CN105671165A

CN105671165A - Kit for detecting efficient typing of gene loci related to clopidogrel drug resistance reaction

Info

Publication number: CN105671165A
Application number: CN201610123251.8A
Authority: CN
Inventors: 徐剑锋; 刘旭
Original assignee: Huashan Hospital of Fudan University
Current assignee: Huashan Hospital of Fudan University
Priority date: 2016-03-05
Filing date: 2016-03-05
Publication date: 2016-06-15

Abstract

The invention belongs to the technical field of biology, and particularly relates to a kit for detecting efficient typing of gene loci related to clopidogrel drug resistance reaction. The kit is based on a Sequenom MassARRAY typing system, and comprises PCR (polymerase chain reaction) amplification primers and single-base extension primers of gene loci CYP2C19*2 (rs4244285) and CYP2C19*3 (rs4986893). The sequences of the PCR amplification primers of gene loci are respectively disclosed as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. The sequences of the single-base extension primers of gene loci are respectively disclosed as SEQ ID NO.5 and SEQ ID NO.6. Before the subject takes clopidogrel, whether the gene loci of the subject are mutated is detected to instruct the individualized reasonable application of the subject, thereby providing references for individualized antiplatelet therapy.

Description

For detecting the test kit of the efficient typing of gene loci reacting relevant to clopidogrel drug resistance

Technical field

The invention belongs to biological technical field, be specifically related to a kind of test kit for detecting the efficient typing of gene loci reacting relevant to clopidogrel drug resistance.

Background technology

According to World Health Organization, cardiovascular and cerebrovascular disease is the main cause of human mortality in world wide, the current existing heart infarction of China, cerebral infarction patient more than 10,000,000, and every year newly-increased patient respectively about 1,000,000,2,000,000 people. Myocardial infarction is the disease that fatality rate is the highest, and apoplexy is then the first reason that adult is disabled.

Antiplatelet drug is one of topmost medicine of the prevention of current cardiovascular and cerebrovascular disease and treatment, is the Primary Care in Drug therapy. Clopidogrel (medicine name Plavix), because of its onset risk effectively reducing heart infarction and apoplexy and mortality rate and better safety, is antiplatelet drug most-often used in current world wide. Clopidogrel is a kind of novel thiophene pyridine derivatives. Clopidogrel is as a kind of prodrug, it is necessary to is metabolised to activity form in vivo and can play its biological effect activity. Clopidogrel is after little enteral is absorbed, it is subject to the proton pump P glycoprotein regulation and control of ABCB1 gene code, there are about 85% and be hydrolyzed to inactive carboxylic acid, only 15% meeting is reacted metabolism by the enzyme of Cytochrome P450 family by two step main oxidation in liver is activity form: first at CYP2C19, under the catalysis of CYP1A2 and CYP2B6, the thiphene ring of clopidogrel is opened and is oxidized to 2-hydroxyl-clopidogrel; Then CYP3A4, CYP2B6, it is activated product that CYP2C19 and CYP2C9 continues its catalysis, and the activity form of this instability adp receptor P2Y12 in platelet forms with it disulfide-bonded through liver, thus irreversible suppression ADP activates platelet aggregation.

Long-term clinical practice finding, the reactivity of clopidogrel is had very big individual variation by patient, is not that all patients are had enough protective effects, has significant component of patient that clopidogrel can produce low response.Nearly 2 years along with the development of pharmacogenomics, find to refer to except age, body, except the impact of the conventional factors such as blood pressure, blood fat, blood glucose, gene pleiomorphism is the main cause causing the clopidogrel individuality weak curative effect opposite sex, wherein CYP2C19 gene is the main metabolic gene causing clopidogrel curative effect to decline, and the power of influence of clinical events is exceeded the summation of above-mentioned Traditional Factors by it. Clopidogrel metabolism is bad causes its antiplatelet aggregative activity substantially to reduce, and increases directly related with patient's cardiovascular event incidence rate. 2010, food and drug administration (FDA) also issues bulletin, warning must be indicated on clopidogrel (Plavix) medicine label, before suggestion medication, patient is carried out gene test, cytochrome enzyme (CYP) dysfunction person is caused because of CYP2C19 gene pleiomorphism through what gene test confirmed, or other drug affects CYP2C19 activity person, the taking dose of clopidogrel should be changed or use other antiplatelet drugs. Also a lot of research discovery has been had to carry CYP2C19 afunction gene C YP2C19*2(rs4244285 in recent years in Chinese population, 681G A) and CYP2C19*3(rs4986893,636G A) all can make patient that high biologically active pdgf state occurs when carrying out clopidogrel Antiplatelet therapy, cause the nonreply of clopidogrel or low response, and the clothes for patients clopidogrel of carrying function deletion mutation carry out Antiplatelet therapy after be more easy to generation cardiovascular and cerebrovascular vessel ischemic event. In Southern Asia crowd, the probability of happening of CYP2C19*2 and CYP2C19*3 is apparently higher than crowds such as the U.S., Europe, east Asias. Therefore, in clinical application process, first patient should be carried out the gene type detection of CYP2C19*2 and CYP2C19*3, if there being one or two gene loci to make a variation, then should change the taking dose of clopidogrel or use other antiplatelet drugs. Gene type detection is carried out significant for clinical guidance individuation the reasonable safety uses the medicine before medication.

The invention provides a kind of simplicity, accurately detect CYP2C19*2 (rs4244285) and the test kit of CYP2C19*3 (rs4986893) gene loci, provide foundation for individuation Antiplatelet therapy.

Summary of the invention

It is an object of the invention to provide a kind of test kit for detecting the efficient typing of gene loci reacting relevant to clopidogrel drug resistance.

Test kit for detecting the efficient typing of gene loci reacting relevant to clopidogrel drug resistance provided by the invention is based on SequenomMassARRAY classification system, comprises the pcr amplification primer for expanding site CYP2C19*2 (rs4244285) and CYP2C19*3 (rs4986893) and Single base extension primer.

The pcr amplification primer sequence of described gene loci CYP2C19*2 (rs4244285) is such as shown in SEQIDNO.1-2; The pcr amplification primer sequence of CYP2C19*3 (rs4986893) is such as shown in SEQIDNO.3-4. The Single base extension primer sequence of described gene loci CYP2C19*2 (rs4244285) is such as shown in SEQIDNO.5; The Single base extension primer sequence of CYP2C19*3 (rs4986893) is such as shown in SEQIDNO.6. Above-mentioned primer sequence is in Table 1.

Described test kit also includes PCR cocktail buffer (PCRBufferMix); MgCl₂; DNTP; PCR enzyme (PCREnzyme); SAP cocktail buffer (SAPBufferMix); SAP enzyme (SAPEnzyme);IPlexTermination; Extend enzyme (iPlexEnzyme) and extend cocktail buffer (iPlexBufferMix).

Pcr amplification primer and PCR described in this test kit extend primer and react with sample DNA in same hole, detect two sites simultaneously and judge its catastrophe.

The clopidogrel drug resistance gene loci having been found that, based on SequenomMassArray high flux genotyping system, is devised Specific PCR primers and extends primer by this test kit, it is possible to realize the detection of 2 opposing gene locis in same hole. The present invention has simplicity, efficiently and accurately advantage. Before taking clopidogrel experimenter, by detecting whether the gene loci of experimenter has variation, instruct individual subjectization rational use of drug, it is possible to provide foundation for individuation Antiplatelet therapy.

Accompanying drawing explanation

Fig. 1 is the typing figure of SequenomMassArray chip scanning CYP2C19*2 (rs4244285).

Fig. 2 is the typing figure of SequenomMassArray chip scanning CYP2C19*3 (rs4986893).

Detailed description of the invention

Embodiment

1. the genomic DNA of the whole blood of experimenter, saliva or its hetero-organization is extracted with reference to the description of manufacturer.

2. main agents: for detecting the detection kit reagent of the efficient typing of gene loci reacting relevant to clopidogrel drug resistance. Main component includes PCR cocktail buffer (PCRBufferMix); MgCl₂; DNTP; PCR enzyme (PCREnzyme); SAP cocktail buffer (SAPBufferMix); SAP enzyme (SAPEnzyme); IPlexTermination; Extend enzyme (iPlexEnzyme) and extend cocktail buffer (iPlexBufferMix).

3.PCR amplification reaction system and PCR program

PCR system:

PCR program:

4.PCR product alkaline phosphataseization processes

After PCR terminates, PCR primer is used SAP ferment treatment, the unconjugated dNTP of SAP enzymic digestion.

SAP system:

SAPPCR program: 37 DEG C 40 minutes, 85 DEG C 5 minutes, last 4 DEG C of constant temperature.

5. single base extension system and PCR program

Single base extension system:

Single base extension PCR program:

6. resin purification, chip scanning, use MassArrayTyper4.0 software baseline results be analyzed rear and export result.

Result is illustrated: see accompanying drawing 1-2.

Fig. 1 is the typing figure of SequenomMassArray chip scanning CYP2C19*2 (rs4244285). 768 individualities cluster at CYP2C19*2 (rs4244285) site success typing, and wherein 347 individualities are homozygote GG, and 91 individualities are homozygote AA, and 315 individualities are heterozygote AG.

Fig. 2 is the typing figure of SequenomMassArray chip scanning CYP2C19*3 (rs4986893). 768 individualities cluster at CYP2C19*3 (rs4986893) site success typing, and wherein 690 individualities are homozygote GG, and 1 individuality is homozygote AA, and 68 individualities are heterozygote AG.

The pcr amplification primer of table 1.CYP2C19*2 (rs4244285) and CYP2C19*3 (rs4986893) and Single base extension primer

。

Sequence table

SEQIDNO.1:ACGTTGGATGGCAATAATTTTCCCACTATC

SEQIDNO.2:ACGTTGGATGCACTTTCCATAAAAGCAAGG

SEQIDNO.3:ACGTTGGATGAACATCAGGATTGTAAGCAC

SEQIDNO.4:ACGTTGGATGGACTGTAAGTGGTTTCTCAG

SEQIDNO.5:TCCCACTATCATTGATTATTTCCC

SEQIDNO.6:ATTGTAAGCACCCCCTG。

SEQUENCELISTING

<110>Huashan Hospital Affiliated To Fudan Univ

<120>for detecting the test kit of the efficient typing of gene loci reacting relevant to clopidogrel drug resistance

<130>001

<160>6

<170>PatentInversion3.3

<210>1

<211>30

<212>DNA

<213>

<400>1

acgttggatggcaataattttcccactatc30

<210>2

<211>30

<212>DNA

<213>

<400>2

acgttggatgcactttccataaaagcaagg30

<210>3

<211>30

<212>DNA

<213>

<400>3

acgttggatgaacatcaggattgtaagcac30

<210>4

<211>30

<212>DNA

<213>

<400>4

acgttggatggactgtaagtggtttctcag30

<210>5

<211>24

<212>DNA

<213>

<400>5

tcccactatcattgattatttccc24

<210>6

<211>17

<212>DNA

<213>

<400>6

attgtaagcaccccctg17

Claims

1. the test kit being used for detecting the efficient typing of gene loci reacting relevant to clopidogrel drug resistance, it is characterized in that: this test kit is based on SequenomMassARRAY classification system, comprise the pcr amplification primer for expanding site CYP2C19*2 (rs4244285) and CYP2C19*3 (rs4986893) and Single base extension primer.

2. test kit according to claim 1, it is characterised in that: the pcr amplification primer sequence of described gene loci CYP2C19*2 (rs4244285) is such as shown in SEQIDNO.1 and SEQIDNO.2; The pcr amplification primer sequence of CYP2C19*3 (rs4986893) is such as shown in SEQIDNO.3 and SEQIDNO.4; The Single base extension primer sequence of described gene loci CYP2C19*2 (rs4244285) is such as shown in SEQIDNO.5; The Single base extension primer sequence of CYP2C19*3 (rs4986893) is such as shown in SEQIDNO.6.

3. test kit according to claim 1 and 2, it is characterised in that: also include PCR cocktail buffer; MgCl₂; DNTP; PCR enzyme; SAP cocktail buffer; SAP enzyme; IPlexTermination; Extend enzyme and extend cocktail buffer.

4. test kit according to claim 3, it is characterised in that:

Pcr amplification reaction system is:

SAP system is:

Single base extension system is:

。