes (no dUTPs; Bio-Rad Laboratories, CA, USA), primers (PrimeTime mini qPCR Assay, 100 rxn, IDT), and template DNA (40 ng) in a final volume of 20 pi. Primers and probes are as follows: Tbp Forward: 5’-TTGCTACTGCCTGCTGTT-3’ (SEQ ID NO: 19);

Reverse: 5 ’ -GGACTTACTCC AC AGCCTATTC-3 ’ (SEQ ID NO: 20); Tbp 5’ Sun probe: 5’-TTGCTGCTGCTGTCTTTGTTGCTC-3’ (SEQ ID NO: 21); MCE2 transgene Forward: 5’- CTAACGGACCCAGGAAATGTTCAGA-3 ’ (SEQ ID NO: 22); Reverse: 5 ’ -GGTTGTGCAGCATATGCCATATCATAC-3 ’ (SEQ ID NO: 23); MCE2 5’ FAM probe: 5 ’ -AAGGGCGACTTCAGGATCCTTATGTGCAC-3 ’ (SEQ ID NO: 24). Each reaction was then loaded into a sample well of an eight-well disposable cartridge (DG8™; Bio-Rad Laboratories) along with 70 pi of droplet generation oil (Bio-Rad Laboratories). Droplets were formed using a QX200™ Droplet Generator (Bio-Rad Laboratories) according to the manufacturer’s instructions. Droplets were then transferred to a 96-well PCR plate, heat-sealed with foil and amplified to the end point using a conventional thermal cycler (95 °C for 5 mins, followed by 40 cycles of 94 °C for 30 s and 58 °C for 1 min, and a final extension at 98 °C for 10 mins). The resulting products were scanned on a QX200 Droplet Reader (Bio-Rad Laboratories), and the data was analyzed using QuantaSoft™ software (Bio-Rad Laboratories).

[00097] 1.5 SARS-CoV-2 infection

[00098] CAG-hACE2 transgenic or wild-type (WT) mice were anesthetized and intranasally challenged with SARS-CoV-2 TCDC#4 (hCoV-19/Taiwan/4/2020 obtained from Taiwan Centers of Disease Control; lot: IBMS20200819) in a volume of 100 pL of sterile PBS at the indicated plaque-forming units (PFU).

[00099] 1.6 Western blot analysis

[000100] Transgenic and WT mice were sacrificed before collecting different tissues for lysis. Western blot analysis was performed as described previously [14] Antibodies and respective dilutions are as follows: hACE2 (Abeam abl08209, 1:2500); HA (Cell Signaling #3725, 1:1000); and HSP90 (provided by Dr. Chung Wang, 1:5000) [16]

[000101] 1.7 Immunohistochemistry

[000102] Transgenic and WT mice were sacrificed before collecting different tissues for fixation in 10% formaldehyde (MACRON H121-08) at 4 °C for more than 24 h. Fixed tissues were stored in 70% ethanol before embedding in paraffin. Tissues were further processed using a Leica TP 1020 Semi-enclosed Benchtop Tissue Processor. Immunostaining was performed as described previously [17] The following commercial antibodies were used as primary antibodies for immunostaining: rabbit anti-ACE2 (Abeam, abl08209); mouse anti-HA (Abeam, abl30275); and rabbit anti- HA (Cell Signaling, 3742). Tissue sections were colored via DAB-staining (3, 3- diaminobenzidine; Dako, K3468).

[000103] 1.8 Production of pseudotyped SARS-CoV-2 lentivirus [000104] The pseudotyped SARS-CoV-2 lentivirus, which carries SARS-CoV-2 Spike protein as viral envelope protein, was generated by transiently transfecting HEK-293T cells with pCMV-AR8.91, pLAS2w.EGFP.Puro and pcDNA3.1-nCoV- SA18. HEK-293T cells were seeded one day before transfection, and the indicated plasmids were then delivered into the cells using TransIT®-LTl transfection reagent (Mirus). The culture medium was refreshed at 16 h and then harvested at 48 h and 72 h post-transfection. Cell debris was removed by centrifugation at 4,000 g for 10 min, and the supernatant was passed through a 0.45-mih syringe filter (Pall Corporation). The pseudotyped lentivirus was aliquoted and stored at -80 °C. Transduction units (TU) of pseudotyped SARS-CoV-2 lentivirus were estimated by using a cell viability assay in response to limited dilutions of lentivirus. In brief, HEK-293T cells stably expressing the hACE2 gene were plated on a 96-well plate 1 day before lentivirus transduction. To titer pseudotyped lentivirus, different amounts of lentivirus were added into the culture medium containing polybrene (final concentration = 8 pg/ml). Spin infection was carried out at 1,100 g in a 96-well plate for 30 mins at 37 °C. After incubating the cells at 37 °C for 16 h, the culture medium containing virus and polybrene was removed and replaced with fresh complete DMEM containing 2.5 pg/ml puromycin. After puromycin treatment for 48 h, the culture medium was removed and cell viability was determined using 10% AlarmaBlue reagents according to the manufacturer’s instructions. The survival rate of uninfected cells (without puromycin treatment) was set as 100%. Virus titer (TU) was determined by plotting surviving cells against diluted viral dose.

[000105] 1.9 Primary neuronal culture, pseudovirus challenge and immunostaining

[000106] Mouse neuronal cultures were prepared from dorsal cerebral cortex and hippocampal regions of WT and transgenic mice at embryonic day 16-17, as described previously [18, 19] Embryos of both sexes were used. At days in vitro 10 (DIV 10), neurons were challenged with pseudotyped SARS-CoV-2 lentivirus (reporter: GFP) at a multiplicity of infection (MOI) of 0.01 and kept at 37 °C for 8 days. Neuronal cultures were then fixed for immunofluorescence staining as described previously [18, 19] using the following primary antibodies: rabbit anti-ACE2 (Abeam, abl08209); mouse anti-HA (Abeam, abl30275); rabbit anti-HA(Cell Signaling, 3742); mouse anti-MAP2 (Sigma, M4403); mouse anti-GFAP (Millipore, MAB3402); and rabbit anti-GFP (Invitrogen, A6455). The fluorescent images were captured at room temperature with a confocal microscope (LSM 700, Zeiss) equipped with a 20x/NA 0.80 (Plan-Apochromat) objective lens and Zen acquisition and analysis software (Zeiss). The images were processed using Photoshop (Adobe) with minimal adjustment of brightness or contrast applied to the entire images.

[000107] 1.10 Electrophysiological recording

[000108] To measure miniature excitatory postsynaptic currents (mEPSCs), we subjected cultured neurons (DIV 17-19) expressing HA tag or D614 Spike protein to whole-cell voltage-clamp recording at room temperature (23 ± 2 °C). Neurons growing on coverslips were transferred to a submerged chamber and continuously perfused with bath solution (pH 7.3) containing (in mM): 136.5 NaCl, 5 HEPES, 5.56 glucose, 5.4 KC1, 1.8 CaCh, 0.53 MgCh. HA tag- or Spike protein-expressing neurons were visually identified via GFP expression under an infrared differential interference contrast (IR-DIC) microscope (SliceScope, Scientifica) coupled with an OptoLED system (Caim Research Ltd) and connected to a CCD camera (IR-1000, DAGE-MTI). Whole-cell recordings were performed with patch pipettes (4-8 MW) filled with the internal solution consisting of the following (in mM): 135.25 K- gluconate, 8.75 KC1, 0.2 EGTA, 4 MgATP, 10 HEPES, 7 Na2-phosphocreatine, 0.5 Na3GTP (pH 7.3 with KOH). Once the recording was established in the voltage-clamp configuration (Vhold = -72 mV, near the IPSC reversal potential; [Cl-]i = 8.75 mM), we applied tetrodotoxin (TTX, 1 mM) for at least 5 mins before recording mEPSCs. During mEPSC recordings, pipette capacitance and series resistance (Rs) were compensated by 70%, and Rs was continuously monitored every 10 s. Data were discarded if Rs changed by >20% during the entire 8-10-min recording period. Data were recorded using Multi clamp 700B amplifiers (Molecular Devices), filtered at 3 kHz, and sampled at 10 kHz with a Power 1401 mk II digitizer (Cambridge Electronic Design) controlled by Signal 4 software (Cambridge Electronic Design). mEPSC events were detected and analyzed by setting the peak threshold at three times the root-mean-square noise of a 2560 ms baseline and the event kinetics as corresponding to AMPAR-mediated currents. All recordings and analyses were conducted blind to the experiential conditions (i.e., HA tag or Spike protein expression).

[000109] 1.11 Statistical analysis

[000110] Statistical analyses were carried out in Excel or GraphPad Prism 8.0 software. Experiments were performed blind by relabeling the samples with the assistance of other laboratory members or without knowing genotype. Data are presented as mean values, with numbers of individual mice or neurons assessed also indicated. P values < 0.05 were considered significant.

[000111] 2. Results

[000112] 2.1 Establishment of CAG-hACE2 transgenic mice [000113] To study the impact of SARS-CoV-2 infection on various tissues, we generated hACE2 transgenic mice under the control of the CAG promoter, a hybrid promoter comprising the cytomegalovirus enhancer fused to the chicken beta-actin promoter. Since the CAG promoter is highly active in a variety of tissues, CAG- hACE2 transgenic mice would serve as a model for monitoring the effects of SARS- CoV-2 infection on various tissues, including the brain. The hACE2 transgene was tagged with a HA cassette at the C-terminal end for detection. To ensure expression of the hACE2 transgene, a chicken insulator (HS4) was inserted at both the 5’ and 3’ ends of the entire transgene cassette (Fig. 1A). We first generated two independent CAG-hACE2 transgenic lines, i.e., GT5-027 and GT4-008, using genomic PCR with primers corresponding to the sequences of hACE2 and the HA cassette (Fig. 1A, Fig. IB). Since the GT5-027 line bred faster than line GT4-008, we primarily used the former line for experiments unless specified otherwise. We applied ddPCR to determine transgene copy number in line GT5-027, which revealed that it carries two copies of the transgene in its genome (Fig. 1C).

[000114] 2.2 Expression of the hACE2 transgene in various organs [000115] Expression of hACE2 transgene was examined by immunoblotting using both HA- and hACE2-specific antibodies. As expected, hACE2 proteins were detected in different organs, but with higher expression levels in the lung, kidney and brain and lower levels in the duodenum, heart and liver (Fig. 2A). The results using hACE2 or HA antibodies were similar (Fig. 2A). We further compared protein levels of hACE2 in male and female transgenic mice. In the six aforementioned organs, hACE2 protein levels were equivalent between female and male mice (Fig. 2B), suggesting that both female and male transgenic mice were suitable for SARS-CoV-2 infection experiments.

[000116] In addition to immunoblotting, we further performed immunohistochemistry to investigate hACE2 expression at the cellular level. Patterns of HA and hACE2 immunoreactivities were generally very consistent to each other in different tissues, except for the brain (Fig. 2C). HA antibody revealed some diffuse and non-specific background signal in the dentate gyrus (Fig. 2C). These immunoreactivities were specific for CAG-hACE2 transgenic mice, because there was no clear hACE2 antibody signal in WT littermates (Fig. 2C).

[000117] Thus, we have successfully generated a genetically modified mouse model that expresses hACE2 in various organs, including lung, brain, kidney, duodenum, heart and liver.

[000118] 2.3 CAG-hACE2 transgenic mice exhibit high susceptibility to SARS- CoV-2 infection

[000119] We challenged our CAG-hACE2 transgenic mice with SARS-CoV-2 via intranasal infection and then monitored changes in body weight and mouse survival (Fig. 3A). First, we combined both the male and female transgenic mice of two mouse lines (GT5-027 and GT4-008) for comparison with their WT littermates. When challenged with 5xl0⁵ PFU of SARS-CoV-2, there was no change in body weight of WT at the end of the experimental period, whereas there was a marked reduction in body weight of CAG-hACE2 mice. By day 3 post-infection (DPI 3), transgenic mice had significantly lost body weight relative to WT littermates (Fig. 3B, unpaired t-test p = 0.0004), and body weight decline continued thereafter and was accompanied by a decrease in mobility. Six out of eight transgenic mice died on DPI 5 (Fig. 3B, shown in red). Two female mice of the GT4-008 line were also challenged with the same titer of SARS-CoV-2 and showed a similar weight loss pattern (Fig. 3B, open circles). These results suggest that our transgenic mice are susceptible to SARS-CoV-2 infection.

[000120] We reduced viral titers to determine the median lethal dose (LD50) of SARS-CoV-2 infection in our transgenic mice. Four different titers, i.e., lxlO⁵, lxlO⁴, lxlO³ and lxlO², were examined (Fig. 4A). For each titer, a total of eight transgenic mice (five males and three females of the GT5-027 line) were used. We observed that all four of these titers caused body weight loss in our transgenic mice, starting at day 3 or 4 (Fig. 4B). Mice started to die at day 5 in the group infected with lxlO⁵, lxlO⁴ or lxlO³ PFU of virus, resulting in reduced mouse numbers in each experimental group (Fig. 4B). All mice had died by DPI 9, except for one female infected with lxlO² PFU (Fig. 4C, Fig. 4D). This surviving female mouse actually fully recovered from SARS-CoV-2 infection and displayed increased body weight and normal appearance for at least two weeks after infection. Since the titer of lxlO² PFU resulted in one of eight mice surviving, we estimated the LD50 of SARS-CoV-2 in our transgenic mice to be half the lxlO² titer, i.e., 50 PFU. Atotal of 32 mice were used in this set of experiments, yet only one mouse survived. Thus, overall mortality (including the group of mice infected with just 100 PFU) was -96%. Accordingly, we assert that our transgenic mice are highly susceptible to SARS-CoV-2 infection and may serve as an appropriate model for severe COVID-19.

[000121] 2.4 Sex-biased responses among CAG-hACE2 transgenic mice to SARS-CoV-2 infection

[000122] When we analyzed the LD50 of SARS-CoV-2 in our transgenic mice, we noticed that female and male transgenic mice appeared to respond differentially to viral infection. To investigate this point further, we generated survival curves for male and female transgenic mice separately (Fig. 4D). Among the 25 male mice infected with different virus titers, six died at DPI 5. A further 3 male and 8 male mice died on days 6 and 7 post-infection, respectively. Thus, survival rates for days 5, 6 and 7 were 56%, 44% and 12%, respectively. Eventually, all infected male mice had died by DPI 9 (Fig. 4D). In contrast, among the total of 12 experimental female mice, only one had died by day 6. However, a further 10 female mice (83% of infected mice) suddenly died on day 7, regardless of viral titer, and only one female survived SARS- CoV-2 challenge (Fig. 4D).

[000123] We further analyzed changes in body weight of male and female mice. We found that for higher titers, i.e., lxlO⁵ and lxlO⁴ PFU, changes in body weight were comparable between male and female transgenic mice, except for the titer of lxlO⁵ at DPI 7 (Fig. 4E). For lower titers, i.e., lxlO³ and lxlO² PFU, female transgenic mice exhibited a much less pronounced reduction in body weight compared to male mice (Fig. 4E). These results suggest that female and male transgenic mice respond differently to SARS-CoV-2 infection.

[000124] 2.5 Susceptibility of brain cells to SARS-CoV-2 infection [000125] In the aforementioned immunohistochemistry study, we found that HA tag antibody revealed some non-specific signal in brain sections (Fig. 2C). To further confirm hACE2 expression in neurons and glial cells, we prepared neuronal culture using CAG-ACE2 transgenic mice for immunofluorescence staining. Although neurons represent the majority of cell types in our neuronal culture, a small population of astrocytes is also present [20] We first used hACE2 and HA antibodies to perform dual immunostaining on our neuronal cultures at DIV 10. Compared with WT neuronal culture, which did not express the hACE2 transgene, we observed a punctate pattern of colocalized hACE2 and HA immunoreactivities in our neuronal culture from transgenic mice (Fig. 5), supporting that the hACE2 transgene is expressed in brain cells. Based on cell morphology, we speculated that both neurons and astrocytes expressed hACE2 (Fig. 5, middle panels = neuron; lower panels = astrocyte). To confirm these cell types, we performed dual immunostaining using a combination of hACE2 or HA antibodies with the neuronal marker MAP2 or the astrocyte marker GFAP. Dual immunostaining using these markers indeed indicated that both neurons and astrocytes of our transgenic mice are hACE2 -positive (Fig. 6A, Fig. 6B). When we compared the immunoreactivities of neurons and astrocytes, we found that astrocytes presented much higher levels of hACE2 proteins (Fig. 6A, upper). Thus, even though CAG is a ubiquitous promoter, the transgene expression driven by it varies. Nevertheless, these immunostaining experiments confirm expression of the hACE2 transgene in both neurons and glial cells.

[000126] We then subjected our neuronal culture to pseudovirus infection to evaluate its susceptibility to infection. To do that, we added genetically-modified lentivirus that expresses SARS-CoV-2 Spike protein co-expressed with a GFP marker into neuronal culture at DIV 10. Eight days later, cultures were subjected to immunostaining using GFP and MAP2 or GFAP antibodies (Fig. 7). GFP expression was readily observed in both neurons and astrocytes (Fig. 7A, Fig. 7B), indicating that our CAG-hACE2 transgenic mice can also serve as a model for investigating SARS-CoV-2 infection of the brain.

[000127] 2.6 SARS-CoV-2 Spike protein alters synaptic activity [000128] Next, we investigated if SARS-CoV-2 influences neuronal activity. Due to biosafety regulations, it is technically difficult to record the electrophysiological activity of SARS-CoV-2-infected neurons. Since expression of SARS-CoV-2 Spike protein alone is sufficient to alter the morphology and density of dendritic spines, including induction of greater spine density, longer spines and narrower spine heads [15], we recorded the mEPSCs of cultured neurons transfected with SARS-CoV-2 Spike protein. GFP was co-transfected with SARS-CoV-2 Spike protein or vector control into cultured neurons to label transfected cells. Compared with vector control, we found that overexpression of SARS-CoV-2 Spike protein increased mEPSC amplitude, which was reflected in both the average of mEPSC amplitude of individual neurons and the cumulative probability curve of individual peaks (Fig. 8). However, mEPSC frequency was not altered by this treatment (Fig. 8). These results indicate that expression of SARS-CoV-2 Spike protein influences the synaptic activity of neurons, which is likely relevant to the neurological symptoms displayed by COVID- 19 patients.

[000129] 3. Discussion

[000130] Our hACE2 transgene was driven by a ubiquitous promoter, CAG, and was flanked with two copies of the HS4 insulators to limit transgene silencing by positional effects. This design resulted in strong expression of hACE2 in different organs of our transgenic mice. Thus, virus propagation to other organs upon intranasal infection is expected to occur in this mouse model. However, we noticed that although the CAG promoter is ubiquitous, hACE2 expression levels vary across different tissues. In neuronal culture, we also observed that astrocytes and neurons express very different levels of hACE2 proteins. It is possible that hACE2 protein is subject to posttranslational regulation. Nevertheless, the higher expression levels of hACE2 in the astrocytes of our transgenic mice may indicate that astrocytes display higher viral susceptibility, mimicking the tropism of SARS-CoV-2 reported for human cortical astrocytes in organoids [21] Our CAG-hACE2 transgenic mice also express hACE2 in diverse tissues, making them a useful model for investigating systematic responses to SARS-CoV-2 infection.

[000131] We have also demonstrated that our CAG-hACE2 transgenic mouse line is a very sensitive model for SARS-CoV-2 infection, as it responded to very low titers of SARS-CoV-2. The LD50 of SARS-CoV-2 in our hACE2 transgenic mice was lower than 10² PFU and we estimated it to be ~50 PFU, which is the lowest LD50 yet reported for SARS-CoV-2. Typically, 2.5-10 x 10⁴ PFU of SARS-CoV-2 are used for infection experiments using mouse models [6, 12, 13] For our CAG-hACE2 transgenic mice, a titer of 100 PFU was sufficient to cause 100% lethality in male mice. Thus, relative to other currently available models, our hACE2 transgenic mice are the most sensitive model for COVID-19 infection. Interestingly, female hACE2 transgenic mice are relatively resistant to low-dose SARS-CoV-2 infection, displaying a lower degree of body weight loss compared to males and one female infected with 100 PFU even survived at least longer than 2 weeks after infection. This difference is unlikely due to differential expression levels of hACE2 proteins in male and female mice because immunoblotting revealed comparable hACE2 protein levels among male and female mice for various organs. Thus, our transgenic mice may also serve as a model to study severe COVID-19 and sex-biased responses to SARS-CoV-2 infection. Consequently, it should prove valuable in exploring therapeutic agents and for vaccine development. [000132] Our previous report showed that overexpression of SARS-CoV-2 Spike protein in cultured neurons alters dendritic spine density and morphology [16] Since dendritic spines are mainly supported by F-actin cytoskeleton, this alteration of dendritic spines suggests that SARS-CoV-2 can influence F-actin. Consistent with this observation, informational spectrum analysis has revealed that actin is a possible host factor for cell entry and pathogenesis of SARS-CoV-2 [22] Confocal analysis has further indicated that SARS-CoV-2 Spike protein colocalizes with F-actin along filopodia, another subcellular structure supported by F-actin in non-neuronal cells [16] The presence of SARS-CoV-2 virions along filopodia may facilitate virus spread [23] Here, we further show that the mEPSCs of SARS-CoV-2 Spike protein expressing neurons differs from those of control neurons, further implying that SARS-CoV-2 infection alters neuronal activity, which may account at least partially for the neurological symptoms displayed by COVID-19 patients. Apart from neurons, the astrocytes of our transgenic mice were also readily infected by SARS-CoV-2.

Thus, our transgenic mice provide an appropriate model for investigating the impact of SARS-CoV-2 infection on various organs and tissues, as well as the neuropsychiatric symptoms observed in COVID-19 patients [24, 25]

References

1. Mackenzie, J.S., and David W Smith. , “COVID-19: a novel zoonotic disease caused by a coronavirus from China: what we know and what we don't. Microbiology Australia, MA20013. , 2020. 17 Mar. 2020,

(doi:10.1071/MA20013).

2. Hu, B., et ak, Characteristics of SARS-CoV-2 and COVID-19. Nature Reviews Microbiology, 2020, DOI:10.1038/s41579-020-00459-7.

3. Cantuti-Castelvetri, L., et ak, Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science, 2020. 370(6518): p. 856-860.

4. Roberts, A. and K. Subbarao, Animal models for SARS. Adv Exp Med Biol, 2006. 581: p. 463-71.

5. Munoz-Fontela, C., et ak, Animal models for COVID-19. Nature, 2020. 586(7830): p. 509-515.

6. Moreau, G.B., et ak, Evaluation of K18-hACE2 Mice as a Model ofSARS-CoV- 2 Infection. Am J Trop Med Hyg, 2020. 103(3): p. 1215-1219.

7. Oladunni, F.S., et ak, Lethality of SARS-CoV-2 infection in K18 human angiotensin-converting enzyme 2 transgenic mice. Nat Commun, 2020. 11(1): p. 6122. Han, K., et al., Lung Expression of Human Angiotensin-Converting Enzyme 2 Sensitizes the Mouse to SARS-CoV-2 Infection. Am J Respir Cell Mol Biol, 2021. 64(1): p. 79-88. Hassan, A.O., et al., A SARS-CoV-2 Infection Model in Mice Demonstrates Protection by Neutralizing Antibodies. Cell, 2020. 182(3): p. 744-753. e4. Lee, S.H., et al., Characterization of changes in global gene expression in the hearts and kidneys of transgenic mice overexpressing human angiotensin converting enzyme 2. Laboratory Animal Research, 2020. 36(1): p. 23. Jiang, R.D., et al., Pathogenesis of SARS-CoV-2 in Transgenic Mice Expressing Human Angiotensin-Converting Enzyme 2. Cell, 2020. 182(1): p. 50-58. e8. Bao, L., et al., The pathogenicity of SARS-CoV-2 in hACE2 transgenic mice. Nature, 2020. 583(7818): p. 830-833. Sun, S.-H., et al., A Mouse Model of SARS-CoV-2 Infection and Pathogenesis. Cell Host & Microbe, 2020. 28(1): p. 124-133.e4. Shih, Y.T., Huang, T.N., Hu, H.T., Yen, T.L., and Hsueh, Y.P., Vcp overexpression and leucine supplementation increase protein synthesis and improve fear memory and social interaction of Nfl mutant mice. Cell Reports 2020. 31:107835. Chen, C.-Y, Y.-C. Chou, and Y.-R Hsueh, SARS-CoV-2 D614 and G614 spike variants impair neuronal synapses and exhibit differential fusion ability. bioRxiv, 2020: p. 2020.12.03.409763. Liou, S.T. and C. Wang, Small glutamine-rich tetratricopeptide repeat- containing protein is composed of three structural units with distinct functions. Arch Biochem Biophys, 2005. 435(2): p. 253-63. Tsai C.Y., C.C.K., Yang C.W., Lai Y.C., Liang C.C, Chen C.M. and Tsai T.F. , Hurp deficiency in mice leads to female infertility caused by an implantation defect. Journal of Biological Chemistry 2008. 283(39):26302-6. Chen CY, L.H., Hsueh YP. , ΊΊ.R3 downregulates expression of schizophrenia gene Disci via MYD88 to control neuronal morphology. EMBO Rep. , 2017. 18(1): 169-183. Hung YF, C.C., Shih YC, Liu HY, Huang CM, Hsueh YP. , Endosomal TLR3, TLR7, and TLR8 control neuronal morphology through different transcriptional programs. J Cell Biol. , 2018. 6;217(8):2727-2742. Liu, H.-Y, et al., TLR7 negatively regulates dendrite outgrowth through the Myd88-c-Fos-IL-6 pathway. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2013. 33(28): p. 11479-11493. Andrews, M.G., et al., Tropism of SARS-CoV-2 for Developing Human Cortical Astrocytes. bioRxiv, 2021. V.-A. J. Veljkovic V, S.J.a.P.S.v.p.r.a., Use of the informational spectrum methodology for rapid biological analysis of the novel coronavirus 2019-nCoV: prediction of potential receptor, natural reservoir, tropism and therapeutic/vaccine target. FlOOOResearch, 2021. 9:52. Veljkovic V, V.-A.J., Segales J and Paessler S. , Use of the informational spectrum methodology for rapid biological analysis of the novel coronavirus 2019-nCoV: prediction of potential receptor, natural reservoir, tropism and therapeutic/vaccine target [version 4; peer review: 2 approved] FlOOOResearch 2021. 9:52. Follis, K.E., J. York, and J.H. Nunberg, Furin cleavage of the SARS coronavirus spike glycoprotein enhances cell-cell fusion but does not affect virion entry. Virology, 2006. 350(2): p. 358-69. Mao, L., et al., Neurologic Manifestations of Hospitalized Patients With Coronavirus Disease 2019 in Wuhan, China. JAMA Neurology, 2020. 77(6): p. 683-690.

Claims

CLAIMS What is claimed is:

1. A transgenic non-human animal having a genome comprising an expression cassette which comprises a transgene encoding human angiotensin-converting enzyme II (hACE2) under the control of a CAG promoter, wherein the expression cassette is optionally flanked by at least one insulator.

2. The transgenic non-human animal of claim 1, wherein the insulator is a chicken b-globin 5'HS4 insulator (HS4 insulator).

3. The transgenic non-human animal of claim 2, wherein the expression cassette is flanked by two copies of the HS4 insulator at 5'end and two copies of the HS4 insulator at 3' end.

4. The transgenic non-human animal of any of claims 1 to 3, wherein the expression cassette further comprises a nucleic acid sequence encoding a marker or tag fused with hACE2.

5. The transgenic non-human animal of claim 4, wherein the tag is a hemagglutinin (HA) tag.

6. The transgenic non-human animal of any of claims 1 to 5, wherein the expression cassette further comprises a Kozak sequence at the start of the hACE2 coding sequence in the transgene.

7. The transgenic non-human animal of claim 1, wherein the expression cassette comprises from 5' to 3' two copies of a HS4 insulator; the CAG promoter; a Kozak sequence; the transgene encoding hACE2; a HA-tag coding nucleotide sequence; and two copies of a HS4 insulator.

8. The transgenic non-human animal of any of claims 1 to 7, wherein the hACE2 comprise an amino acid sequence set forth in SEQ ID NO: 1.

9. The transgenic non-human animal of any of claims 1 to 8, wherein the transgene comprises a nucleotide sequence set forth in SEQ ID NO: 2; the CAG promoter comprises a nucleotide sequence set forth in SEQ ID NO: 3; and/or the insulator comprises a nucleotide sequence set forth in SEQ ID NO: 4.

10. The transgenic non-human animal of claim 6 or 7, wherein the Kozak sequence comprises a nucleotide sequence of GCCACC.

11. The transgenic non-human animal of claim 5, wherein the HA tag comprises an amino acid sequence set forth in SEQ ID NO: 5.

12. The transgenic non-human animal of claim 11, wherein the nucleic acid sequence encoding the HA tag comprises a nucleotide sequence set forth in SEQ ID NO: 6.

13. The transgenic non-human animal of any of claims 1 to 12, wherein the expression cassette comprises a nucleotide sequence set forth in SEQ ID NO: 7 or 8.

14. The transgenic non-human animal of any of claims 1 to 13, wherein said animal is a mouse.

15. The transgenic non-human animal of any of claims 1 to 13, wherein the hACE2 is expressed in one or more organs selected from the group consisting of lung, kidney, brain, duodenum, heart and liver.

16. An expression cassette including a hACE2 transgene as defined in any of claims 1 to 13.

17. A nucleic acid construct, comprising an expression cassette of claim 16.

18. A method for producing a transgenic non-human animal expressing human angiotension-converting enzyme II (hACE2), comprising

(a) introducing an expression cassette including a hACE2 transgene of claim 16 into a zygote of an animal;

(b) transplanting the zygote into a pseudopregnant animal;

(c) allowing the zygote to develop to term; and

(d)identifying a transgenic offspring containing the transgene.

19. A method for generating an animal model for viral infection in a subject for which ACE2 is required, comprising

(a) providing a transgenic non-human animal as defined in any of claims 1 to 15; and

(b) challenging the animal with a virus which uses ACE2 for entry, said animal exhibiting one or more symptoms or condition characteristics associated with such viral infection.

20. A method of screening for a candidate agent for treating viral infection in a subject for which ACE2 is required, comprising

(a) providing a transgenic non-human animal as defined in any of claims 1 to 15;

(b) challenging the animal with a virus which uses ACE2 for entry, said animal exhibiting one or more symptoms or condition characteristics associated with such viral infection;

(c) administering a test agent to the animal; and

(d) determining whether at least one of the symptom or condition characteristics is reduced or alleviated in result of the administration of the agent.

21. The method of claim 19 or 20, wherein the one or more symptom or condition characteristics include damages in one or more organs selected from the group of lung, kidney, brain, duodenum, heart and liver.

22. The method of claim 19 or 20, wherein the one or more symptom or condition characteristics include six-biased responses to the viral infection.

23. The method of claim 19 or 20, wherein the one or more symptom or condition characteristics include neuropsychiatric symptoms.

24. The method of claim 20, wherein in step (c), the test agent is administrated to the animal prior to or after the virus challenging.

25. The method of any of claims 19 to 24, wherein the virus is a coronavirus.

26. The method of claim 25, wherein the coronavirus is selected from the group consisting of severe acute respiratory syndrome coronavirus (SARS-CoV) and novel coronavirus (SARS-CoV2).

27. Use of a transgenic non-human animal as defined in any of claims 1 to 15 as an animal model for viral infection in a subject for which ACE2 is required.

28. Use of a transgenic non-human animal as defined in any of claims 1 to 15 as an animal model for screening for a candidate agent for treating viral infection in a subject for which ACE2 is required.

29. Use of claim 27 or 28, wherein the virus is a coronavirus.

30. Use of claim 29, wherein the coronavirus is selected from the group consisting of severe acute respiratory syndrome coronavirus (SARS-CoV) and novel coronavirus (SARS-CoV2).