CN107022611B - Method and special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines - Google Patents
Method and special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines Download PDFInfo
- Publication number
- CN107022611B CN107022611B CN201710217190.6A CN201710217190A CN107022611B CN 107022611 B CN107022611 B CN 107022611B CN 201710217190 A CN201710217190 A CN 201710217190A CN 107022611 B CN107022611 B CN 107022611B
- Authority
- CN
- China
- Prior art keywords
- primer
- stranded
- sequence
- stranded extension
- primer pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a method and a special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines. The invention provides a special primer for detecting drug resistance SNP loci of 4 common clinical cardiovascular and cerebrovascular disease drugs. The method has the advantages that the detection of 8 SNP sites related to aspirin resistance, nitroglycerin resistance, warfarin individual difference and clopidogrel resistance is finished through efficient one-time experiments, the accurate medication gene detection of aspirin, nitroglycerin, warfarin and clopidogrel is finished through one-time experiments, and the experiment cost is reduced; the PCR primer and the unique UEP primer designed according to each SNP locus have higher specificity. The invention has very high application value for guiding the clinical accurate medication of aspirin, nitroglycerin, warfarin and clopidogrel, and is suitable for popularization and application.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a method and a special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines.
Background
Accurate medication is an important component of accurate medical treatment. The research of genetics pharmacology and pharmacogenomics proves that the single nucleotide polymorphisms of genes (such as drug transport protein genes, drug metabolizing enzyme genes and DNA repair genes) carried by different patients are different, the reaction to the drugs is different, and the curative effect of the same drug to different patients is also greatly different, so that from the perspective of the curative effect of the drugs, the gene detection is carried out to guide accurate drug administration, a doctor is helped to screen out an effective treatment scheme, the most correct treatment decision is made for the patients, the invalid medical expense of the patients is saved, and the treatment effect is improved.
Aspirin is a clinically common basic drug for preventing and treating arterial thrombotic diseases, and nitroglycerin is a clinically common cardiovascular and cerebrovascular emergency drug. Warfarin is a classic oral anticoagulant used for the prevention and treatment of deep vein thrombosis, heart valves, non-valvular atrial fibrillation, intracardiac thrombosis, perioperative surgical treatments, for over 50 years. Clinically, clopidogrel is a platelet aggregation inhibitor and is used for preventing and treating heart, brain and other arterial circulatory disorders caused by platelet high aggregation, such as thrombosis and the like.
However, clinically, there is a phenomenon of aspirin resistance, that is, aspirin is not effective in all patients with thrombus, and some patients cannot inhibit platelet aggregation and prevent thrombus formation even if they take aspirin, and thus clinical therapeutic effects are not achieved.
The phenomenon of using the nitroglycerin is very common in clinic, namely, the nitroglycerin taken by people in a hurry moment needing first aid cannot save lives even if the people strive for the second taking.
Warfarin has large individuation difference, doctors often have difficulty in grasping the clinical dosage of patients, the dosage is required to be searched for several weeks (months), and the high-incidence period of adverse events is 30-60 days. Excessive warfarin administration can easily cause bleeding risk (1-3%/year), especially for the elderly; if the dosage is insufficient, the clinical anticoagulation effect cannot be achieved. Warfarin gene testing was recommended by the U.S. Food and Drug Administration (FDA).
Clopidogrel is a very common clinical resistance phenomenon, and in 3 months of 2010, the FDA in the united states announces a "black box warning" of clopidogrel resistance, and recommends gene detection to remind that adverse cardiovascular events occurring after clopidogrel application are related to alleles with CYP2C19 loss of function.
Aspirin resistance phenomenon, nitroglycerin use ineffectiveness phenomenon, great individualized difference of warfarin, and clopidogrel resistance phenomenon closely related to gene polymorphism.
The traditional detection method mainly adopts sanger sequencing, fluorescent quantitative PCR and other methods. Although the method may provide better value clinically, the method has the reasons of time consumption, high economic cost, high time cost and the like, and cannot be popularized and used clinically in a large scale.
The matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MA L DI-TOF-MS) technology can simultaneously detect a plurality of gene polymorphic sites, has the advantages of strong compatibility, high flux, high accuracy and high cost performance, and can be used for simultaneously detecting accurate medication related gene information of aspirin resistance, nitroglycerin resistance, individualized difference of warfarin and clopidogrel resistance.
Disclosure of Invention
The invention aims to provide a special primer for detecting drug resistance SNP sites of 4 common clinical cardiovascular and cerebrovascular disease drugs.
The primer provided by the invention comprises a primer group 1 and a primer group 2;
the primer group 1 consists of a primer pair 1, a primer pair 2, a primer pair 3, a primer pair 4, a primer pair 5, a primer pair 6, a primer pair 7 and a primer pair 8;
the primer pair 1 consists of a single-stranded DNA molecule shown in a sequence 1 and a single-stranded DNA molecule shown in a sequence 2;
the primer pair 2 consists of a single-stranded DNA molecule shown in a sequence 3 and a single-stranded DNA molecule shown in a sequence 4;
the primer pair 3 consists of a single-stranded DNA molecule shown in a sequence 5 and a single-stranded DNA molecule shown in a sequence 6;
the primer pair 4 consists of a single-stranded DNA molecule shown in a sequence 7 and a single-stranded DNA molecule shown in a sequence 8;
the primer pair 5 consists of a single-stranded DNA molecule shown in a sequence 9 and a single-stranded DNA molecule shown in a sequence 10;
the primer pair 6 consists of a single-stranded DNA molecule shown in a sequence 11 and a single-stranded DNA molecule shown in a sequence 12;
the primer pair 7 consists of a single-stranded DNA molecule shown in a sequence 13 and a single-stranded DNA molecule shown in a sequence 14;
the primer pair 8 consists of a single-stranded DNA molecule shown in a sequence 15 and a single-stranded DNA molecule shown in a sequence 16.
The primer group 2 consists of a single-stranded extension primer 1, a single-stranded extension primer 2, a single-stranded extension primer 3, a single-stranded extension primer 4, a single-stranded extension primer 5, a single-stranded extension primer 6, a single-stranded extension primer 7 and a single-stranded extension primer 8;
the nucleotide sequence of the single-stranded extension primer 1 is a sequence 17;
the nucleotide sequence of the single-stranded extension primer 2 is sequence 18;
the nucleotide sequence of the single-stranded extension primer 3 is a sequence 19;
the nucleotide sequence of the single-stranded extension primer 4 is a sequence 20;
the nucleotide sequence of the single-stranded extension primer 5 is a sequence 21;
the nucleotide sequence of the single-stranded extension primer 6 is a sequence 22;
the nucleotide sequence of the single-stranded extension primer 7 is a sequence 23;
the nucleotide sequence of the single-stranded extension primer 8 is a sequence 24.
In the above primers, the molar ratio of each primer in the primer pair 1-primer pair 8 is equimolar ratio;
or the molar ratio of the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3, the single-stranded extension primer 4, the single-stranded extension primer 5, the single-stranded extension primer 6, the single-stranded extension primer 7 and the single-stranded extension primer 8 is 1: 1: 1: 1: 1: 1: 1: 1.
the invention also aims to provide a PCR reagent for detecting drug resistance SNP loci of 4 common clinical cardiovascular and cerebrovascular disease drugs.
The PCR reagent provided by the invention comprises a PCR reagent 1 and a PCR reagent 2;
the PCR reagent 1 comprises the primer pair 1, the primer pair 2, the primer pair 3, the primer pair 4, the primer pair 5, the primer pair 6, the primer pair 7, the primer pair 8, a PCR buffer solution and MgCl2Dntps and DNA polymerase;
the PCR reagent 2 comprises the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3, the single-stranded extension primer 4, the single-stranded extension primer 5, the single-stranded extension primer 6, the single-stranded extension primer 7, the single-stranded extension primer 8, a single-stranded extension buffer and a single-stranded extension enzyme in claim 1.
Among the PCR reagents described above, in the case of PCR reagents,
the concentration of each primer in the primer pair 1, the primer pair 2, the primer pair 3, the primer pair 4, the primer pair 5, the primer pair 6, the primer pair 7 and the primer pair 8 in the PCR reagent 1 is 0.1 mu M respectively;
or, the MgCl2The concentration in the PCR reagent 1 was 2 mM;
or, the concentration of the dNTP in the PCR reagent 1 is 0.5 mM;
or, the concentration of the DNA polymerase in the PCR reagent 1 is 0.2U/. mu.l;
the concentrations of the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3, the single-stranded extension primer 4, the single-stranded extension primer 5, the single-stranded extension primer 6, the single-stranded extension primer 7 and the single-stranded extension primer 8 in the PCR reagent 2 were 0.05. mu.M, respectively.
The invention aims at providing a kit for detecting drug resistance SNP loci of 4 common clinical cardiovascular and cerebrovascular disease drugs.
The kit provided by the invention comprises the special primer or the PCR reagent 2.
The application of the special primer or the PCR reagent or the kit in the preparation of 4 common clinical cardiovascular and cerebrovascular disease drug resistance SNP locus genotype products is also within the protection scope of the invention;
or the application of the special primer or the PCR reagent or the kit in detecting the drug resistance SNP locus genotypes of 4 common clinical cardiovascular and cerebrovascular disease drugs is also within the protection scope of the invention;
or the application of the special primer or the PCR reagent or the kit in the cardiovascular and cerebrovascular disease guiding medication of a sample to be detected is also within the protection scope of the invention;
or the application of the special primer or the PCR reagent or the kit in preparing the product for guiding the cardiovascular and cerebrovascular diseases of the sample to be detected is also within the protection scope of the invention.
The 4 th purpose of the invention is to provide a method for detecting the drug resistance SNP locus genotypes of 4 common clinical cardiovascular and cerebrovascular disease drugs in a sample to be detected.
The method provided by the invention comprises the following steps:
1) carrying out PCR amplification on a sample to be detected by using the primer pairs 1-8 in the special primers to obtain a PCR amplification product;
2) carrying out alkaline phosphatase digestion on the PCR amplification product to obtain a digestion product;
3) performing single-base extension reaction on the digestion product by using the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3, the single-stranded extension primer 4, the single-stranded extension primer 5, the single-stranded extension primer 6, the single-stranded extension primer 7 and the single-stranded extension primer 8 in the special primer according to claim 1 or 2 to obtain a single-base extension reaction product;
4) and purifying the single base extension reaction product, and then carrying out matrix-assisted laser desorption ionization time-of-flight mass spectrometry to obtain the genotypes of the drug resistance SNP sites of the 4 common clinical cardiovascular and cerebrovascular disease drugs in the sample to be detected.
In the method, the template amplified by PCR is the genomic DNA of the sample to be detected.
In the method, the PCR amplification procedure comprises the steps of carrying out 45 cycles of 94 ℃ for 2min, then 94 ℃ for 20s, 56 ℃ for 30s and 72 ℃ for 60s, and then 72 ℃ for 3 min;
or the procedure for the alkaline phosphatase digestion is: at 37 ℃ for 40 min; storing at 85 deg.C for 5min and 4 deg.C;
or the procedure of the single base extension reaction is: performing 5 cycles of 94 deg.C for 30s, 94 deg.C for 5s, (52 deg.C for 5s, and 80 deg.C for 5s) for 40 cycles, and 72 deg.C for 3 min;
or the purification is a resin purification.
In the above, the SNP sites are rs5918 (corresponding to primer pair 1 and single-strand extension primer 1), rs1330344 (corresponding to primer pair 2 and single-strand extension primer 2), rs20417 (corresponding to primer pair 3 and single-strand extension primer 3), rs671 (corresponding to primer pair 4 and single-strand extension primer 4), rs1057910 (corresponding to primer pair 5 and single-strand extension primer 5), rs9923231 (corresponding to primer pair 6 and single-strand extension primer 6), rs4244285 (corresponding to primer pair 7 and single-strand extension primer 7), and rs4986893 (corresponding to primer pair 8 and single-strand extension primer 8);
the 4 common clinical cardiovascular and cerebrovascular disease medicines are aspirin, nitroglycerin, warfarin and clopidogrel.
Experiments prove that the method can efficiently complete 8 SNP site detections related to aspirin resistance, nitroglycerin resistance, warfarin individual difference and clopidogrel resistance in one-time experiments, and can complete accurate medication gene detection of aspirin, nitroglycerin, warfarin and clopidogrel in one-time experiments, so that the experiment cost is reduced; the PCR primer and the unique UEP primer designed according to each SNP locus have higher specificity. The invention has very high application value for guiding the clinical accurate medication of aspirin, nitroglycerin, warfarin and clopidogrel, and is suitable for popularization and application.
Drawings
Fig. 1 shows the result of rs5918 detection.
FIG. 2 shows the result of the rs1330344 assay.
Fig. 3 shows the result of rs 9923231.
Fig. 4 shows the result of rs4986893 detection.
FIG. 5 shows the result of rs671 assay.
Fig. 6 shows the result of rs20417 detection.
FIG. 7 shows the result of the rs1057910 assay.
Fig. 8 shows the result of rs4244285 detection.
FIG. 9 shows the result of detection of rs5918 primer set 1.
FIG. 10 shows the result of detection of rs5918 primer set 2.
FIG. 11 shows the result of detection of rs1330344 primer set 1.
FIG. 12 shows the result of detection of rs1330344 primer set 2.
FIG. 13 shows the result of detection of rs4986893 primer set 1.
FIG. 14 shows the result of detection of rs4986893 primer set 2.
FIG. 15 shows the result of detection of rs20417 primer set 1.
FIG. 16 shows the result of detection of rs20417 primer set 2.
FIG. 17 shows the result of detection of rs671 primer set 1.
FIG. 18 shows the result of detection of rs671 primer set 2.
FIG. 19 shows the result of detection of rs1057910 primer set 1.
FIG. 20 shows the result of detection of rs1057910 primer set 2.
FIG. 21 shows the result of detection of rs9923231 primer set 1.
FIG. 22 shows the result of detection of rs9923231 primer set 2.
FIG. 23 shows the result of detection of rs4244285 primer set 1.
FIG. 24 shows the result of detection of rs4244285 primer set 2.
Fig. 25 shows the results of the rs671 optimization condition 1 test.
Fig. 26 shows the rs9923231 optimization condition 2 detection result.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 method for detecting drug resistance SNP loci of 4 common clinical cardiovascular and cerebrovascular disease drugs and special primers
Special primer for detecting drug resistance SNP (single nucleotide polymorphism) sites of 4 common clinical cardiovascular and cerebrovascular disease drugs
Specific PCR primers and UEP primers are designed according to related SNP sites of aspirin resistance, nitroglycerin resistance, warfarin individual difference and clopidogrel resistance related genes rs5918, rs1330344, rs20417, rs671, rs1057910, rs9923231, rs4244285 and rs4986893, and accurate medication gene detection of aspirin resistance, nitroglycerin resistance, warfarin individuation difference and clopidogrel resistance phenomenon is realized by utilizing a matrix-assisted laser desorption ionization time of flight mass spectrometry (MA L DI-TOF-MS) technology.
Specific PCR primers and UEP primers include:
rs5918PCR primer 1: ACGTTGGATGTCTTTGGGCTCCTGTCTTAC (SEQ ID NO: 1);
rs5918PCR primer 2: ACGTTGGATGAGCAGATTCTCCTTCAGGTC (SEQ ID NO: 2);
rs1330344PCR primer 1: ACGTTGGATGAGGTCACGCTATGGAAGAAG (SEQ ID NO: 3);
rs1330344PCR primer 2: ACGTTGGATGAAGAAACACTTGTGTGGCCC (SEQ ID NO: 4);
rs20417PCR primer 1: ACGTTGGATGACAGGGTAACTGCTTAGGAC (SEQ ID NO: 5);
rs20417PCR primer 2: ACGTTGGATGACTGTTCTCCGTACCTTCAC (SEQ ID NO: 6);
rs671PCR primer 1: ACGTTGGATGTTGGTGGCTACAAGATGTCG (SEQ ID NO: 7);
rs671PCR primer 2: ACGTTGGATGAGGTCCCACACTCACAGTTT (SEQ ID NO: 8);
rs1057910 primer 1: ACGTTGGATGTGTCACAGGTCACTGCATGG (SEQ ID NO: 9);
rs1057910 primer 2: ACGTTGGATGCTACACAGATGCTGTGGTGC (SEQ ID NO: 10);
rs9923231 primer 1: ACGTTGGATGGCTAGGATTATAGGCGTGAG (SEQ ID NO: 11);
rs9923231 primer 2: ACGTTGGATGTCTGGGAAGTCAAGCAAGAG (SEQ ID NO: 12);
rs4244285 primer 1: ACGTTGGATGGCAATAATTTTCCCACTATC (SEQ ID NO: 13);
rs4244285 primer 2: ACGTTGGATGCACTTTCCATAAAAGCAAGG (SEQ ID NO: 14);
rs4986893 primer 1: ACGTTGGATGGACTGTAAGTGGTTTCTCAG (SEQ ID NO: 15);
rs4986893 primer 2: ACGTTGGATGAACATCAGGATTGTAAGCAC (SEQ ID NO: 16);
rs5918UEP primer: TTACAGGCCCTGCCTC (SEQ ID NO: 17);
rs1330344UEP primer: TGAAGGCTCTTCCCAT (SEQ ID NO: 18);
rs20417UEP primer: AGGAGAATTTACCTTTCCC (SEQ ID NO: 19);
rs671UEP primer CCACACTCACAGTTTTCACTT (SEQ ID NO: 20);
rs1057910UEP primer: CAGGCTGGTGGGGAGAAGGTCAA (SEQ ID NO: 21);
rs9923231UEP primer: GATTATAGGCGTGAGCCACCGCACC (SEQ ID NO: 22);
rs4244285UEP primer: TTTCCCACTATCATTGATTATTTCCC (SEQ ID NO: 23);
rs4986893UEP primer: AAACTTGGCCTTACCTGGAT (sequence 24)
Second, method for detecting drug resistance SNP locus of 4 common clinical cardiovascular and cerebrovascular disease drugs
1. Extraction of template DNA
Genomic DNA was extracted from 192 cases of extracorporeal peripheral blood, and the concentration of the prepared working solution was 20-30 ng/. mu.l.
2. PCR reaction
Prepare 5 μ l PCR reaction in 384-well plates: 1 μ l of template DNA and 1 μ l of primer mixture (final concentration of each primer in the reaction system)0.1. mu.M each), 10 × Buffer (containing 15mM Mg2+)0.5μl，MgCl2Mu.l (25mM) (final concentration 2mM), 0.1. mu.l (final concentration 0.5mM) dNTP (25mM), 0.2. mu.l (final concentration 0.2U/. mu.l) Hotstar Taq (5U/. mu.l) were made up to 5. mu.l with MBG water. The 384 well plates were sealed with a sealing membrane.
The primer mixture consists of primers shown in sequences 1-16 and water, wherein the concentration of each primer is 0.5 mu M.
And carrying out PCR reaction on the reaction system to obtain a PCR amplification product.
The PCR reaction program was set up as follows:
3. alkaline phosphatase treatment (SAP digestion reaction)
The following were added to the PCR amplification product obtained in 2 above: SAP Buffer 0.17. mu.l, SAP Enzyme (Agena BIOSCIENCE, product ref:100021, lot:0000021450) 0.30. mu.l, and MBG water 1.53. mu.l, to obtain an SAP digestion reaction system.
And carrying out digestion reaction on the SAP digestion reaction system to obtain a digestion reaction product.
The digestion reaction procedure described above: at 37 ℃ for 40 min; 5min at 85 ℃; 4 ℃ and infinity.
4. Single base extension reaction
To the digestion reaction product obtained in the above 3 were added 0.2. mu.l of iP L EX Buffer plus (Agena BIOSCIENCE, Ref:01431, lot:0000021844), 0.2. mu.l of iP L EX Terminator (Agena BIOSCIENCE, Ref:01430, lot:0000021435), 0.041. mu.l of iP L EX Enzyme (Agena BIOSCIENCE, Ref:01432, lot:0000021845), 0.619. mu.l of MBG water, and 0.940. mu.l of primers (final concentration of each primer in the single-base extension reaction mixture was 0.05. mu.M), to obtain a single-base extension reaction mixture.
The primer Mix consists of primers shown in sequences 17-24 and water, and the concentration of each primer is 0.5. mu.M.
And carrying out single base extension reaction on the single base extension reaction system to obtain a single base extension reaction product.
The above single base extension reaction procedure is as follows:
5. resin purification
The product of the single base extension reaction obtained in the above 4 was subjected to resin purification as follows:
1) the 384 reaction plates containing the single base extension products obtained in 4 above were centrifuged at 3000rpm for 2min, 16. mu.l of MBG water was added to each well, the reaction plates were sealed with a sealing film, and the plates were centrifuged instantaneously at 3000 rpm.
2) A clean A4 paper is taken, a resin plate (specification is 6mg) is placed on the paper, a proper amount of resin (Agena BIOSCIENCE, product ref:08040, lot:0000022403) is taken by a spoon and placed on the resin plate, a plastic cover plate is used for repeatedly pushing the resin to the left and the right, and the resin is compacted to ensure that the resin content in each hole is uniform.
3) The centrifuged 384 reaction plate was inverted over the resin plate with the resin laid, with the wells of the two plates in one-to-one correspondence. The plates were inverted with the resin plate on top and the 384 reaction plate on the bottom. The back of the resin plate was gently knocked evenly to drop the resin into a 384 reaction plate containing the single base extension product.
4) The 384 reaction plate containing the single base extension product and the resin is sealed with a sealing film, and the shaker is rotated vertically at a low speed for 30min to bring the resin into full contact with the reactants.
5) And centrifuging the 384 reaction plates after the reaction is finished at 3000rpm for 5min to enable the resin to sink to the bottom of the tube, wherein the supernatant is the purified product.
6. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MA L DI-TOF-MS) detection
The purified product obtained in the above step 5 was transferred to a chip (Agena BIOSCIENCE, product ref:01509, lot:0000022421) by a spotting instrument, and placed in a mass spectrometer for mass spectrometry (mass spectrometry molecular weight range: 4500-.
The results are shown in FIGS. 1-8, and genotypes of the sites rs5918, rs1330344, rs20417, rs671, rs1057910, rs9923231, rs4244285 and rs4986893 are obtained; it can be seen that the primer pairs and methods of the invention can be used for genotyping these sites.
The precise medication analysis is performed according to the detected genotypes, and clinical medication is guided, which is specifically shown in table 1.
TABLE 1 genotype guide for clinical medication
| Detection site | Clinical significance |
| rs5918 | Genotype CC and CT are more likely to develop aspirin resistance than genotype TT |
| rs1330344 | Genotype CT and CC are more prone to develop aspirin resistance than genotype TT |
| rs20417 | Genotypes CC and GG are more prone to aspirin resistance than genotype GG |
| rs671 | Genotypes GA and AA are more susceptible to nitroglycerin resistance than genotype GG |
| rs1057910 | The genotype AA can be taken normally, and the dosage of the AC and the CC can be properly reduced |
| rs9923231 | The genotype GG can be taken normally, and the dosage of AA and GA can be properly reduced |
| rs4244285 | Genotype GA and AA, compared with genotype GG, are more likely to develop clopidogrel resistance |
| rs4986893 | Genotype GA and AA, compared with genotype GG, are more likely to develop clopidogrel resistance |
Example 2 method for detecting drug resistance SNP sites of 4 common clinical cardiovascular and cerebrovascular disease drugs and application of special primers
1. Extraction of template DNA
DNA was extracted by the method of 1 in example 1, using 5 subjects' peripheral blood (all showing symptoms such as hypertension and thrombus) as samples 1 to 5.
2. And (3) PCR reaction: same as 2 of the second embodiment of example 1.
3. Alkaline phosphatase treatment (SAP digestion reaction): the same as 3 of the second embodiment of example 1.
4. Single base extension reaction: same as 4 of the second embodiment of example 1.
5. Resin purification: the same as example 1, second 5.
6. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MA L DI-TOF-MS) detection:
the procedure was the same as that of example 1,2, and the results were as follows:
TABLE 2 SNP sites of the samples to be examined
| |
|
|
|
|
|
| rs5918 | TT | TT | TT | TT | TT |
| rs1330344 | TT | CT | CT | CT | TT |
| rs20417 | GG | GC | GC | GC | GC |
| rs671 | GG | GG | GA | GA | CA |
| rs1057910 | AC | AA | AC | AC | AC |
| rs9923231 | GA | GG | GA | GA | GA |
| rs4244285 | AG | GG | GG | AA | GG |
| rs4986893 | GG | GG | GA | GA | GG |
From the analysis results of table 1, it can be seen that:
the sample 1 is sensitive to aspirin, aspirin resistance is not easy to occur, the sample 5 has certain aspirin resistance, the samples 2,3 and 4 are easy to occur aspirin resistance, and the dosage of the medicine is increased;
the sample 2 is easy to have warfarin resistance, the dosage of the medicine can be properly increased clinically, and the samples 1,3,4 and 5 can reduce the dosage of warfarin, so that the clinical treatment effect can be achieved, and the side effect of gastrorrhagia can be reduced.
Clinical medication verification:
the patient in sample 1 is sensitive to aspirin and is not easy to have aspirin resistance, the patient in sample 5 has certain aspirin resistance, and the patients in samples 2,3 and 4 are easy to have aspirin resistance, so that the dosage of the medicine is increased;
warfarin resistance easily occurs in sample 2, the dosage of the drug is properly increased clinically, and the dosage of warfarin is reduced in samples 1,3,4 and 5, so that the clinical treatment effect can be achieved, and the side effect of gastrorrhagia is reduced.
This is consistent with the results of the present invention, indicating that the present invention is correct.
Comparative examples 1,
The design of the primer is the key of the detection work, the combination rate of the primer and the template directly influences the PCR amplification efficiency, so that the sensitivity and the detection rate of the detection result are influenced, particularly, the design requirement of the UEP primer is very high, except for the requirement of complete base complementary match of the sequence and the sequence in front of the detection site, the 8UEP primers must be increased in gradient in length design so as to generate molecular weight difference and realize mass spectrum detection. Non-specific binding of the primer to the template results in non-specific amplification products, which also interfere with the experimental results.
For each SNP site, the inventors designed 3 sets of PCR primers and UEP primers in parallel (primer set 3 in example 1), and detected 192 samples with 3 sets of primers according to the method of example 1, and compared the detection effect of the set 3 primers in example 1 is the best: high detection rate, high sensitivity, good clustering effect and high specificity.
Table 3 shows primer set 1
Table 4 shows primer set 2
Primer set 3 is shown in sequence 1-sequence 24 in example 1.
As a result, as shown in FIGS. 9 to 24, the primer set 2 and the primer set 1 both showed the cases of low detection rate of the existing sites and poor clustering effect.
Comparative example 2 optimization procedure for different enzyme concentration gradients and PCR reaction cycle number
In exploring the reaction system of example 1, the following parallel experiments were made:
1. optimizing the condition 1:
⑴ PCR reaction:
the final concentration of each primer was: 0.1. mu.M
MgCl2To a final concentration of 2mM
The final concentration of dNTPs was 0.5mM
The final concentration of Hotstar Taq was 0.1U/. mu.l
The PCR reaction program was set up as follows:
⑵ enzyme digestion of SAP including digestion at 37 deg.C for 45min, 85 deg.C for 5min, 4 deg.C and infinity.
⑶ Single base extension reaction
2. Optimization condition 2:
⑴ PCR reaction:
the final concentration of each primer was: 0.1. mu.M
MgCl2To a final concentration of 2mM
The final concentration of dNTPs was 0.5mM
The final concentration of Hotstar Taq was 0.1U/. mu.l
The PCR reaction program was set up as follows:
⑵ enzyme digestion of SAP including digestion at 37 deg.C for 40min, 85 deg.C for 5min, 4 deg.C and infinity.
⑶ Single base extension reaction
The primer group, the control primer group 1 and the primer group 2 in example 1 are used to detect the rs671 and the rs9923231 sites of 192 samples of the same sample in example 1, and the detected reaction system and the detected reaction conditions are respectively the optimization condition 1 and the optimization condition 2, and the results are shown in fig. 25 and fig. 26, which shows that the site detection rate of the optimization condition 1 and the optimization condition 2 is low and the clustering effect is poor. The effect was inferior to that of the reaction system and reaction conditions of example 1.
Sequence listing
<110> Li-lover's silk
<120> method for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines and special primer
<160>24
<170>PatentIn version 3.5
<210>1
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>1
acgttggatg tctttgggct cctgtcttac 30
<210>2
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>2
acgttggatg agcagattct ccttcaggtc 30
<210>3
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>3
acgttggatg aggtcacgct atggaagaag 30
<210>4
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>4
acgttggatg aagaaacact tgtgtggccc 30
<210>5
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>5
acgttggatg acagggtaac tgcttaggac 30
<210>6
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>6
acgttggatg actgttctcc gtaccttcac 30
<210>7
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>7
acgttggatg ttggtggcta caagatgtcg 30
<210>8
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>8
acgttggatg aggtcccaca ctcacagttt 30
<210>9
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>9
acgttggatg tgtcacaggt cactgcatgg 30
<210>10
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>10
acgttggatg ctacacagat gctgtggtgc 30
<210>11
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>11
acgttggatg gctaggatta taggcgtgag 30
<210>12
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>12
acgttggatg tctgggaagt caagcaagag 30
<210>13
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>13
acgttggatg gcaataattt tcccactatc 30
<210>14
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>14
acgttggatg cactttccat aaaagcaagg 30
<210>15
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>15
acgttggatg gactgtaagt ggtttctcag 30
<210>16
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>16
acgttggatg aacatcagga ttgtaagcac 30
<210>17
<211>16
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>17
ttacaggccc tgcctc 16
<210>18
<211>16
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>18
tgaaggctct tcccat 16
<210>19
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>19
aggagaattt acctttccc 19
<210>20
<211>21
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>20
ccacactcac agttttcact t 21
<210>21
<211>23
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>21
caggctggtg gggagaaggt caa 23
<210>22
<211>25
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>22
gattataggc gtgagccacc gcacc 25
<210>23
<211>26
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>23
tttcccacta tcattgatta tttccc 26
<210>24
<211>20
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>24
aaacttggcc ttacctggat 20
Claims (10)
1. A special primer for detecting drug resistance SNP loci of 4 common clinical cardiovascular and cerebrovascular disease drugs comprises a primer group 1 and a primer group 2;
the primer group 1 consists of a primer pair 1, a primer pair 2, a primer pair 3, a primer pair 4, a primer pair 5, a primer pair 6, a primer pair 7 and a primer pair 8;
the primer pair 1 consists of a single-stranded DNA molecule shown in a sequence 1 and a single-stranded DNA molecule shown in a sequence 2;
the primer pair 2 consists of a single-stranded DNA molecule shown in a sequence 3 and a single-stranded DNA molecule shown in a sequence 4;
the primer pair 3 consists of a single-stranded DNA molecule shown in a sequence 5 and a single-stranded DNA molecule shown in a sequence 6;
the primer pair 4 consists of a single-stranded DNA molecule shown in a sequence 7 and a single-stranded DNA molecule shown in a sequence 8;
the primer pair 5 consists of a single-stranded DNA molecule shown in a sequence 9 and a single-stranded DNA molecule shown in a sequence 10;
the primer pair 6 consists of a single-stranded DNA molecule shown in a sequence 11 and a single-stranded DNA molecule shown in a sequence 12;
the primer pair 7 consists of a single-stranded DNA molecule shown in a sequence 13 and a single-stranded DNA molecule shown in a sequence 14;
the primer pair 8 consists of a single-stranded DNA molecule shown in a sequence 15 and a single-stranded DNA molecule shown in a sequence 16;
the primer group 2 consists of a single-stranded extension primer 1, a single-stranded extension primer 2, a single-stranded extension primer 3, a single-stranded extension primer 4, a single-stranded extension primer 5, a single-stranded extension primer 6, a single-stranded extension primer 7 and a single-stranded extension primer 8;
the nucleotide sequence of the single-stranded extension primer 1 is a sequence 17;
the nucleotide sequence of the single-stranded extension primer 2 is sequence 18;
the nucleotide sequence of the single-stranded extension primer 3 is a sequence 19;
the nucleotide sequence of the single-stranded extension primer 4 is a sequence 20;
the nucleotide sequence of the single-stranded extension primer 5 is a sequence 21;
the nucleotide sequence of the single-stranded extension primer 6 is a sequence 22;
the nucleotide sequence of the single-stranded extension primer 7 is a sequence 23;
the nucleotide sequence of the single-stranded extension primer 8 is a sequence 24.
2. The specialized primer of claim 1, wherein:
the molar ratio of each primer in the primer pairs 1-8 is equal molar ratio;
or the molar ratio of the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3, the single-stranded extension primer 4, the single-stranded extension primer 5, the single-stranded extension primer 6, the single-stranded extension primer 7 and the single-stranded extension primer 8 is 1: 1: 1: 1: 1: 1: 1: 1.
3. the dedicated primer according to claim 1 or 2, characterized in that: the SNP loci are rs5918, rs1330344, rs20417, rs671, rs1057910, rs9923231, rs4244285 and rs 4986893;
the 4 common clinical cardiovascular and cerebrovascular disease medicines are aspirin, nitroglycerin, warfarin and clopidogrel.
4. A PCR reagent for detecting drug resistance SNP loci of 4 common clinical cardiovascular and cerebrovascular disease drugs comprises a PCR reagent 1 and a PCR reagent 2;
the PCR reagent 1 comprises a primer pair 1, a primer pair 2, a primer pair 3, a primer pair 4, a primer pair 5, a primer pair 6, a primer pair 7, a primer pair 8, PCR buffer solution and MgCl in claim 12Dntps and DNA polymerase;
the PCR reagent 2 comprises the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3, the single-stranded extension primer 4, the single-stranded extension primer 5, the single-stranded extension primer 6, the single-stranded extension primer 7, the single-stranded extension primer 8, a single-stranded extension buffer and a single-stranded extension enzyme in claim 1.
5. The PCR reagent according to claim 4, wherein:
the concentration of each primer in the primer pair 1, the primer pair 2, the primer pair 3, the primer pair 4, the primer pair 5, the primer pair 6, the primer pair 7 and the primer pair 8 in the PCR reagent 1 is 0.1 mu M;
or, the concentration of MgCl2 in the PCR reagent 1 is 2 mM;
or, the concentration of the dNTP in the PCR reagent 1 is 0.5 mM;
or, the concentration of the DNA polymerase in the PCR reagent 1 is 0.2U/. mu.l;
the concentrations of the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3, the single-stranded extension primer 4, the single-stranded extension primer 5, the single-stranded extension primer 6, the single-stranded extension primer 7 and the single-stranded extension primer 8 in the PCR reagent 2 are all 0.05. mu.M.
6. The PCR reagent according to claim 4 or 5, wherein: the SNP loci are rs5918, rs1330344, rs20417, rs671, rs1057910, rs9923231, rs4244285 and rs 4986893;
the 4 common clinical cardiovascular and cerebrovascular disease medicines are aspirin, nitroglycerin, warfarin and clopidogrel.
7. A kit for detecting drug-resistant SNP sites of 4 common clinical cardiovascular and cerebrovascular diseases, which comprises the special primers as claimed in claim 1 or 2 or the PCR reagents as claimed in claim 4 or 5.
8. The kit of claim 7, wherein: the SNP loci are rs5918, rs1330344, rs20417, rs671, rs1057910, rs9923231, rs4244285 and rs 4986893;
the 4 common clinical cardiovascular and cerebrovascular disease medicines are aspirin, nitroglycerin, warfarin and clopidogrel.
9. The use of the special primer of claim 1 or 2 or the PCR reagent of claim 4 or 5 or the kit of claim 7 for preparing a product for detecting drug resistance SNP loci genotype of 4 common clinical cardiovascular and cerebrovascular diseases;
or the special primer of claim 1 or 2 or the PCR reagent of claim 4 or 5 or the kit of claim 7, in the preparation of a product for guiding cardiovascular and cerebrovascular diseases of a sample to be tested.
10. Use according to claim 9, characterized in that: the SNP loci are rs5918, rs1330344, rs20417, rs671, rs1057910, rs9923231, rs4244285 and rs 4986893;
the 4 common clinical cardiovascular and cerebrovascular disease medicines are aspirin, nitroglycerin, warfarin and clopidogrel.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710217190.6A CN107022611B (en) | 2017-04-05 | 2017-04-05 | Method and special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710217190.6A CN107022611B (en) | 2017-04-05 | 2017-04-05 | Method and special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107022611A CN107022611A (en) | 2017-08-08 |
| CN107022611B true CN107022611B (en) | 2020-07-31 |
Family
ID=59526882
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710217190.6A Active CN107022611B (en) | 2017-04-05 | 2017-04-05 | Method and special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107022611B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109306377A (en) * | 2018-05-21 | 2019-02-05 | 上海迈浦生物科技有限公司 | SNaPShot serotype specific primer and its detection method |
| CN109371115A (en) * | 2018-08-24 | 2019-02-22 | 山东德诺生物科技有限公司 | For detecting the primed probe group and its application of rs5918 |
| CN109182509B (en) * | 2018-10-29 | 2022-05-06 | 广州金域医学检验集团股份有限公司 | Primer group, kit and method for detecting polymorphic sites of hypertension-related drug genes |
| CN112553319B (en) * | 2020-12-10 | 2022-09-09 | 北京大学人民医院 | Special primer for detecting anticoagulant and/or antiplatelet drug resistance related gene SNP locus and application |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2830407C (en) * | 2011-03-15 | 2021-08-31 | University Of Utah Research Foundation | Methods of diagnosing and treating vascular associated maculopathy and symptoms thereof |
| US20130095179A1 (en) * | 2011-09-15 | 2013-04-18 | Omthera Pharmaceuticals, Inc. | Methods and compositions for treating, reversing, inhibiting or preventing resistance to antiplatelet therapy |
| WO2013049278A1 (en) * | 2011-09-30 | 2013-04-04 | Novartis Ag | USE OF IL-1 ß BINDING ANTIBODIES |
| CN102676666A (en) * | 2012-05-04 | 2012-09-19 | 周宏灏 | Kit and method for detecting gene polymorphism related to warfarin personalized medication by pyro sequencing method |
| CN102690888B (en) * | 2012-06-15 | 2013-06-05 | 毅新兴业（北京）科技有限公司 | Primer system for detecting gene SNP (single nucleotide polymorphism) related to warfarin dosage and application of primer system |
| CN103233068B (en) * | 2013-04-19 | 2015-04-29 | 北京毅新博创生物科技有限公司 | Primer system for detecting genetic polymorphic sites related to human cytochrome P450 and application of primer system |
| CN105671165A (en) * | 2016-03-05 | 2016-06-15 | 复旦大学附属华山医院 | Kit for detecting efficient typing of gene loci related to clopidogrel drug resistance reaction |
| CN105803104A (en) * | 2016-05-27 | 2016-07-27 | 刘鹏飞 | Reagent system and kit for detecting alcohol or nitroglycerin metabolism and application of reagent system and kit |
-
2017
- 2017-04-05 CN CN201710217190.6A patent/CN107022611B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107022611A (en) | 2017-08-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106893783B (en) | A kind of detection method and primer special for the accurate early warning of cardiovascular and cerebrovascular disease risk and accurate medication | |
| CN107022611B (en) | Method and special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines | |
| CN109868314B (en) | Kit for detecting cardiovascular disease drug gene and detection method | |
| CN109136365B (en) | Detection method for children personalized medication analysis based on SNP (Single nucleotide polymorphism) locus and application thereof | |
| JP2014530819A5 (en) | ||
| CN104774933A (en) | Primers, kit and method for detection of polymorphism of human IL28B gene | |
| CN111808944A (en) | Gene detection method for children personalized medicine | |
| CN112553319B (en) | Special primer for detecting anticoagulant and/or antiplatelet drug resistance related gene SNP locus and application | |
| CN104711344A (en) | Warfarin individualized medication gene detection kit and application thereof | |
| CN110699446B (en) | SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof | |
| CN105886606A (en) | Kit for rapid detection of polymorphism of Warfarin metabolic enzyme gene by virtue of pyrosequencing method and application of kit | |
| CN107557460A (en) | Method based on nucleic acid mass-spectrometric technique detection colorectal cancer driving gene and susceptible SNP | |
| CN106947815B (en) | Method and special primer for detecting accurate medication of aspirin and nitroglycerin | |
| WO2013060005A1 (en) | Method for detecting specific single nucleotide polymorphism related to ankylosing spondylitis and kit therefor | |
| CN110846399A (en) | Cardiovascular disease individualized medication gene detection system kit and application thereof | |
| CN103131776A (en) | A719G single nucleotide polymorphism detection kit of thiopurine methyltransferase (TPMT) * 3C | |
| TWI567202B (en) | Method and kit for determination of alcohol metabolizing genes | |
| CN111235252A (en) | Method for distinguishing individual medication of nitrendipine by mass spectrometry through detecting product | |
| CN111235251A (en) | Kit for detecting gene of nitrendipine individualized medication guidance of antihypertensive drug | |
| CN111690736A (en) | Warfarin medication gene detection kit and use method thereof | |
| CN110951858A (en) | Primer-probe combination for guiding detection of genes related to glibenclamide drug personalized administration, kit and application | |
| CN111235254A (en) | Primer composition for distinguishing nitrendipine individualized medication type | |
| CN111206083A (en) | Detection kit for medication guidance gene of telmisartan medicament for reducing hypertension | |
| CN111235255A (en) | Method for distinguishing individual medication of nitrendipine by using primer composition through mass spectrometry | |
| CN112481372B (en) | Primer for detecting SNP locus of gene related to accurate medication of chronic heart failure and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |