CN109628603A - Identify Hirudo japonica specific primer to and method, application - Google Patents
Identify Hirudo japonica specific primer to and method, application Download PDFInfo
- Publication number
- CN109628603A CN109628603A CN201811449782.1A CN201811449782A CN109628603A CN 109628603 A CN109628603 A CN 109628603A CN 201811449782 A CN201811449782 A CN 201811449782A CN 109628603 A CN109628603 A CN 109628603A
- Authority
- CN
- China
- Prior art keywords
- hirudo japonica
- sample
- tested
- candidate
- hirudo
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Abstract
The invention discloses a kind of for identifying the specific primer pair of Hirudo japonica, it is made of primer RY-5 ' and primer RY-3 ', the primer RY-5 ' and the primer RY-3 ' is single strand dna, and nucleotide sequence is followed successively by sequence 1 and sequence 2 in sequence table.PCR amplification is carried out using genomic DNA of the specific primer to sample to be tested, if it is possible to realize effectively amplification, then contain in the sample to be tested or candidate contains Hirudo japonica；If can not achieve effective amplification, do not contained in the sample to be tested or candidate without containing Hirudo japonica.The present invention can be obtained effectively and distinguish Hirudo japonica and other leech samples, quick, easy.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to identify the specific primer of Hirudo japonica to and side
Method, application.
Background technique
Leech (HIRUDO) alias horseleech, Chinese ephedra Qi, horseleech belong to Annelida Hirudinea and cure leech shape suborder Yi Zhi section." mind
Agriculture book on Chinese herbal medicine warp " it records: " leech master closes, the accumulation ... of blood-breaking lump in the abdomen the moon by extravesated blood, hemostasis ".Leech has so far as Chinese medicine
More than 3000 years history.Modern Chinese medicine thinks the blood-activating and menstruation-regulating medicinal of Hirudo drug for invigorating blood circulation and eliminating stasis subordinate classification, can inhibit blood
The release of platelet reduces blood lipid, inhibits fibroblast proliferation；For preventing and treating thrombus disease, the transfer of control cancer cell and increasing
Value etc..The effect of leech and its blood coagulation resisting function are closely related, and the best anticoagulant active substance of most important one, curative effect is
Hirudin (Hirudin), it is most effective and safest natural thrombin inhibitor in the world so far, with insulin,
Qinghaosu is referred to as " three element of the world " for saving human diseases, has high medical value.
2015 editions " pharmacopeia " regulations are Hirudinidae animal whitmania Whitmania pigra Whitman for medicinal leech
(i.e. eurysome golden thread leech), leech Hirudo nippponica whitman (i.e. Hirudo japonica) or willow leaf leech Whitmania
Acranulata Whitman (i.e. tapering gold thread leech).It is worth noting that, leech in the world has more than 500 kinds, China has 97
Kind, they belong to different mesh, section and category, in morphosis, feeding habit, living environment and internal contained bioactivity
It is all very different in terms of the structure and function of substance.Inventor is to Hui nationality, China, Yuzhou of Henan, Sichuan Chengdu lotus
The leech of the several main Chinese Medicinal Materials Markets sale of Hua Chi and Hubei Qichun and the raw material of nearly ten kinds of leech Chinese patent drugs are investigated
It was found that the resource of Chinese traditional medicine leech is extremely in short supply；Meanwhile the production and trade of leech lack industry standard, source is chaotic, there is
Serious similar varieties leech kind obscures medication problem.The discrepant leech kind of different cultivars, curative effect is mixed to influence leech
Chinese medicine quality also brings great security risk to clinical application.In order to which clinical application is safe and accurate and effective, for outer
Difference traditional Chinese medicinal materials assortment similar in shape establish it is a kind of effectively accurately identification method become have become extremely urgent demand.
The conventional identification method of leech be identified by character, the methods of microscopical characters, these discrimination methods be easy by
Many influences such as appraiser, medicinal material growing environment, growth year and Habitat producing；Also, at present still without a kind of maturation
Physical and chemical identification method be used for leech Variety identification.And the Study on Diversity as molecular biology rapidly develops, on DNA level
It makes a breakthrough, using DNA bar code technology and the polymerase chain reaction method based on specific primer as representative, uses
It is also becoming better and approaching perfection day by day in the Molecular Identification technology of medicinal animals and plants.CN2014101625452 is with DNA bar code technical appraisement expanded letter
Gold thread leech by the determined dna sequence to standard target gene and compares analysis, is sentenced according to the similitude with theoretical sequence
Fixed species identification technology.But this method is in the detection process slowly without promoting, and there is criterion for this method
The not stringent, limitation such as practical application is not strong.Concrete reason mainly has following three aspects: first is that process is complicated, time and effort consuming.
DNA bar code experiment need through extraction DNA, polymerase chain reaction (PCR), PCR product electrophoresis verifying, commission sequencing and
The manual check and correction of sequencing result, sequence assembly such as are compared at all multi-steps with openly sequence, are not suitable for quick, high-throughput
Application detection.Second is that as a result stability is poor, sequencing step is complicated, and the result of sequencing reaction receives sample pre-treatments
Influence with reaction condition and quality is different, influence species and determine conclusion.Third is that lacking specific criterion, if usually
The homology of target gene and the theory gene order SEQ ID NO.1 can determine whether the object of sample to be tested 99% or more
Kind.But according to gene difference, species to be measured are different, and degree of variation of the sequence between species is different.Therefore, lack
One stabilization, accurate, clearly homology standard is determined.
For Hirudo japonica, Hirudo japonica is one of Hementaria officianalis kind specified in pharmacopeia.Due to individual compared with
Small, raising difficulty, be easily confused use on Market of Chinese Materia Medica.There is presently no specificity methods to identify Hirudo japonica.Therefore,
Need to establish it is a kind of quickly, accurate, high resolution, easily operated Hirudo japonica identification method with make up identification field blank with
The deficiency that the complexity of the prior art is time-consuming, accuracy is not high.
Summary of the invention
The technical problem to be solved by the present invention is to provide a kind of identification day in view of the deficiency of the prior art
The method and specific primer pair of this doctor leech, it is so effective that distinguish Hirudo japonica and other leech samples, it is quick, easy.
The present invention be solve the problems, such as it is set forth above used by technical solution are as follows:
Present invention firstly provides a kind of for identifying the specific primer pair of Hirudo japonica, can be by primer RY-5 ' and primer
RY-3 ' composition, the primer RY-5 ' and the primer RY-3 ' are single strand dna, and nucleotide sequence is followed successively by sequence table
In sequence 1 (5 ' CCAGCTATATCATTAAGTCAAT3 ') and sequence 2 (5 ' CTTAATGGAGTATTTTGAATT3 ').
The above-mentioned specific primer centering for being used to identify Hirudo japonica, the primer RY-5 ' and the primer RY-3's ' rubs
Your ratio can be 1:1.
The application of the above-mentioned specific primer pair for being used to identify Hirudo japonica is any in following a)-f):
A) kit for detecting or assisting detection Hirudo japonica is prepared；
B) it detects or assists whether to contain in detection sample to be tested or candidate contains Hirudo japonica；
C) kit for identifying or assisting identification Hirudo japonica is prepared；
D) identify or assist to identify sample to be tested whether be or candidate is Hirudo japonica；
E) kit for identifying or assisting to identify the true or false of commercially available Hirudo japonica is prepared；
F) identify or assist the true or false of the commercially available Hirudo japonica of identification.
The present invention also provides for identifying the kit of Hirudo japonica.It is provided by the present invention to be used to identify Hirudo japonica
Kit contain it is above-mentioned for identifying the primer pair of Hirudo japonica.Wherein, it can also include Taq archaeal dna polymerase, dNTP,
Water or reaction buffer etc..
The above-mentioned application for identifying the kit of Hirudo japonica also belongs to protection scope of the present invention.It is above-mentioned to be used to identify
The kit of Hirudo japonica application can be following b1) b2) or b3):
B1 it) detects or assists whether to contain in detection sample to be tested or candidate contains Hirudo japonica；
B2) identify or assist to identify sample to be tested whether be or candidate is Hirudo japonica；
B3) identify or assist the true or false of the commercially available Hirudo japonica of identification.
Whether contain the present invention also provides a kind of detection sample to be tested or the candidate method containing Hirudo japonica, it may include
Following steps: extracting the total DNA of sample to be tested as template, using above-mentioned primer pair (or the reagent for identifying Hirudo japonica
Box) carry out PCR amplification, if it is possible to it realizes effectively amplification, then contains in the sample to be tested or candidate contains Hirudo japonica；Such as
Fruit can not achieve effective amplification, then does not contain in the sample to be tested or candidate is without containing Hirudo japonica.
The present invention also provides it is a kind of identify sample to be tested whether be or candidate is the method for Hirudo japonica, it may include it is as follows
Step: extracting the genomic DNA of sample to be tested as template, using above-mentioned primer pair (or the reagent for identifying Hirudo japonica
Box) carry out PCR amplification, if it is possible to realize effectively amplification, then the sample to be tested is or candidate is Hirudo japonica；If cannot
Realize effectively amplification, then the sample to be tested is not or candidate is not Hirudo japonica.
The present invention also provides a kind of methods of true or false for identifying commercially available Hirudo japonica, it may include following steps: extracting
The genomic DNA of commercially available Hirudo japonica as template, using it is above-mentioned for identify the primer pair (or kit) of Hirudo japonica into
Row PCR amplification, if it is possible to realize effectively amplification, then the commercially available Hirudo japonica is or candidate is genuine piece；If can not achieve
Effectively amplification, then the commercially available Hirudo japonica is or candidate is adulterant.
In any of the above-described the method, described " can be realized effective amplification " is to contain 200-300bp in pcr amplification product
DNA fragmentation；Described " can not achieve effective amplification " is the DNA fragmentation that 200-300bp is not contained in pcr amplification product.Wherein,
The DNA fragmentation of the 200-300bp can be the DNA fragmentation of the 287bp, (CCAGCTATATCATTA as shown in sequence 3 in sequence table
AGTCAATTTTATATTATATTTTTAGGGGTTAATATTACTTTTTTTCCTCAACACTTTCTAGGGCTAAGAGGAATAC
CACGGCGATACTCAGACTATCCAGATGTGTATATAGATTGAAATGTAGTATCATCATTTGGTTCAATTCTTTCTAC
TATTGCTCTTTTTTTATTTGTTTATTTATTATGAGAATCATTAAGAACTCAACGAGCTCTAATTTTCTTCCCTAGG
TTAGCAGCATCACTAGAGCTATTAATTCAAAATACTCCATTAAG)。
In the above method, when carrying out the PCR amplification, concretely 55 DEG C of the annealing temperature of use.
In the above method, when carrying out the PCR amplification, the amplification program of use concretely 94 DEG C of initial denaturation 3min；94
DEG C denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；35 circulations；72 DEG C of extension 5min.
In the above method, when carrying out the PCR amplification, the system of the PCR amplification can are as follows: when total volume is 20 μ l,
SYBR Premix Ex Taq II 10 μ l, RY-5 ' (upstream primer) 0.4 μ l (0.4 μM), 0.4 μ l of RY-3 ' (downstream primer)
(0.4 μM)), template 1 μ l (10-30ng), 20 μ l of sterile purified water polishing.
Compared with prior art, the beneficial effects of the present invention are:
Firstly, RY-5 ' (upstream primer) and RY-3 ' (downstream primer) are selected the present invention relates to primer pair specificity is good
Selected mostly with the site of two continuous mutations as specific primer 3 ' end generate mostly with two continuous mispairing, high degree
Reduce the potential nonspecific possibility of specific primer；In addition design specific primer when also fully considered reaction condition,
A variety of specific primers are used in mixed way by the compatibility in terms of amplified production size convenient for subsequent.Finally the experimental results showed that benefit
PCR is carried out with Hirudo japonica specific primer of the present invention, does not generate nonspecific reaction with the DNA fragmentation other than target,
And expanding obtained PCR product can obviously distinguish, and can be used for fast and accurately identifying the Hirudo japonica kind true and false, and
Nonspecific reaction is not generated to other leech kinds, primary first-order equation can come out target leech Variety identification.
Furthermore the invention further relates to a kind of high-resolution DNA detection method, in conjunction with minor effect genes (Shimadzu Corporation,
MultiNA it) is directly detected, realizes the quick detection to leech medicinal material.Compared to specified in pharmacopeia to pcr amplification product
The agarose gel electrophoresis method for detecting detected, this side's sensitivity is good, high resolution, analysis cost are low, easy to operate, can be quick
Realize the identification of traditional Chinese medicinal materials assortment.
Detailed description of the invention
Fig. 1 specific primer investigates gel figure；Left side L:DNA Marker, from top to bottom successively are as follows: 500bp, 450bp,
425bp、400bp、375bp、350bp、325bp、300bp、275bp、250bp、225bp、200bp、175bp、150bp、
125bp,100bp,75bp,50bp,25bp；Template: 1- eurysome golden thread leech, 2- Hirudo japonica, 3- hiruto, 4: water-blank pair
According to.
Fig. 2 is the corresponding electrophoretogram of template 2- Hirudo japonica in Fig. 1.
Fig. 3 is to mix the gel figure that sample investigates Hirudo japonica specific primer pair of the present invention using a variety of leech；
Left side L:DNA Marker, from top to bottom successively are as follows: 500bp, 450bp, 425bp, 400bp, 375bp, 350bp, 325bp,
300bp,275bp,250bp,225bp,200bp,175bp,150bp,125bp,100bp,75bp,50bp,25bp；Template: 1-
Water, blank control；2- Hirudo japonica+eurysome golden thread leech, 3- eurysome golden thread leech+hiruto, 4- Hirudo japonica+hiruto, 5- days
This doctor leech+hiruto+eurysome golden thread leech.
Fig. 4 is the corresponding electrophoretogram of Fig. 3.
Fig. 5 different batches leech multiplex PCR identifies electrophoretogram；Left side L:DNA Marker, from top to bottom successively are as follows:
500bp、450bp、425bp、400bp、375bp、350bp、325bp、300bp、275bp、250bp、225bp、200bp、
175bp,150bp,125bp,100bp,75bp,50bp,25bp；Template: 1-8 is the leech sample of different batches, and see Table 1 for details；
Primer: the primer mixture of specific primer containing Hirudo japonica pair, the primer mixture is by KT-5 '
TATGTATTGAAAGGGTATTCAATCG, KT-3 ' TTAAGAATGATCATCAGTATATAGTG, FN-5 '
GTAATTAGAATCGTAATAGCTC, FN-3 ' CATAATTGAATATACATTTACAGCAGAA, RY-5 '
CCAGCTATATCATTAAGTCAAT, RY-3 ' CTTAATGGAGTATTTTGAATT composition.
Specific embodiment
For a better understanding of the present invention, below with reference to the embodiment content that the present invention is furture elucidated, but the present invention is not
It is limited only to the following examples.
In following embodiments, involved key instrument and reagent are as follows: minor effect genes (Shimadzu Corporation MultiNNA
MCE-202), PCR instrument (Shimadzu Corporation), ultraviolet-spectrophotometer (Shimadzu Corporation Biospec-nano), supercentrifuge
(Eppendort 5418)；DAN polymerase (SYBR Premix Ex Taq II, precious biology RR820), DNA dyestuff (
Gold Nucleic Acid Gel Stain, U.S. hero life technology Co., Ltd S-11494), minor effect genes kit
(DNA-500 Reagent Kit for MultiNA, Shimadzu Corporation 292-27910-91), DNA molecular amount standard (25bp DNA
Ladder, U.S. hero life technology Co., Ltd 10597-011), genome DNA extracting reagent kit (DNeasy Blood&
Tissue Kit, QIAGEN 69504).
In following embodiments, involved medicinal material sample includes Hirudo japonica, Hirudo japonica, hiruto and eight kinds on the market
The leech medicinal material of different batches.
Embodiment 1
It for identifying the specific primer pair of Hirudo japonica, is made of primer RY-5 ' and primer RY-3 ', the primer RY-
5 ' and the primer RY-3 ' is single strand dna, and nucleotide sequence is followed successively by sequence 1 and sequence 2 in sequence table.
Identify the method for leech sample using above-mentioned primer pair, steps are as follows:
(1) extracting genome DNA: leech sample to be tested takes 30mg, extracts total DNA with animal DNA extracts kit.According to
DNA extraction kit specification is operated, -4 DEG C of preservations；DNA extract takes 1 μ L, is verified using ultraviolet-spectrophotometer
DNA mass, it is 1.7-1.9 that concentration, which is greater than 10ng/ μ l, A260/A280 ratio, and the ratio of A260/A230 is greater than 2.0；
Sample to be tested is respectively that source is clear and the eurysome golden thread leech Jing Guo the authenticated kind of conventional method, day in this step
This doctor leech, hiruto standard items, have verified that the specificity of primer pair of the present invention；
(2) foundation of PCR amplification system with react: 20 μ L of PCR reaction system total volume, including SYBR Premix
10 μ l of Ex Taq II, the 1 μ l (20ng) of DNA profiling of extraction, primer pair RY-5 ', RY-3 ' dosage are 0.4 μM, sterile double steamings
Water supplements system to 20 μ L；
PCR response parameter: 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；35 are followed
Ring；72 DEG C of extension 5min；4 DEG C of preservations；
(3) result detects: after pcr amplification reaction, taking 1 μ L of PCR reaction product, minor effect genes detection, kit
It selects minor effect genes 500bp kit (DNA-500 Reagent Kit for MultiNA), system automatically generated gel figure
With electrophoretogram.
From Fig. 1 and Fig. 2: Hirudo japonica theory PCR product is 287bp, when sample to be tested is Hirudo japonica,
There is single band at 287bp, the fragment length and PCR target product that minor effect genes detect are almost the same.And with Japan doctor
When leech, hiruto and water are sample to be tested, there is no band respectively as between 200-300bp in the amplified production of template, it was demonstrated that
The primer pair can specificity identification Hirudo japonica.
Embodiment 2
Whether the specific primer of above-mentioned identification Hirudo japonica identifies it to being a variety of leech mixtures for sample to be tested
Contain Hirudo japonica.
Reaction system and detection method are referring to embodiment 1, and wherein DNA profiling is the hybrid dna template of a variety of leech, PCR
Amplified production is with Micro Chip Electrophoresis Analyser MultiNA detection.As a result it is shown by Fig. 3,4, Hirudo japonica ingredient in each mixing sample
It is all detected by Successful amplification and by Micro Chip Electrophoresis Analyser MultiNA, if mixing sample expands containing only hiruto and eurysome golden thread leech
There is no band between 200-300bp in volume increase object, negative control (water) is also without band.Prove what the primer pair can be specific
Identify the Hirudo japonica ingredient in mixture.
Embodiment 3
Using above-mentioned reaction system and response parameter, wherein primer pair is mix primer pair, the primer pair of eurysome golden thread leech
KT concentration is 0.4 μM, and the primer pair RY concentration of Hirudo japonica is 0.2 μM, and the primer pair FN concentration of hiruto is 0.4 μM, again
Method applicability verifying is carried out to the PCR identification system established with the leech medicinal material of 8 kinds of different batches, sample message is shown in Table 1,
Wherein expected results are the leech kind authenticated by conventional method, and specific electrophoretogram is shown in Fig. 5.
1 different batches leech sample message of table
As shown in Figure 5, the specific fragment of the amplifiable 287bp out of the Hirudo japonica sample of leech, and other leech samples
The specific fragment of 287bp can not then be amplified, it was demonstrated that primer pair specificity of the present invention is good, and strong applicability can be to Japan
Doctor leech intuitively, fast and accurately identify.
To sum up, method provided by the invention only accurately, quickly and reliably can be mixed easily from several by a PCR amplification
Identify Hirudo japonica in the leech kind confused, and the present invention is detected by minor effect genes, sensitivity is good, high resolution, divides
It analyses at low cost, easy to operate, is Chinese medicine and the strong analysis method of food Variety identification.
The above is only a preferred embodiment of the present invention, it is noted that come for those of ordinary skill in the art
It says, without departing from the concept of the premise of the invention, several modifications and variations can also be made, these belong to of the invention
Protection scope.
110 business administration of > Shimadzu (China) Co., Ltd of <
120 > of < identify Hirudo japonica specific primer to and method, application
160 > 7 of <
<210>1
<211>22
<212>DNA
<213>artificial sequence
<400>1
ccagctatat cattaagtca at 22
<210>2
<211>21
<212>DNA
<213>artificial sequence
<400>2
cttaatggag tattttgaat t 21
<210>3
<211>287
<212>DNA
<213>Hirudo japonica
<400>3
ccagctatat cattaagtca attttatatt atatttttag gggttaatat tacttttttt 60
cctcaacact ttctagggct aagaggaata ccacggcgat actcagacta tccagatgtg 120
tatatagatt gaaatgtagt atcatcattt ggttcaattc tttctactat tgctcttttt 180
ttatttgttt atttattatg agaatcatta agaactcaac gagctctaat tttcttccct 240
aggttagcag catcactaga gctattaatt caaaatactc cattaag 287
<210>4
<211>25
<212>DNA
<213>artificial sequence
<400>4
tatgtattga aagggtattc aatcg 25
<210>5
<211>26
<212>DNA
<213>artificial sequence
<400>5
ttaagaatga tcatcagtat atagtg 26
<210>6
<211>22
<212>DNA
<213>artificial sequence
<400>6
gtaattagaa tcgtaatagc tc 22
<210>7
<211>28
<212>DNA
<213>artificial sequence
<400>7
cataattgaa tatacattta cagcagaa 28
Claims (10)
1. for identifying the specific primer pair of Hirudo japonica, it is characterised in that be made of primer RY-5 ' and primer RY-3 ', institute
It states primer RY-5 ' and the primer RY-3 ' is single strand dna, nucleotide sequence is followed successively by the sequence 1 (5 ' in sequence table
CCAGCTATATCATTAAGTCAAT3 ') and sequence 2 (5 ' CTTAATGGAGTATTTTGAATT3 ').
2. the application of specific primer pair described in claim 1, it is characterised in that be any in following a)-f):
A) kit for detecting or assisting detection Hirudo japonica is prepared；
B) it detects or assists whether to contain in detection sample to be tested or candidate contains Hirudo japonica；
C) kit for identifying or assisting identification Hirudo japonica is prepared；
D) identify or assist to identify sample to be tested whether be or candidate is Hirudo japonica；
E) kit for identifying or assisting to identify the true or false of commercially available Hirudo japonica is prepared；
F) identify or assist the true or false of the commercially available Hirudo japonica of identification.
3. the kit containing specific primer pair described in claim 1, it is characterised in that the kit for identify or
Auxiliary identification Hirudo japonica.
4. kit as claimed in claim 3, it is characterised in that the kit further include Taq archaeal dna polymerase, dNTP, water or
Reaction buffer.
5. the application of kit as claimed in claim 3, it is characterised in that be following b1) b2) or b3):
B1 it) detects or assists whether to contain in detection sample to be tested or candidate contains Hirudo japonica；
B2) identify or assist to identify sample to be tested whether be or candidate is Hirudo japonica；
B3) identify or assist the true or false of the commercially available Hirudo japonica of identification.
6. whether a kind of detection sample to be tested contains or the candidate method containing Hirudo japonica, it is characterised in that including walking as follows
It is rapid: to extract the total DNA of sample to be tested as template, using specific primer described in claim 1 to PCR amplification is carried out, such as
Fruit can be realized effective amplification, then contains in the sample to be tested or candidate contains Hirudo japonica；If can not achieve effective expansion
Increase, is not then contained in the sample to be tested or candidate is without containing Hirudo japonica.
7. it is a kind of identify sample to be tested whether be or candidate is the method for Hirudo japonica, it is characterised in that include the following steps: to mention
Take the genomic DNA of sample to be tested as template, using specific primer described in claim 1 to progress PCR amplification, if
It can be realized effective amplification, then the sample to be tested is or candidate is Hirudo japonica；It is described if can not achieve effective amplification
Sample to be tested is not or candidate is not Hirudo japonica.
8. a kind of method for the true or false for identifying commercially available Hirudo japonica, it may include following steps: extract the base of commercially available Hirudo japonica
Because group DNA is as template, using specific primer described in claim 1 to progress PCR amplification, if it is possible to realize and effectively expand
Increase, then the commercially available Hirudo japonica is or candidate is genuine piece；If can not achieve effective amplification, the commercially available Hirudo japonica is
Or candidate is adulterant.
9. the method as described in claim 6 or 7 or 8, it is characterised in that described " can be realized effective amplification " is PCR expansion
Increase production the DNA fragmentation containing 200-300bp in object；Described " can not achieve effective amplification " is not contain in pcr amplification product
The DNA fragmentation of 200-300bp.
10. the method as described in claim 6 or 7 or 8, it is characterised in that when carrying out the PCR amplification, the amplification program of use
Concretely 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；35 circulations；72 DEG C of extensions
5min；The system of the PCR amplification can are as follows: when total volume is 20 μ l, 10 μ l of SYBR Premix Ex Taq II, and upstream primer
0.4 μM of RY-5 ', 0.4 μM of downstream primer RY-3 ', template 10-30ng, 20 μ l of sterile purified water polishing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811449782.1A CN109628603A (en) | 2018-11-30 | 2018-11-30 | Identify Hirudo japonica specific primer to and method, application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811449782.1A CN109628603A (en) | 2018-11-30 | 2018-11-30 | Identify Hirudo japonica specific primer to and method, application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109628603A true CN109628603A (en) | 2019-04-16 |
Family
ID=66070221
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811449782.1A Pending CN109628603A (en) | 2018-11-30 | 2018-11-30 | Identify Hirudo japonica specific primer to and method, application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109628603A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112481393A (en) * | 2020-12-15 | 2021-03-12 | 泸州百草堂健康产品有限公司 | PCR detection kit for identifying hirudo nipponica |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898235A (en) * | 2014-04-21 | 2014-07-02 | 牡丹江友搏药业股份有限公司 | DNA (deoxyribonucleic acid) barcoding based molecular identification method of leech |
| US9481718B2 (en) * | 2015-04-20 | 2016-11-01 | North American Hirudin Supplement Products Inc. | Extracting hirudin from leech in vivo |
| CN107937566A (en) * | 2017-12-29 | 2018-04-20 | 江苏大学 | The specific primer and its identification method of one group of identification leech |
-
2018
- 2018-11-30 CN CN201811449782.1A patent/CN109628603A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898235A (en) * | 2014-04-21 | 2014-07-02 | 牡丹江友搏药业股份有限公司 | DNA (deoxyribonucleic acid) barcoding based molecular identification method of leech |
| US9481718B2 (en) * | 2015-04-20 | 2016-11-01 | North American Hirudin Supplement Products Inc. | Extracting hirudin from leech in vivo |
| CN107937566A (en) * | 2017-12-29 | 2018-04-20 | 江苏大学 | The specific primer and its identification method of one group of identification leech |
Non-Patent Citations (3)
| Title |
|---|
| PETER TRONTELJ 等: "Celebrity with a neglected taxonomy: molecular systematics of the medicinal leech (genus Hirudo)", 《MOL PHYLOGENET EVOL.》 * |
| XU,Y. 等: "GenBank: KC667144.1，"Hirudo nipponia mitochondrion, complete genome"", 《GENBANK》 * |
| 赵吉平 等: "医学蛭类ＤＮＡ分子鉴定研究进展", 《中国药事》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112481393A (en) * | 2020-12-15 | 2021-03-12 | 泸州百草堂健康产品有限公司 | PCR detection kit for identifying hirudo nipponica |
| CN112481393B (en) * | 2020-12-15 | 2023-07-28 | 泸州百草堂健康产品有限公司 | PCR detection kit for identifying Hirudo japonica |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN109680071A (en) | Identify the primer set and method of leech kind | |
| CN104388598B (en) | A kind of HBV cccDNA digital pcr immue quantitative detection reagent box and application thereof | |
| CN108004312B (en) | Detect primer sets, kit and the method for cardiovascular disease related gene polymorphism | |
| CN110643680B (en) | Joint suitable for ultra-trace DNA sequencing and application thereof | |
| CN108753954B (en) | Capture probe set of dementia-related gene, kit, library construction method and application | |
| CN109900871A (en) | The DNA molecular discrimination method of leech medicinal material in a kind of cerebral ischemic preparation | |
| CN101545013A (en) | Hepatitis B virus multi-drug resistant gene locus typing detection kit | |
| CN107022611B (en) | Method and special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines | |
| CN109371141A (en) | Identify the method and specific primer pair of Atlantic salmon and rainbow trout | |
| CN109504782A (en) | A pair of of specificity identifies the primer of eurysome golden thread leech | |
| CN106434982A (en) | Relevant molecular markers for cerebral ischemic stroke and application of molecular markers | |
| CN107604077B (en) | A kind of multiple PCR primer and method of Rapid identification Blattaria insect species | |
| CN109628603A (en) | Identify Hirudo japonica specific primer to and method, application | |
| CN109439800A (en) | Detect the kit and method in the area HIV-1 gene PR and RT region gene mutation | |
| CN108866205A (en) | Identify the specific primer of hiruto based on molecular biology method | |
| CN109762919B (en) | Method for rapidly identifying raspberry and various confuses thereof | |
| CN108504774A (en) | A method of detection rhinovirus parting and enterovirus | |
| CN109762908A (en) | Identify hiruto specific primer to and method, application | |
| CN111635949A (en) | DNA barcode standard detection fragment for identifying wasp with yellow veins and application thereof | |
| CN106947815B (en) | Method and special primer for detecting accurate medication of aspirin and nitroglycerin | |
| CN107446998A (en) | MTHFR C677T, rs1801133 single nucleotide polymorphisms quick detections primer, molecular beacon, kit and its detection method | |
| CN115386649A (en) | A pair of Panax specific primers and molecular biological identification method of Panax Chinese medicinal material in Chinese patent medicine | |
| CN106755310B (en) | Kit and method for identifying Syngnathus | |
| CN103627789A (en) | Kit for detecting warfarin sensitivity gene by using electrochemical gene sensor method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190416 |