CN106947815B - Method and special primer for detecting accurate medication of aspirin and nitroglycerin - Google Patents
Method and special primer for detecting accurate medication of aspirin and nitroglycerin Download PDFInfo
- Publication number
- CN106947815B CN106947815B CN201710217302.8A CN201710217302A CN106947815B CN 106947815 B CN106947815 B CN 106947815B CN 201710217302 A CN201710217302 A CN 201710217302A CN 106947815 B CN106947815 B CN 106947815B
- Authority
- CN
- China
- Prior art keywords
- primer
- stranded
- stranded extension
- aspirin
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method and special primers for detecting accurate medication of aspirin and nitroglycerin. The invention provides a special primer for detecting aspirin and nitroglycerin drug resistance SNP loci, which comprises a primer group 1 and a primer group 2; the primer group 1 consists of a primer pair 1, a primer pair 2, a primer pair 3 and a primer pair 4; the primer group 2 consists of a single-stranded extension primer 1, a single-stranded extension primer 2, a single-stranded extension primer 3 and a single-stranded extension primer 4; experiments prove that the method can complete detection of a plurality of SNP sites related to resistance of aspirin and nitroglycerin through efficient one-time experiments, complete accurate medication gene detection of the aspirin and the nitroglycerin through one-time experiments, and reduce experiment cost; the invention has very high application value for guiding the clinical accurate medication of aspirin and nitroglycerin, and is suitable for popularization and application.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a method and a special primer for detecting accurate medication of aspirin and nitroglycerin.
Background
Accurate medication is an important component of accurate medical treatment. The research of genetics pharmacology and pharmacogenomics proves that the single nucleotide polymorphisms of genes (such as drug transport protein genes, drug metabolizing enzyme genes and DNA repair genes) carried by different patients are different, the reaction to the drugs is different, and the curative effect of the same drug to different patients is also greatly different, so that from the perspective of the curative effect of the drugs, the gene detection is carried out to guide accurate drug administration, a doctor is helped to screen out an effective treatment scheme, the most correct treatment decision is made for the patients, the invalid medical expense of the patients is saved, and the treatment effect is improved.
Aspirin is a clinically common basic drug for preventing and treating arterial thrombotic diseases, and nitroglycerin is a clinically common cardiovascular and cerebrovascular emergency drug. However, clinically, there is a phenomenon of aspirin resistance, that is, aspirin is not effective in all patients with thrombus, and some patients cannot inhibit platelet aggregation and prevent thrombus formation even if they take aspirin, and thus clinical therapeutic effects are not achieved. The phenomenon of using the nitroglycerin is very common in clinic, namely, the nitroglycerin taken by people in a hurry moment needing first aid cannot save lives even if the people strive for the second taking. The aspirin resistance phenomenon and the nitroglycerin use ineffectiveness phenomenon are closely related to gene polymorphism.
The traditional detection method mainly adopts sanger sequencing, fluorescent quantitative PCR and other methods. Although the method may provide better value clinically, the method has the reasons of time consumption, high economic cost, high time cost and the like, and cannot be popularized and used clinically in a large scale.
The matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF-MS) technology can simultaneously detect a plurality of gene polymorphism sites, has the advantages of strong compatibility, high flux, high precision and high cost performance, and can be used for simultaneously detecting related gene information of accurate medication of aspirin resistance and nitroglycerin resistance. At present, the matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology is not applied to accurate drug gene detection of aspirin resistance and nitroglycerin resistance.
Disclosure of Invention
The invention aims to provide a special primer for detecting aspirin and nitroglycerin drug resistance SNP loci.
The special primer provided by the invention comprises a primer group 1 and a primer group 2;
the primer group 1 consists of a primer pair 1, a primer pair 2, a primer pair 3 and a primer pair 4;
the primer pair 1 consists of a single-stranded DNA molecule shown in a sequence 1 and a single-stranded DNA molecule shown in a sequence 2;
the primer pair 2 consists of a single-stranded DNA molecule shown in a sequence 3 and a single-stranded DNA molecule shown in a sequence 4;
the primer pair 3 consists of a single-stranded DNA molecule shown in a sequence 5 and a single-stranded DNA molecule shown in a sequence 6;
the primer pair 4 consists of a single-stranded DNA molecule shown in a sequence 7 and a single-stranded DNA molecule shown in a sequence 8;
the primer group 2 consists of a single-stranded extension primer 1, a single-stranded extension primer 2, a single-stranded extension primer 3 and a single-stranded extension primer 4;
the nucleotide sequence of the single-stranded extension primer 1 is a sequence 9;
the nucleotide sequence of the single-stranded extension primer 2 is a sequence 10;
the nucleotide sequence of the single-stranded extension primer 3 is a sequence 11;
the nucleotide sequence of the single-stranded extension primer 4 is sequence 12.
Among the above-mentioned special primers, the primer of the present invention,
the molar ratio of each primer in the primer pair 1, the primer pair 2, the primer pair 3 and the primer pair 4 is equal to the molar ratio;
or the molar ratio of the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3 and the single-stranded extension primer 4 is 1:1:1: 1.
Another objective of the invention is to provide a PCR reagent for detecting aspirin and nitroglycerin drug resistance SNP sites.
The PCR reagent provided by the invention comprises a PCR reagent 1 and a PCR reagent 2;
the PCR reagent 1 comprises a primer pair 1, a primer pair 2, a primer pair 3, a primer pair 4, a PCR buffer solution and MgCl in the special primer of claim 12Dntps and DNA polymerase;
the PCR reagent 2 comprises the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3, the single-stranded extension primer 4, the single-stranded extension buffer and the single-stranded extension enzyme in the special primer of claim 2.
In the above-mentioned PCR reagent, the PCR reagent,
the concentration of each primer in the primer pair 1, the primer pair 2, the primer pair 3 and the primer pair 4 in the PCR reagent 1 is 0.1 mu M;
or, the concentration of MgCl2 in the PCR reagent 1 is 2 mM;
or, the concentration of the dNTP in the PCR reagent 1 is 0.5 mM;
or, the concentration of the DNA polymerase in the PCR reagent 1 is 0.2U/. mu.l;
the concentrations of the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3 and the single-stranded extension primer 4 in the PCR reagent 2 are all 0.05 mu M.
The 3 rd purpose of the invention is to provide a kit for detecting the drug resistance SNP locus of aspirin and nitroglycerin.
The kit provided by the invention comprises the special primer or the PCR reagent.
The application of the special primer or the PCR reagent or the kit in the preparation of the product for detecting the drug resistance SNP locus genotype of aspirin and nitroglycerin is also within the protection scope of the invention;
or the application of the special primer or the PCR reagent or the kit in detecting the genotype of the aspirin and nitroglycerin drug resistance SNP locus is also within the protection scope of the invention;
or the application of the special primer or the PCR reagent or the kit in aspirin and nitroglycerin guiding medication of a sample to be detected is also within the protection scope of the invention;
or the special primer or the PCR reagent or the kit is applied to the preparation of products for guiding aspirin and nitroglycerin administration on samples to be detected.
The 4 th purpose of the invention is to provide a method for detecting the genotype of the drug resistance SNP locus of aspirin and nitroglycerin in a sample to be detected.
The method provided by the invention comprises the following steps:
1) carrying out PCR amplification on a sample to be detected by using the primer pairs 1-4 in the special primers to obtain a PCR amplification product;
2) carrying out alkaline phosphatase digestion on the PCR amplification product to obtain a digestion product;
3) carrying out single-base extension reaction on the digestion product by using a single-stranded extension primer 1, a single-stranded extension primer 2, a single-stranded extension primer 3 and a single-stranded extension primer 4 in the special primers to obtain a single-base extension reaction product;
4) and purifying the single base extension reaction product, and then carrying out matrix-assisted laser desorption ionization time-of-flight mass spectrometry to obtain the genotype of the drug resistance SNP (single nucleotide polymorphism) site of the aspirin and the nitroglycerin in the sample to be detected.
In the method, the template amplified by PCR is the genomic DNA of the sample to be detected.
In the method, the PCR amplification procedure comprises the steps of carrying out 45 cycles of 94 ℃ for 2min, then 94 ℃ for 20s, 56 ℃ for 30s and 72 ℃ for 60s, and then 72 ℃ for 3 min;
or the procedure for the alkaline phosphatase digestion is: at 37 ℃ for 40 min; storing at 85 deg.C for 5min and 4 deg.C;
or the procedure of the single base extension reaction is: performing 5 cycles of 94 deg.C for 30s, 94 deg.C for 5s, (52 deg.C for 5s, and 80 deg.C for 5s) for 40 cycles, and 72 deg.C for 3 min;
or the purification is a resin purification.
In the above, the SNP sites are rs5918 (corresponding to primer pair 1 and single-strand extension primer 1), rs1330344 (corresponding to primer pair 2 and single-strand extension primer 2), rs20417 (corresponding to primer pair 3 and single-strand extension primer 3), and rs671 (corresponding to primer pair 4 and single-strand extension primer 4).
Experiments prove that the method can complete detection of a plurality of SNP sites related to resistance of aspirin and nitroglycerin through efficient one-time experiments, complete accurate medication gene detection of the aspirin and the nitroglycerin through one-time experiments, and reduce experiment cost; the PCR primer and the unique UEP primer designed according to each SNP locus have higher specificity. The invention has very high application value for guiding the clinical accurate medication of aspirin and nitroglycerin, and is suitable for popularization and application.
Drawings
Fig. 1 shows the result of rs5918 detection.
FIG. 2 shows the result of the rs1330344 assay.
Fig. 3 shows the result of rs20417 detection.
FIG. 4 shows the result of rs671 assay.
FIG. 5 shows the result of detection of rs5918 primer set 1.
FIG. 6 shows the result of detection of rs5918 primer set 2.
FIG. 7 shows the result of detection of rs1330344 primer set 1.
FIG. 8 shows the result of detection of rs1330344 primer set 2.
FIG. 9 shows the result of detection of rs20417 primer set 1.
FIG. 10 shows the result of detection of rs20417 primer set 2.
FIG. 11 shows the result of detection of rs671 primer set 1.
FIG. 12 shows the result of detection of rs671 primer set 2.
Fig. 13 shows the results of the rs671 optimization 1 assay.
Fig. 14 shows the results of the rs671 optimization 2 assay.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 method for detecting aspirin and nitroglycerin drug resistance SNP locus and special primer
Special primer for detecting drug resistance SNP (single nucleotide polymorphism) sites of aspirin and nitroglycerin
Specific PCR primers and UEP primers are designed according to related SNP sites rs5918, rs1330344, rs20417 and rs671 of aspirin and nitroglycerin drug resistance genes, and detection of the aspirin and nitroglycerin drug resistance genes is realized by matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF-MS).
Specific PCR primers and UEP primers include:
rs5918PCR primer 1: ACGTTGGATGTCTTTGGGCTCCTGTCTTAC (SEQ ID NO: 1);
rs5918PCR primer 2: ACGTTGGATGAGCAGATTCTCCTTCAGGTC (SEQ ID NO: 2);
rs1330344PCR primer 1: ACGTTGGATGAGGTCACGCTATGGAAGAAG (SEQ ID NO: 3);
rs1330344PCR primer 2: ACGTTGGATGAAGAAACACTTGTGTGGCCC (SEQ ID NO: 4);
rs20417PCR primer 1: ACGTTGGATGACAGGGTAACTGCTTAGGAC (SEQ ID NO: 5);
rs20417PCR primer 2: ACGTTGGATGACTGTTCTCCGTACCTTCAC (SEQ ID NO: 6);
rs671PCR primer 1: ACGTTGGATGTTGGTGGCTACAAGATGTCG (SEQ ID NO: 7);
rs671PCR primer 2: ACGTTGGATGAGGTCCCACACTCACAGTTT (SEQ ID NO: 8);
rs5918UEP primer: TTACAGGCCCTGCCTC (SEQ ID NO: 9);
rs1330344UEP primer: TGAAGGCTCTTCCCAT (SEQ ID NO: 10);
rs20417UEP primer: AGGAGAATTTACCTTTCCC (SEQ ID NO: 11);
rs671UEP primer CCACACTCACAGTTTTCACTT (SEQ ID NO: 12)
Second, method for detecting drug resistance SNP locus of aspirin and nitroglycerin
1. Extraction of template DNA
192 cases of genomic DNA from extracorporeal peripheral blood were extracted at a concentration of 20-30 ng/. mu.l.
2. PCR reaction
A reaction system comprising 1. mu.l of template DNA, 1. mu.l of primer mixture (final concentration of each primer in the reaction system: 0.1. mu.M), and 10 × Buffer (containing 15mM Mg) was prepared in 5. mu.l of PCR96 well plate2+)0.5μl，MgCl2(25mM) 0.4. mu.l (MgCl in the reaction System)2The final concentration of (2 mM), 0.1. mu.l of dNTP (25mM) (the final concentration of dNTP in the reaction system is 0.5mM), 0.2. mu.l of Hotstar Taq (5U/. mu.l) (the final concentration of Hotstar Taq in the reaction system is 0.2U/. mu.l), and 5. mu.l of the reaction system was supplemented with MBG water. The 384 well plates were sealed with a sealing membrane.
The primer mixture consists of primers shown in sequences 1-8 and water, wherein the concentration of each primer is 0.5 mu M.
And carrying out PCR reaction on the reaction system to obtain a PCR amplification product.
The PCR reaction program was set up as follows:
3. alkaline phosphatase treatment (SAP digestion reaction)
The following were added to the PCR amplification product obtained in 2 above: SAPBuffer 0.17. mu.l, SAP Enzyme (Agena BIOSCIENCE, product ref:100021, lot:0000021450) 0.30. mu.l, MBG water 1.53. mu.l, to obtain SAP digestion reaction system.
And carrying out digestion reaction on the SAP digestion reaction system to obtain a digestion reaction product.
The digestion reaction procedure described above: at 37 ℃ for 40 min; 5min at 85 ℃; 4 ℃ and infinity.
4. Single base extension reaction
To the digestion reaction product obtained in the above 3 was added the following: 0.2. mu.l of iPLEX Buffer plus (Agena BIOSCIENCE, Ref:01431, lot:0000021844), 0.2. mu.l of iPLEX Terminator (Agena BIOSCIENCE, Ref:01430, lot:0000021435), 0.041. mu.l of iPLEX Enzyme (Agena BIOSCIENCE, Ref:01432, lot:0000021845), 0.619. mu.l of MBG water, and 0.940. mu.l of primers (the final concentration of each primer in the single-base extension reaction is 0.05. mu.M), thus obtaining the single-base extension reaction system.
The primer Mix consists of primers shown in sequences 9-12 and water, and the concentration of each primer is 0.5. mu.M.
And carrying out single base extension reaction on the single base extension reaction system to obtain a single base extension reaction product.
The above single base extension reaction procedure is as follows:
5. resin purification
The product of the single base extension reaction obtained in the above 4 was subjected to resin purification as follows:
1) the 384 reaction plates containing the single base extension products obtained in 4 above were centrifuged at 3000rpm for 2min, 16. mu.l of MBG water was added to each well, the reaction plates were sealed with a sealing film, and the plates were centrifuged instantaneously at 3000 rpm.
2) A clean A4 paper is taken, a resin plate (specification is 6mg) is placed on the paper, a proper amount of resin (Agena BIOSCIENCE, product ref:08040, lot:0000022403) is taken by a spoon and placed on the resin plate, a plastic cover plate is used for repeatedly pushing the resin to the left and the right, and the resin is compacted to ensure that the resin content in each hole is uniform.
3) The centrifuged 384 reaction plate was inverted over the resin plate with the resin laid, with the wells of the two plates in one-to-one correspondence. The plates were inverted with the resin plate on top and the 384 reaction plate on the bottom. The back of the resin plate was gently knocked evenly to drop the resin into a 384 reaction plate containing the single base extension product.
4) The 384 reaction plate containing the single base extension product and the resin is sealed with a sealing film, and the shaker is rotated vertically at a low speed for 30min to bring the resin into full contact with the reactants.
5) And centrifuging the 384 reaction plates after the reaction is finished at 3000rpm for 5min to enable the resin to sink to the bottom of the tube, wherein the supernatant is the purified product.
6. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) detection
The purified product obtained in the above step 5 was transferred to a chip (Agena BIOSCIENCE, product ref:01509, lot:0000022421) by a spotting instrument, and placed in a mass spectrometer for mass spectrometry (mass spectrometry molecular weight range: 4500-.
The results are shown in FIGS. 1-4, and the genotypes of the rs5918, rs1330344, rs20417 and rs671 sites are obtained; it can be seen that the primer pairs and methods of the invention can be used for genotyping these sites. .
The precise medication analysis is performed according to the detected genotypes, and clinical medication is guided, which is specifically shown in table 1.
TABLE 1 genotype guide for clinical medication
| Detection site | Clinical significance |
| rs5918 | Genotype CC and CT are more likely to develop aspirin resistance than genotype TT |
| rs1330344 | Genotype CT and CC, comparisonGenotype TT is more likely to develop aspirin resistance |
| rs20417 | Genotypes CC and GG are more prone to aspirin resistance than genotype GG |
| rs671 | Genotypes GA and AA are more susceptible to nitroglycerin resistance than genotype GG |
Example 2 method for detecting aspirin and nitroglycerin drug resistance SNP locus and application of special primer
1. Extraction of template DNA
DNA was extracted by the method of 1 in example 1, using 5 subjects' peripheral blood (all showing symptoms such as hypertension and thrombus) as samples 1 to 5.
2. And (3) PCR reaction: same as 2 of the second embodiment of example 1.
3. Alkaline phosphatase treatment (SAP digestion reaction): the same as 3 of the second embodiment of example 1.
4. Single base extension reaction: same as 4 of the second embodiment of example 1.
5. Resin purification: the same as example 1, second 5.
6. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) detection:
the procedure was the same as that of example 1, 6, and the results are shown in Table 2 below:
TABLE 2 SNP sites of the samples to be examined
| |
|
|
|
|
|
| rs5918 | TT | TT | TT | TT | TT |
| rs1330344 | TT | CT | CT | CT | TT |
| rs20417 | GG | GC | GC | GC | GC |
| rs671 | GG | GG | GA | GA | CA |
From the analysis results of table 1, it can be seen that:
the sample 1 is sensitive to aspirin, aspirin resistance is not easy to occur, the sample 5 has certain aspirin resistance, the samples 2,3 and 4 are easy to occur aspirin resistance, and the dosage of the medicine is increased;
clinical medication verification:
the patient in sample 1 is sensitive to aspirin and is not easy to have aspirin resistance, the patient in sample 5 has certain aspirin resistance, and the patients in samples 2,3 and 4 are easy to have aspirin resistance, so that the dosage of the medicine is increased;
this is consistent with the results of the present invention, indicating that the present invention is correct.
Comparative examples 1,
The design of the primer is the key of the detection work, the combination rate of the primer and the template directly influences the PCR amplification efficiency, so that the sensitivity and the detection rate of a detection result are influenced, particularly, the design requirement of the UEP primer is very high, except for the requirement of complete base complementary match of a sequence and a sequence in front of a detection site, the 4UEP primers must be increased in gradient in length design so as to generate a molecular weight difference and realize mass spectrum detection. Non-specific binding of the primer to the template results in non-specific amplification products, which also interfere with the experimental results.
For each SNP site, the inventors designed 3 sets of PCR primers and UEP primers in parallel (primer set 3 in example 1), and detected 192 samples with 3 sets of primers according to the method of example 1, and compared the primer set 3 in example 1 had the best detection effect: high detection rate, high sensitivity, good clustering effect and high specificity.
Table 3 shows primer set 1
Table 4 shows primer set 2
Primer set 3 refers to the above sequence 1-sequence 12.
The primer 1 group and the primer 2 group have the conditions of low site detection rate and poor clustering effect, and the results are shown in figures 5-12.
Comparative examples 2,
When the reaction system of example 1 was investigated, the following parallel reaction condition investigation experiment was performed:
1. optimizing the condition 1:
the method comprises the following steps of:
the final concentration of each primer was: 0.1. mu.M
MgCl2To a final concentration of 2mM
The final concentration of dNTPs was 0.5mM
Hotstar Taq was used at a final concentration of 0.15U/. mu.l
The PCR reaction program was set up as follows:
and (2) SAP enzyme digestion: digestion reaction procedure: at 37 ℃ for 45 min; 5min at 85 ℃; 4 ℃ and infinity.
A single base extension reaction
Optimization condition 2:
the method comprises the following steps of:
the final concentration of each primer was: 0.1. mu.M
MgCl2To a final concentration of 2mM
The final concentration of dNTPs was 0.5mM
The final concentration of Hotstar Taq was 0.1U/. mu.l
The PCR reaction program was set up as follows:
and (2) SAP enzyme digestion: digestion reaction procedure: at 37 ℃ for 40 min; 5min at 85 ℃; 4 ℃ and infinity.
A single base extension reaction
The primer group, the control primer group 1 and the primer group 2 in example 1 are used to detect the rs671 site of 192 samples of the same samples in example 1, the detected reaction system and reaction conditions are respectively the optimization conditions 1, and the results are shown in fig. 13. The effect was inferior to that of the reaction system and reaction conditions of example 1.
The primer group, the control primer group 1 and the primer group 2 in example 1 are used to detect the rs671 site of 192 samples of the same samples in example 1, the detected reaction system and reaction conditions are respectively the optimization conditions 2, and the results are shown in fig. 14. The effect was inferior to that of the reaction system and reaction conditions of example 1.
Sequence listing
<110> Li-lover's silk
<120> method for detecting accurate medication of aspirin and nitroglycerin and special primer
<160>12
<170>PatentIn version 3.5
<210>1
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>1
acgttggatg tctttgggct cctgtcttac 30
<210>2
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>2
acgttggatg agcagattct ccttcaggtc 30
<210>3
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>3
acgttggatg aggtcacgct atggaagaag 30
<210>4
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>4
acgttggatg aagaaacact tgtgtggccc 30
<210>5
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>5
acgttggatg acagggtaac tgcttaggac 30
<210>6
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>6
acgttggatg actgttctcc gtaccttcac 30
<210>7
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>7
acgttggatg ttggtggcta caagatgtcg 30
<210>8
<211>30
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>8
acgttggatg aggtcccaca ctcacagttt 30
<210>9
<211>16
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>9
ttacaggccc tgcctc 16
<210>10
<211>16
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>10
tgaaggctct tcccat 16
<210>11
<211>19
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>11
aggagaattt acctttccc 19
<210>12
<211>21
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>12
ccacactcac agttttcact t 21
Claims (10)
1. A special primer for detecting aspirin and nitroglycerin drug resistance SNP loci comprises a primer group 1 and a primer group 2;
the primer group 1 consists of a primer pair 1, a primer pair 2, a primer pair 3 and a primer pair 4;
the primer pair 1 consists of a single-stranded DNA molecule shown in a sequence 1 and a single-stranded DNA molecule shown in a sequence 2;
the primer pair 2 consists of a single-stranded DNA molecule shown in a sequence 3 and a single-stranded DNA molecule shown in a sequence 4;
the primer pair 3 consists of a single-stranded DNA molecule shown in a sequence 5 and a single-stranded DNA molecule shown in a sequence 6;
the primer pair 4 consists of a single-stranded DNA molecule shown in a sequence 7 and a single-stranded DNA molecule shown in a sequence 8;
the primer group 2 consists of a single-stranded extension primer 1, a single-stranded extension primer 2, a single-stranded extension primer 3 and a single-stranded extension primer 4;
the nucleotide sequence of the single-stranded extension primer 1 is a sequence 9;
the nucleotide sequence of the single-stranded extension primer 2 is a sequence 10;
the nucleotide sequence of the single-stranded extension primer 3 is a sequence 11;
the nucleotide sequence of the single-stranded extension primer 4 is sequence 12.
2. The specialized primer of claim 1, wherein:
the molar ratio of each primer in the primer pair 1, the primer pair 2, the primer pair 3 and the primer pair 4 is equal to the molar ratio;
or the molar ratio of the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3 and the single-stranded extension primer 4 is 1:1:1: 1.
3. The dedicated primer according to claim 1 or 2, characterized in that: the SNP loci are rs5918, rs1330344, rs20417 and rs 671.
4. A PCR reagent for detecting aspirin and nitroglycerin drug resistance SNP locus comprises a PCR reagent 1 and a PCR reagent 2;
the PCR reagent 1 comprises a primer pair 1, a primer pair 2, a primer pair 3, a primer pair 4, a PCR buffer solution and MgCl in the special primers of claim 1 or 22、dNTP and DNA polymerase;
the PCR reagent 2 comprises the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3, the single-stranded extension primer 4, a single-stranded extension buffer and a single-stranded extension enzyme of the special primer of claim 1 or 2.
5. The PCR reagent according to claim 4, wherein:
the concentration of each primer in the primer pair 1, the primer pair 2, the primer pair 3 and the primer pair 4 in the PCR reagent 1 is 0.1 mu M;
or, the concentration of MgCl2 in the PCR reagent 1 is 2 mM;
or, the concentration of the dNTP in the PCR reagent 1 is 0.5 mM;
or, the concentration of the DNA polymerase in the PCR reagent 1 is 0.2U/. mu.l;
or, the concentrations of the single-stranded extension primer 1, the single-stranded extension primer 2, the single-stranded extension primer 3 and the single-stranded extension primer 4 in the PCR reagent 2 are all 0.05. mu.M.
6. The PCR reagent according to claim 4 or 5, wherein: the SNP loci are rs5918, rs1330344, rs20417 and rs 671.
7. A kit for detecting an aspirin and nitroglycerin resistance SNP site, comprising the special primer of claim 1 or 2 or the PCR reagent of claim 4 or 5.
8. The kit of claim 7, wherein: the SNP loci are rs5918, rs1330344, rs20417 and rs 671.
9. Use of the primers as defined in claim 1 or 2 or the PCR reagents as defined in claim 4 or 5 or the kit as defined in claim 7 for the preparation of a product for detecting the genotype at the SNP sites of aspirin and nitroglycerin resistance;
or the special primer of claim 1 or 2 or the PCR reagent of claim 4 or 5 or the kit of claim 7, in the preparation of a product for aspirin and nitroglycerin guiding medication of a sample to be tested.
10. Use according to claim 9, characterized in that: the SNP loci are rs5918, rs1330344, rs20417 and rs 671.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710217302.8A CN106947815B (en) | 2017-04-05 | 2017-04-05 | Method and special primer for detecting accurate medication of aspirin and nitroglycerin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710217302.8A CN106947815B (en) | 2017-04-05 | 2017-04-05 | Method and special primer for detecting accurate medication of aspirin and nitroglycerin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106947815A CN106947815A (en) | 2017-07-14 |
| CN106947815B true CN106947815B (en) | 2020-08-14 |
Family
ID=59474565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710217302.8A Active CN106947815B (en) | 2017-04-05 | 2017-04-05 | Method and special primer for detecting accurate medication of aspirin and nitroglycerin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106947815B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371115A (en) * | 2018-08-24 | 2019-02-22 | 山东德诺生物科技有限公司 | For detecting the primed probe group and its application of rs5918 |
| CN109207583A (en) * | 2018-10-22 | 2019-01-15 | 南通中科基因医学检验所有限公司 | Aspirin personalized medicine gene detecting kit and detection method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009117122A2 (en) * | 2008-03-19 | 2009-09-24 | Existence Genetics Llc | Genetic analysis |
| CN102690888A (en) * | 2012-06-15 | 2012-09-26 | 向华 | Primer system for detecting gene SNP (single nucleotide polymorphism) related to warfarin dosage and application of primer system |
| CN104928375A (en) * | 2015-06-03 | 2015-09-23 | 复旦大学附属华山医院 | Method for simultaneously determining human cyclosporine action target gene polymorphism |
| CN105238853A (en) * | 2015-08-20 | 2016-01-13 | 复旦大学附属华山医院 | Method for simultaneously measuring gene polymorphism of tacrolimus action targets of person |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120164640A1 (en) * | 2010-12-10 | 2012-06-28 | Duke University | Methods and compositions for correlating genetic markers with sudden cardiac death risk |
-
2017
- 2017-04-05 CN CN201710217302.8A patent/CN106947815B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009117122A2 (en) * | 2008-03-19 | 2009-09-24 | Existence Genetics Llc | Genetic analysis |
| CN102690888A (en) * | 2012-06-15 | 2012-09-26 | 向华 | Primer system for detecting gene SNP (single nucleotide polymorphism) related to warfarin dosage and application of primer system |
| CN104928375A (en) * | 2015-06-03 | 2015-09-23 | 复旦大学附属华山医院 | Method for simultaneously determining human cyclosporine action target gene polymorphism |
| CN105238853A (en) * | 2015-08-20 | 2016-01-13 | 复旦大学附属华山医院 | Method for simultaneously measuring gene polymorphism of tacrolimus action targets of person |
Non-Patent Citations (3)
| Title |
|---|
| Detection of drugs in lifted cyanoacrylatedeveloped latent fingermarks using two laser desorption/ionisation mass spectrometric methods;Latha Sundar et al.;《Analyst》;20131128;第139卷;第633-642页 * |
| 基质辅助激光解吸电离飞行时间质谱技术检测华法林代谢酶基因多态性;郭俊等;《临床检验杂志》;20140630;第32卷(第6期);第410-413页 * |
| 应用硝酸甘油联合阿司匹林治疗心绞痛的疗效观察;纪俊宏;《当代医药论丛》;20141231;第12卷(第14期);第159-160页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106947815A (en) | 2017-07-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106893783B (en) | A kind of detection method and primer special for the accurate early warning of cardiovascular and cerebrovascular disease risk and accurate medication | |
| CN109136365B (en) | Detection method for children personalized medication analysis based on SNP (Single nucleotide polymorphism) locus and application thereof | |
| CN107022611B (en) | Method and special primer for detecting accurate medication of 4 common clinical cardiovascular and cerebrovascular disease medicines | |
| JP2014530819A5 (en) | ||
| Carapito et al. | On the genetics of the Silk Route: association analysis of HLA, IL10, and IL23R-IL12RB2 regions with Behçet’s disease in an Iranian population | |
| CN104774933A (en) | Primers, kit and method for detection of polymorphism of human IL28B gene | |
| CN111808944A (en) | Gene detection method for children personalized medicine | |
| CN105524987A (en) | Primers and method for simultaneously detecting ALDH2 gen *2 polymorphism and ADH1B gene *2 polymorphism | |
| CN110699446B (en) | SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof | |
| CN106947815B (en) | Method and special primer for detecting accurate medication of aspirin and nitroglycerin | |
| CN112226505A (en) | Respiratory system disease gene SNP locus typing optimization method | |
| CN112553319B (en) | Special primer for detecting anticoagulant and/or antiplatelet drug resistance related gene SNP locus and application | |
| CN109097459B (en) | Detection method for adult common anti-infective drug administration analysis based on SNP locus and application thereof | |
| CN105886606A (en) | Kit for rapid detection of polymorphism of Warfarin metabolic enzyme gene by virtue of pyrosequencing method and application of kit | |
| CN112410420B (en) | Special primer for simultaneously and accurately detecting SNP (single nucleotide polymorphism) loci of related genes of 'one palm induced deafness' and 'one needle induced deafness' and application | |
| WO2013060005A1 (en) | Method for detecting specific single nucleotide polymorphism related to ankylosing spondylitis and kit therefor | |
| KR101138862B1 (en) | A polynucleotide associated with a breast cancer comprising single nucleotide polymorphism, microarray and diagnostic kit comprising the same and method for diagnosing a breast cancer using the same | |
| CN110564836A (en) | Primer-probe combination for guiding detection of related genes for repaglinide drug personalized administration, kit and application | |
| CN110029162B (en) | SNP marker for detecting susceptibility of systemic lupus erythematosus in non-coding gene region and application thereof | |
| CN105506089A (en) | Primer and method for detecting ALDH2 gene*2 polymorphism | |
| CN112481372B (en) | Primer for detecting SNP locus of gene related to accurate medication of chronic heart failure and application | |
| CN110951858A (en) | Primer-probe combination for guiding detection of genes related to glibenclamide drug personalized administration, kit and application | |
| CN112391463B (en) | Special primer for detecting SNP (single nucleotide polymorphism) site of invasive aspergillosis risk after allogeneic hematopoietic stem cell transplantation and application of special primer | |
| CN112980946B (en) | Gene polymorphism detection kit and detection method for guiding administration of rocuronium bromide serving as skeletal muscle relaxant | |
| CN117143998B (en) | Detection primer set and kit for children asthmatic disease drug |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |