CN112980946B - Gene polymorphism detection kit and detection method for guiding administration of rocuronium bromide serving as skeletal muscle relaxant - Google Patents

Abstract

The invention provides a gene polymorphism detection kit and a detection method for guiding the administration of a skeletal muscle relaxant rocuronium bromide. The kit comprises an amplification primer and an extension primer for detecting 5 gene polymorphic sites for guiding rocuronium bromide medication, a Polymerase Chain Reaction (PCR) reagent, a PCR product purification reagent and a single base extension Reaction reagent, and can accurately, quickly and simply detect the gene sites related to rocuronium bromide sensitivity; the detection method provided by the invention determines the sensitivity of a patient to rocuronium bromide by applying a pharmacogenomics technology according to a Single Nucleotide Polymorphism (SNP) site base result, so that the dosage of rocuronium bromide in an operation can be guided and predicted, and an individualized and accurate rocuronium bromide medication scheme is provided.

Description

Gene polymorphism detection kit and detection method for guiding administration of rocuronium bromide serving as skeletal muscle relaxant

The technical field is as follows:

the invention relates to the field of biological medicine, in particular to a gene polymorphism detection kit and a detection method for guiding the administration of a skeletal muscle relaxant rocuronium bromide.

Background art:

a large number of operations and invasive operation examinations need to be performed under general anesthesia every year, and the important connotations of general anesthetics mainly comprise three aspects of sedation, analgesia and muscle relaxation. The muscle relaxant is used for clinical anesthesia, changes the muscle relaxation obtained by deepening general anesthesia and meets the requirements of operations. Therefore, muscle relaxants have become an important adjuvant drug in general anesthesia. Neuromuscular blocking agents (NMBAs) facilitate tracheal intubation, mechanical ventilation, prevent patient movement, facilitate surgery, reduce oxygen consumption, and the like. Wherein, rocuronium is a single quaternary ammonium analog of double quaternary ammonium amino stanol, is non-depolarizing NMBAs, has the characteristics of short onset time, long action duration, quick recovery, small influence on cardiovascular, no histamine release or other adverse reactions, and is mainly used for general anesthesia, skeletal muscle relaxation and endotracheal intubation clinically.

Muscle relaxants are widely used and play an important role in clinical practice as important adjunctive drugs in general anesthesia. In recent years, with the rapid development of precise medical treatment, the safety and effectiveness of medicine use are more and more emphasized, and the requirement of individualized precise medicine application is more prominent. However, a number of clinical studies and observations have shown that muscle relaxants exhibit significant variation between different populations and/or between different individuals in the same population. Clinically the metabolism of rocuronium bromide may be affected by many factors including sex, age, body mass index, physical disease conditions, genetic factors, etc. In clinical practice, patients have extremely high requirements on the level of rocuronium bromide induced muscle relaxation for the dose of rocuronium bromide. The rocuronium bromide is excessive in infusion amount or highly sensitive to rocuronium bromide, and can cause postoperative muscle relaxation residue, prolong the extubation time and postoperative recovery time of a patient, and add unnecessary mental pain and economic burden to the patient. The rocuronium bromide is too little in infusion amount or the patient is low sensitive to rocuronium bromide, the patient can have an unsatisfactory muscle relaxation effect, the visual field and operation of an operation are affected, and even the operation accident caused by body movement in the operation can be serious. It is therefore particularly important to provide individualized, accurate muscle relaxation management to the patient during the perioperative period. Therefore, it is important to know the sensitivity of the patient to rocuronium bromide in advance before the patient is subjected to surgical anesthesia, so as to provide a proper anesthesia scheme and accurate rocuronium bromide infusion amount.

The clinical use of rocuronium bromide varies greatly between individuals, and one of the most important genetic material bases for the variation between individuals is Single Nucleotide Polymorphism (SNP), which mainly refers to DNA sequence polymorphism caused by variation of a single nucleotide at the genome level. The SNPs are the most common human heritable variation, the SNPs widely exist in a human genome, 1 in every 500-1000 base pairs on average, and the total number of the SNPs is estimated to be 300 ten thousand or more. As a third generation genetic marker, SNP is closely related to a plurality of phenotypic differences of human bodies, drug susceptibility and disease susceptibility. The abundant presence of SNPs in the genome makes it a powerful tool, playing a very important role in disease localization and cloning, drug design and testing, and basic research in biology.

Individualized diagnosis and treatment and accurate medicine are great directions of future medical development. The individual target point is located in a certain gene, even a single nucleotide, and the discovery of the genetic marker of the disease can help to develop disease prevention, diagnosis and treatment according to different genetic backgrounds of each patient. The SNP of the gene is an important genetic basis for forming the difference between individuals, and through the relevance analysis of the SNP and the diseases and drug treatment, a doctor can predict and determine the gene related to the diseases through the detected SNP, and can grasp the response characteristics of individual patients to certain drugs in advance, and select the drug with the best treatment effect and the minimum risk of adverse reactions and the like to accurately treat the patients according to the characteristics.

The project team finds out through clinical queue research: the gene polymorphism has an important role in the sensitivity of rocuronium bromide, and the sensitivity of rocuronium bromide has close relation with SNP of NR1I2 rs2472677, NR1I2 rs6785049, SLCO1B1 rs4363657, SLCO1A2 rs4762699 and UGT1A1 rs4148323 genes. Therefore, the application of rocuronium bromide to clinical patients is guided by detecting the genes related to the sensitivity of the patients to the rocuronium bromide, the usage amount of the rocuronium bromide of the patients is accurately regulated and controlled, the patients can be safer in the whole application period, and the application method has important significance.

At present, the mainstream of genetic polymorphism detection in the market is high throughput sequencing (NGS), but the sequencing cost is high, the time consumption is long, and therefore, the clinical application has certain limitation; the real-time fluorescent quantitative PCR can also be adopted for multi-hole reaction detection, although the time-effect problem is met, the flux is low, and when more than 10 sites need to be detected, the practical applicability is not strong. Common detection technologies, such as sequencing, fluorescent quantitative PCR and the like, all need to detect the sites one by one, and when the sites are more, the operation is complex and the cost is higher; the existing nucleic acid mass spectrometry based on multiple PCR has single product, and compared with detection products of the traditional sequencing, real-time fluorescence quantitative PCR and other methods, the selection and combination mode of gene loci is less, and a method and a product which can simultaneously and comprehensively detect multiple gene polymorphisms for guiding rocuronium bromide medication at one time are lacked.

The invention content is as follows:

technical problem to be solved

The invention aims to provide a gene polymorphism detection kit and a detection method for guiding the administration of rocuronium bromide, a skeletal muscle relaxant, which can accurately, quickly and simply detect gene sites related to the sensitivity of rocuronium bromide, determine the sensitivity of a patient to rocuronium bromide according to the base result of an SNP site, and solve the problems that the prior art cannot simultaneously and comprehensively detect a plurality of gene polymorphisms for guiding the administration of rocuronium bromide at one time and cannot quickly determine the sensitivity of the patient to rocuronium bromide.

(II) technical scheme

In order to solve the technical problems, the invention adopts the following technical scheme: a gene polymorphism detection kit for guiding medication of rocuronium bromide serving as a skeletal muscle relaxant comprises an amplification primer and an extension primer for detecting 5 gene polymorphism SNP sites for guiding the medication of rocuronium bromide, wherein the 5 gene polymorphism SNP sites for guiding the medication of rocuronium bromide are as follows: NR1I2 rs2472677, NR1I2 rs6785049, SLCO1B1 rs4363657, SLCO1A2 rs4762699 and UGT1A1 rs4148323, wherein the amplification primers refer to a primer pair which can specifically amplify deoxyribonucleic acid (DNA) fragments comprising the 5 gene polymorphism SNP sites for guiding the rocuronium bromide to be used, and the extension primers refer to primers for carrying out extension reaction on the DNA fragments comprising the 5 gene polymorphism SNP sites for guiding the rocuronium bromide to be used.

In the above technical solution, the amplification primers and the extension primers for detecting the 5 gene polymorphism SNP sites for guiding rocuronium bromide administration are respectively:

the NR1I2 gene rs2472677 locus and the amplification primer thereof is

ACAAGTCCCTTATGGGATATGTGAT (forward), GTGGTTGGTAAGACAGATTGTCATA (reverse),

the extension primer is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGTTTGTTTGTTTTTTAATCA;

rs6785049 site of NR1I2 gene, and the amplification primer is

GTGGAGTTCCCGGAGGTTG (forward), GAATCTCAGTTGACACAGCTCGA (reverse),

the extension primer is TTTTTTTTTTTTTTTCCATCCTCCCTCTTCCTCTC;

rs4363657 locus of SLCO1B1 gene and amplification primer thereof is

ACCAGGATGATTCTGGCTTCAA (forward), GGGAGCATGTATTAACTGGGTCA (reverse),

the extension primer is TTTTTCAGAATAATTTAGTACAGTGGGTAC;

rs4762699 locus of SLCO1A2 gene, and amplification primer thereof is

ATTCCAACCCAGTTTGTCAGTCT (forward), TTGCCATGTCACGTATTTGTCTA (reverse),

the extension primer is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTCAGTGCCTCCCCAT;

UGT1A1 gene rs4148323 site, and amplification primer thereof is

ATAAGTAGGAGAGGGCGAACC (forward), TATGCCCGAGACTAACAAAAGAC (reverse),

the extension primer was TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCTTCAAGGTGTAAAATGCTC.

Specifically, the PCR amplification reaction solution of the amplification primers for amplifying the DNA containing the 5 gene polymorphism SNP sites for directing the administration of rocuronium bromide to a sample, the purification reaction solution for purifying Shrimp Alkaline Phosphatase (SAP), and the extension reaction solution of the extension primers for obtaining the base detection result of the 5 gene polymorphism SNP sites for directing the administration of rocuronium bromide.

The invention also provides a detection method of the gene polymorphism detection kit for guiding the administration of the rocuronium bromide serving as the skeletal muscle relaxant, and the sensitivity of a patient to rocuronium bromide is determined by judging the 5 gene polymorphism SNP sites for guiding the administration of the rocuronium bromide by using the gene polymorphism detection kit for guiding the administration of the rocuronium bromide serving as the skeletal muscle relaxant.

In the technical scheme, the judgment of the 5 gene polymorphism SNP sites for guiding the rocuronium bromide to be used comprises the following steps:

step 1), extracting genome DNA of a sample to be detected;

step 2), taking the genome DNA obtained in the step 1) as a template, and carrying out PCR amplification reaction by using the amplification primer and the PCR amplification reaction solution to amplify a section of DNA containing the SNP locus;

step 3), removing the residual deoxyribonucleoside triphosphate and the primer in the PCR system obtained in the step 2) by using SAP enzyme to obtain a sample DNA fragment;

step 4), adding the extension primer into the reaction liquid obtained in the step 3), performing extension termination reaction on the sample DNA by adopting single-base extension termination reaction liquid, and purifying a reaction product by using resin to obtain a target gene for SNP analysis;

and 5) calculating the genotype Frequency and the Allele Frequency, checking Hardy-Weinberg Equilibrium Law (Hardy-Weinberg Equisibrium Law) and the Minimum Allele Frequency (MAF), analyzing the difference of the genotype and the Allele of the target gene on the site obtained in the step 4) through Pearson chi-square test, determining the base of the SNP site, and determining the sensitivity of the patient to rocuronium bromide according to the base result of the SNP site.

Specifically, the reaction conditions for performing the PCR amplification reaction in step 2) are: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 deg.C for 10s, annealing at 60 deg.C for 10s, and extension at 72 deg.C for 10s, performing 35 cycles, extension at 72 deg.C for 5min, and storing at 4 deg.C; the reaction conditions under which the extension is carried out are: circulating for 25 times at 96 deg.C for 2min, at 96 deg.C for 10s, at 50 deg.C for 5s, and at 60 deg.C for 30s, and storing at 4 deg.C.

Specifically, in the step 5), according to the base result of the SNP site, when determining the sensitivity of the patient to rocuronium bromide: when the base result of the obtained NR1I2 gene rs2472677 site is CT or TT genotype, or when the base result of the obtained NR1I2 gene rs6785049 site is GA or AA genotype, or when the base result of the obtained SLCO1B1 gene rs4363657 site is TC or CC genotype, or when the base result of the obtained UGT1A1 gene rs4148323 site is GA or AA genotype, the method indicates that the patient is highly sensitive to rocuronium bromide, and when the base result of the obtained SLCO1A2 gene rs4762699 site is TC or CC genotype, the method indicates that the patient is less sensitive to rocuronium bromide.

(III) advantageous effects

Compared with the prior art, the invention has the following beneficial effects: (1) the amplification primer and the extension primer provided by the invention can accurately amplify and extend the gene locus related to the sensitivity of rocuronium bromide, and have high sensitivity and good specificity; (2) the gene polymorphism detection kit for guiding the medication of the rocuronium bromide serving as a skeletal muscle relaxant can accurately, quickly and simply detect a plurality of gene loci related to the sensitivity of the rocuronium bromide; (3) the detection method of the gene polymorphism detection kit for guiding the medication of the rocuronium bromide serving as a skeletal muscle relaxant, provided by the invention, applies a pharmacogenomics technology, can simultaneously and comprehensively detect a plurality of gene polymorphisms for guiding the medication of the rocuronium bromide at one time according to the base result of the SNP site, and quickly determines the sensitivity of a patient to the rocuronium bromide, so that the dosage of the rocuronium bromide in an operation can be guided and predicted, and an accurate medication scheme of the rocuronium bromide and muscle relaxin is provided.

Description of the drawings:

in order to more clearly illustrate the technical solution in the embodiments of the present invention, the drawings required to be used in the embodiments will be briefly described below.

FIG. 1 is an agarose gel electrophoresis of 48 DNA samples randomly extracted in an example of the present invention;

FIG. 2 is a diagram of agarose gel electrophoresis of the amplification primers and extension primers of the present invention after amplification alone and separation of the A-E five groups for sample mixture purification;

FIG. 3 is a diagram of 5 detection peaks of SNP sites of genes for guiding rocuronium bromide administration according to an embodiment of the present invention;

FIG. 3.1 is a detection peak map of site rs2472677 of NR1I2 gene (the number in the map is the gene sequence number);

FIG. 3.2 is the detection peak diagram of site rs6785049 of NR1I2 gene;

FIG. 3.3 is the detection peak map of rs4363657 locus of SLCO1B1 gene;

FIG. 3.4 is a detection peak diagram of rs4148323 site of UGT1A1 gene;

FIG. 3.5 is a detection peak diagram of rs4762699 locus of SLCO1A2 gene;

the specific implementation mode is as follows:

the technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention.

The gene polymorphism detection kit for guiding the medication of rocuronium bromide serving as a skeletal muscle relaxant comprises 5 pairs of amplification primers of SNP locus genotypes and 5 extension primers, wherein the detection genes are 5 genes related to the sensitivity of rocuronium bromide: NR1I2 rs2472677, NR1I2 rs6785049, SLCO1B1 rs4363657, SLCO1A2 rs4762699, UGT1A1 rs 4148323.

The amplification primer refers to a primer pair aiming at NR1I2 rs2472677, NR1I2 rs6785049, SLCO1B1 rs4363657, SLCO1A2 rs4762699 and UGT1A1 rs4148323, and DNA fragments comprising the 5 SNP sites can be amplified at the 5 SNP sites;

the extension primer refers to a primer for carrying out extension reaction on DNA fragments of the 5 SNP sites including NR1I2 rs2472677, NR1I2 rs6785049, SLCO1B1 rs4363657, SLCO1A2 rs4762699 and UGT1A1 rs 4148323.

Polymerase Chain Reaction (PCR) is used to amplify a region of DNA located between two known sequences. The reaction mix was incubated at three different temperatures for template denaturation, primer annealing and primer extension sequentially for each PCR cycle. The process can be automated using a programmable temperature thermal cycler.

Primers are an important component of PCR technology, and are small pieces of single-stranded DNA that serve as a starting point for DNA replication and as a polynucleotide strand that acts as a starting point for extension of each polynucleotide strand during a nucleic acid synthesis reaction.

The invention designs a forward amplification primer, a reverse amplification primer and an extension primer respectively aiming at each gene locus related to rocuronium bromide sensitivity. The last nucleotide of the forward primer is respectively complementary and paired with bases detected by the rocuronium bromide sensitivity-related gene sites, and the reverse primer is combined to carry out specific amplification on the DNA template to be detected during PCR amplification. The single-base extension primer pair carries out extension reaction on DNA fragments including each gene site related to rocuronium bromide sensitivity.

The amplification primers and the extension primers for detecting the genotypes of the 5 SNP loci are respectively as follows:

the NR1I2 gene rs2472677 locus and the amplification primer thereof is

ACAAGTCCCTTATGGGATATGTGAT (forward), GTGGTTGGTAAGACAGATTGTCATA (reverse),

the extension primer is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGTTTGTTTGTTTTTTAATCA;

rs6785049 site of NR1I2 gene, and the amplification primer is

GTGGAGTTCCCGGAGGTTG (forward), GAATCTCAGTTGACACAGCTCGA (reverse),

the extension primer is TTTTTTTTTTTTTTTCCATCCTCCCTCTTCCTCTC;

rs4363657 locus of SLCO1B1 gene and amplification primer thereof is

ACCAGGATGATTCTGGCTTCAA (forward), GGGAGCATGTATTAACTGGGTCA (reverse),

the extension primer is TTTTTCAGAATAATTTAGTACAGTGGGTAC;

rs4762699 locus of SLCO1A2 gene, and amplification primer thereof is

ATTCCAACCCAGTTTGTCAGTCT (forward), TTGCCATGTCACGTATTTGTCTA (reverse),

the extension primer is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTCAGTGCCTCCCCAT;

UGT1A1 gene rs4148323 site, and amplification primer thereof is

ATAAGTAGGAGAGGGCGAACC (forward), TATGCCCGAGACTAACAAAAGAC (reverse),

the extension primer was TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCTTCAAGGTGTAAAATGCTC.

The gene polymorphism detection kit for guiding the administration of the skeletal muscle relaxant rocuronium bromide further comprises:

amplification reaction liquid, wherein the amplification reaction liquid is used for amplifying DNA containing NR1I2 rs2472677, NR1I2 rs6785049, SLCO1B1 rs4363657, SLCO1A2 rs4762699 and UGT1A1 rs4148323 sites in a sample, and the amplification reaction liquid comprises: 10 XPCR Buffer with 15mM MgCl20.5ul, 25mM MgCl20.4ul, 25mM dNTP mixed liquor 0.1ul, 0.5uM Primer mix 1ul, 5U/. mu.l HotStar Taq enzyme, 10 ng/. mu.l DNA 1ul, HPLC grade ultrapure water 1.8 ul.

And purifying reaction liquid, wherein the purification reaction liquid is used for purifying the amplified DNA fragment and comprises 1.53ul of triple distilled water, 0.17ul of SAP buffer and 0.3ul of SAP enzyme in 1.7U/ul.

An extension reaction solution for obtaining base detection results of 5 SNP sites, comprising: 0.619ul of triple distilled water, 0.2ul of iPLEX Buffer Plus, 0.2ul of iPLEX Terminator Mix, 0.94ul of iPLEX extended Primer Mix, 0.041ul of iPLEX Enzyme, and 7ul of the amplification reaction solution and the purification reaction solution.

A detection method of a gene polymorphism detection kit for guiding the administration of a skeletal muscle relaxant rocuronium bromide is characterized in that the gene polymorphism detection kit for guiding the administration of the skeletal muscle relaxant rocuronium bromide is used for determining the sensitivity of a patient to rocuronium bromide by judging 5 SNP sites and is used for guiding a muscle relaxation administration scheme.

The judgment of the 5 SNP loci comprises the following steps:

step 1), extracting genome DNA of a sample to be detected;

step 2), taking the genome DNA obtained in the step 1) as a template, and carrying out PCR amplification reaction by using the amplification primer and the PCR amplification reaction solution to amplify a section of DNA containing the SNP locus;

step 3), removing the residual deoxyribonucleoside triphosphates and primers in the PCR system obtained in the step 2) by using SAP enzyme to obtain a sample DNA fragment;

step 4), adding the extension primer into the reaction liquid obtained in the step 3), performing extension termination reaction on the sample DNA by adopting single-base extension termination reaction liquid, and purifying a reaction product by using resin to obtain a target gene for SNP analysis;

and 5) calculating the genotype Frequency and the Allele Frequency, checking Hardy-Weinberg equilibrium Law and the Minimum Allele Frequency (MAF), analyzing the difference between the genotype and the Allele of the target gene on the site obtained in the step 4) through Pearson chi-square test, determining the base of the SNP site, and determining the sensitivity of the patient to rocuronium bromide according to the base result of the SNP site.

When determining the sensitivity of a patient to rocuronium bromide: when the base result of the obtained NR1I2 gene rs2472677 site is represented by CT or TT genotype, or when the base result of the obtained NR1I2 gene rs6785049 site is represented by GA or AA genotype, or when the base result of the obtained SLCO1B1 gene rs4363657 site is represented by TC or CC genotype, or when the base result of the obtained UGT1A1 gene rs4148323 site is represented by GA or AA genotype, the high sensitivity of the patient to rocuronium is suggested; when the base result of the rs4762699 locus of the SLCO1A2 gene is obtained and shows as a TC or CC genotype, the low sensitivity of the patient to rocuronium bromide is suggested.

The detection method of the gene polymorphism detection kit for guiding the medication of the skeletal muscle relaxant rocuronium bromide provided by the invention has the following amplification program: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 10s, for 35 cycles; extending for 5min at 72 ℃; storing at 4 ℃.

The reaction conditions for single base extension in the extension reaction solution are as follows: circulating at 96 deg.C for 2min, at 96 deg.C for 10s, at 50 deg.C for 5s, and at 60 deg.C for 30s for 25 times; storing at 4 ℃.

Examples

A detection method for detecting the gene polymorphism related to the sensitivity of rocuronium bromide by using a gene polymorphism detection kit for guiding the medication of the rocuronium bromide serving as a skeletal muscle relaxant comprises the following steps:

1. extraction of genomic DNA

One day before the operation or the anesthesia operation of the patient, the arterial blood of the patient is extracted and collected in an EDTA anticoagulation tube (purple head), and an TSINGKE DNA extraction kit (general type) is used, and the specific steps are as follows:

1.1A 96-well plate (1.2ml deep well plate) was numbered.

1.2 blood samples were thawed at room temperature, then mixed several times by gentle inversion, after which 200ul of blood was taken into a deep well plate. (100-200 ul blood samples in sequence)

1.3 Add 20ul proteinase K into each well, shake and mix evenly.

1.4 adding 200ul Buffer gA1, sealing with a silica gel pad, mixing by vortex oscillation, incubating at 65 deg.C for 30min, mixing by oscillation for 2-3 times to ensure cell lysis.

1.5 after incubation, add 300 isopropanol (or 400ul absolute ethanol) to each well, add 10 microliter magnetic beads (mix well before use, mix well occasionally when adding sample for a long time), and mix well for 10 seconds by vortex oscillation. (isopropyl alcohol is 0.6 to 0.7 times volume, and absolute ethyl alcohol is equal volume.)

Shaking horizontally for 30min at 1.6 to make the magnetic beads fully combined with the DNA and improve the yield of the DNA; the vibration rotating speed must be sufficient, and the magnetic beads need to be vibrated.

1.7 shaking, placing on a magnetic frame, inverting for two times after full adsorption (solution clarification), adsorbing for 2-4 minutes again, and discarding the supernatant after the solution clarification.

1.8 adding 500 microliter Buffer PW (whether absolute ethyl alcohol is added before use or not), oscillating, uniformly mixing, standing, magnetically attracting until the solution is clarified, reversing again, standing until the solution is clarified again, and discarding the supernatant; and repeating the steps once.

1.9 adding 500 microliter of Wash Buffer (whether absolute ethyl alcohol is added before use or not), shaking, uniformly mixing, standing, magnetically attracting (for 2-4 minutes) until the solution is clear, standing after reversing again until the solution is clear again, and discarding the supernatant.

1.10500 spin down and centrifuge or oven dry for 3 min (not too dry, otherwise difficult to elute DNA), add 100. mu.l TE buffer. After shaking and mixing uniformly, shaking horizontally for 5min, then magnetically sucking until the solution is clarified again (adsorbing for 2-4 min), ensuring that the DNA is fully eluted, and absorbing for electrophoresis identification.

SNP genotyping

Determining SNP sites related to the sensitivity of rocuronium bromide, intercepting a gene sequence with the length of more than 100bp by taking the SNP sites as the center, designing a primer by adopting assay design 3.1 software according to the sequence information of the SNP, and then synthesizing the primer. The synthesized primers and sample DNA are subjected to PCR reaction, and the mixed reaction product is subjected to SNP genotyping on a Sequenom MassArray system. The specific experimental procedures are as follows:

2.1 primer design

2.1.1 primer design principles.

Design principle of peripheral primers: the length of the primer is 15-30bp, the effective length of the primer is not more than 38 in general, otherwise, the optimal extension temperature of the PCR can exceed the optimal action temperature of Taq enzyme, and the specificity of the product is reduced. The GC content should be between 40% and 60%, and the optimum Tm value is between 58 ℃ and 60 ℃. The primer itself cannot contain self-complementary sequences, otherwise a hairpin-like secondary structure is formed. There should be no more than 4 complementary or homologous bases between primers, which would otherwise form primer dimers, especially to avoid complementary overlap at the 3' end.

Extension primer design principle: the primer length is 15-30bp, the GC content is 40% -60%, and the optimal Tm value is 58-60 ℃. To be able to distinguish different genotypes of different SNPs, different lengths of PolyC or PolyT can be added to the 5' ends of the primers to differentiate the primers by length. The shortest design of the primer after tailing is 36bp, and the length difference of two adjacent SNP site primers is 4-6 nucleotides generally.

2.1.2 primer design Synthesis.

Searching the target sequence of the SNP locus at NCBI (https:// www.ncbi.nlm.nih.gov /) and designing a peripheral amplification primer: a pair of peripheral amplification primers is designed aiming at each of 5 sites, 5 pairs of peripheral amplification primers are designed in total, the names of the primers are named according to RS login numbers/gene names/sites, and the peripheral amplification primers are synthesized into PAGE primers. PrimerPremier5 software designs single base extension primer, designs one single base extension primer for 5 sites, 5 pairs of single base extension primers in total, the name of the primer is named by RS accession number/gene name/site, and the HPLC primer is synthesized by the single base extension primer.

PCR specific primers and single base extension primers were automatically designed for multiplex reactions: the amplification primers and the extension primers for detecting the genotypes of the 5 SNP loci are respectively as follows:

the NR1I2 gene rs2472677 locus and the amplification primer thereof is

ACAAGTCCCTTATGGGATATGTGAT (forward), GTGGTTGGTAAGACAGATTGTCATA (reverse),

the extension primer is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGTTTGTTTGTTTTTTAATCA;

rs6785049 site of NR1I2 gene, and the amplification primer is

GTGGAGTTCCCGGAGGTTG (forward), GAATCTCAGTTGACACAGCTCGA (reverse),

the extension primer is TTTTTTTTTTTTTTTCCATCCTCCCTCTTCCTCTC;

rs4363657 locus of SLCO1B1 gene and amplification primer thereof is

ACCAGGATGATTCTGGCTTCAA (forward), GGGAGCATGTATTAACTGGGTCA (reverse),

the extension primer is TTTTTCAGAATAATTTAGTACAGTGGGTAC;

rs4762699 locus of SLCO1A2 gene, and amplification primer thereof is

ATTCCAACCCAGTTTGTCAGTCT (forward), TTGCCATGTCACGTATTTGTCTA (reverse),

the extension primer is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTCAGTGCCTCCCCAT;

UGT1A1 gene rs4148323 site, and amplification primer thereof is

ATAAGTAGGAGAGGGCGAACC (forward), TATGCCCGAGACTAACAAAAGAC (reverse),

the extension primer was TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCTTCAAGGTGTAAAATGCTC.

2.2 primer dilution

Firstly, diluting the single-tube amplification specific primers to the final concentration of 100 mu M, adding deionized water, fully oscillating and uniformly mixing to ensure that the concentration of each primer is 0.5 mu M.

Secondly, diluting the single-tube single-base extension primer to the final concentration of 500 mu M, and adding the primer for mixing to ensure that the concentration of each primer is 8 mu M, 10 mu M and 15 mu M.

Thirdly, calculating the molecular weight, the mass number and the mole number of the primer according to the use instruction of the DNA synthesis product, and further calculating the amount of the deionized water to be added according to the required concentration.

2.3PCR amplification reactions

(ii) the relevant reagents are arranged in 384 plates.

② the sample which is standardized to 10-20 ng/mul, and centrifuging for 3 minutes at 1000g for standby.

Dissolving each PCR component and placing on ice for later use.

The components of the PCR amplification reaction are shown in the following table:

genotyping amplification PCR reaction component of Sequenom MassArray system

Fifthly, carefully and uniformly mixing the prepared reagents, and then distributing the mixed reagents into a 12-hole continuous discharge pipe, wherein 148ul of uniformly mixed reagent is added into each hole.

Sixthly, a 12-channel pipette sucks 4 mu l of mixed reagent and adds the mixed reagent into a 384-hole plate, wherein H11, H12, P11 and P12 holes are used as controls, and primers are not added into the holes, and only other components are contained.

Seventhly, adding a corresponding template into each plate according to the marked sample plate, wherein the adding volume is 1 mu l.

After completing the liquid transfer, carefully covering a 384-hole closing plate film, and firmly pressing each hole to prevent evaporation and the like during a PCR procedure.

Ninthly, amplification PCR reaction program: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 10s, for 35 cycles; extending for 5min at 72 ℃; storing at 4 ℃.

A1% agarose gel was prepared at R, with 25 wells in each row, one of which served as a marker well, and the other was added to the PCR reaction product.

Electrophoresis was performed, and 2. mu.l of the loading buffer, 1. mu.l of the PCR product, voltage 110V, and current 75mA were aspirated, and after 40 minutes, the result was observed, and if the result was good, the SAP reaction was continued.

2.4 SAP reaction

The related reagents are prepared according to 384 plates, and the components of the related reagents for SAP reaction are shown in the following table.

SAP reaction-related agent formulation component

② the prepared solution is evenly distributed into a 96-well plate, and the reagent amount is 10 mul/plate in each well.

③ using a robotic arm to add reagents, pipette 2. mu.l to each well of 384 plates from 96 well plates.

Fourthly, after the liquid transfer is finished, a 384-hole closing plate membrane is carefully covered, and each hole is firmly pressed, so that the phenomena of evaporation and the like during the PCR procedure are prevented.

SAP reaction program:

temperature (. degree. C.)	Time	Number of cycles
			37	40min	/
85	5min	/
			4	∞	/

2.5 Single base extension reaction

Firstly, related reagents are configured according to 384 plates, and the components of the related reagents for the extension reaction are shown in the following table.

Extension reaction-related reagent component

② the prepared solution is evenly distributed into a 96-well plate, and the reagent amount is 10 mul/plate in each well.

③ using a robotic arm to add reagents, pipette 2. mu.l from a 96-well plate to each well of a 384-well plate.

Fourthly, after the liquid transfer is finished, a 384-hole closing plate membrane is carefully covered, and each hole is firmly pressed, so that the phenomena of evaporation and the like during the PCR procedure are prevented.

Extension reaction procedure:

the reaction conditions for the single base extension in the extension reaction solution were: circulating at 96 deg.C for 2min, at 96 deg.C for 10s, at 50 deg.C for 5s, and at 60 deg.C for 30s for 25 times; storing at 4 ℃.

2.6 resin purification

2.6.1 desalting:

and (3) completing desalting, introducing into Assay, inputting a sample table, establishing a plate, spotting, performing Mass ARRAY analysis, controlling quality, outputting a report and other experimental works. The specific process is as follows:

first, a 384/6MG sample plate was uniformly filled with resin and left to dry for 10 minutes.

② use Liquid Handler arm in 384 sample plate each hole in 16 u l water.

③ the 384 sample plate was gently inverted and snapped onto the sample plate, and then tapped to drop the resin into each well of the sample plate.

And fourthly, placing the 384 sample plate in a centrifuge to rotate and mix evenly for 60 minutes at room temperature.

2.6.2 introduction Assay:

opening Typer4.0.

② select Assay Editor.

And thirdly, right click adds a new item.

Fourthly, the name of the new project or the name of the existing project is pressed on the right key, and an import detection group is selected.

Cancel SNP Group option, will cancel design file and browse array Group (xls file) automatically.

A new array group ID or default file name may be entered.

And seventhly, conducting once and then closing.

Closing the array editor.

2.6.3 sample Table input:

create a sample list according to the 384 loading order.

② opening Typerse 4.0, selecting Plate Editor.

And thirdly, clicking the Sample Tab and right-clicking to newly create a Sample folder.

Fourthly, establishing a sample list by right key.

Opening and browsing the created sample list, inputting the name of the sample group, and finishing the import.

2.6.4 building a plate:

opening Typer4.0.

② select Plate Editor.

And right click adds new user.

And fourthly, adding a new item by right click.

Right click add plate.

Plate type ID and selection plate type.

Finding the Assay Tab.

And eighthly, selecting the holes to be added in the middle plate, clicking by a right key and selectively adding Assay.

Ninthly, finding Sample Tab, selecting a hole to be added in the middle plate, clicking a right button and selecting to add the Sample.

The red stores the board file.

2.6.5 spotting:

centrifuging: the desalted product was centrifuged at 4000 rpm for 4 minutes to precipitate the resin.

Checking the volume.

a) Transfer is selected in the main menu.

b) One Method is loaded.

c) The Dispense Speed parameter is set.

d) Volume Check is selected.

e) Run was selected and the volume observed.

f) The Dispense Speed parameter was adjusted by volume to obtain the appropriate volume.

And thirdly, spotting on the chip, and checking the same volume by the method.

(iv) dot Calibrant on the chip, note that Calibrant was selected in the Method.

2.6.5 Mass ARRAY analysis:

opening an RT program on an RT computer.

② press Probe Scout Plate Out button on COMPACT, then put chip on Scout Plate and put back into COMPACT, then press Probe In button.

Let Chip Linker open and connect Chip and Plate.

a) Double click on Chip Linker.

b) Find the Plate built in the Plate Editor.

c) The iPLEX mode is selected.

d) The Genotype or Genotype + Area mode is selected.

e) The type of distensiser is selected.

f) The name of the experiment is entered.

g) Inputting chip bar codes.

h) And selecting addition and creation.

And fourthly, inputting the bar code name into Acquire, clicking the Barcode Report, and clicking the AUTO RUN SETUP tab after the result is correct.

CHIP scanning.

2.6.6 quality control:

opening Type4.0 and clicking TypeAnalyzer.

And turning on the scanning result.

Checking quality control points.

And fourthly, checking the yield and the typing map of the Assay.

2.6.7 outputs a report:

firstly, a typing map.

And secondly, respectively exporting original genotyping data and genotyping data combined with the genotyping chart.

Checking the integrity and correctness of the data file.

Fourthly, storing the result into a corresponding storage medium and submitting the result to a biological information room for analysis.

3. Determination of results

Calculating genotype frequency and allele frequency, checking Hardy-Weinberg equilibrium law (Hardy-Weinberg equilibrium) and Minimum Allele Frequency (MAF), analyzing the difference of the genotype and the allele of a target gene on a locus by Pearson chi-square test, determining the base of an SNP locus, and determining the sensitivity of a patient to rocuronium bromide according to the base result of the SNP locus.

When determining the sensitivity of a patient to rocuronium bromide: when the base result of the obtained NR1I2 gene rs2472677 site is CT or TT genotype, or when the base result of the obtained NR1I2 gene rs6785049 site is GA or AA genotype, or when the base result of the obtained SLCO1B1 gene rs4363657 site is TC or CC genotype, or when the base result of the obtained UGT1A1 gene rs4148323 site is GA or AA genotype, the patient is indicated to be highly sensitive to rocuronium bromide; when the base result of the rs4762699 locus of the SLCO1A2 gene is obtained and shows as a TC or CC genotype, the low sensitivity of the patient to rocuronium bromide is suggested.

In conclusion, the gene polymorphism detection kit and the detection method for guiding the medication of the rocuronium bromide serving as a skeletal muscle relaxant provided by the invention can accurately, quickly and simply detect the gene sites related to the sensitivity of rocuronium bromide, determine the sensitivity of a patient to rocuronium bromide according to the base result of the SNP sites, and solve the problems that the prior art cannot simultaneously and comprehensively detect a plurality of gene polymorphisms for guiding the medication of rocuronium bromide at one time and cannot quickly determine the sensitivity of the patient to rocuronium bromide.

Finally, it should be noted that the above examples are only used for illustrating the present invention and do not limit the protection scope of the present invention. In addition, after reading the technical content of the invention, the skilled person can make various changes, modifications or variations to the invention, and all the equivalents thereof also belong to the protection scope defined by the claims of the present application.

Claims (6)

1. A gene polymorphism detection kit for guiding the administration of rocuronium bromide, a skeletal muscle relaxant, is characterized by comprising: five pairs of amplification primers and five extension primers for detecting 5 gene polymorphism SNP sites for guiding rocuronium bromide medication, wherein the 5 gene polymorphism SNP sites for guiding rocuronium bromide medication are as follows: NR1I2 rs2472677, NR1I2 rs6785049, SLCO1B1 rs4363657, SLCO1A2 rs4762699 and UGT1A1 rs4148323, wherein the amplification primer refers to a primer pair capable of specifically amplifying DNA fragments comprising the 5 gene polymorphism SNP sites for guiding the application of rocuronium bromide, and the extension primer refers to a primer for carrying out extension reaction on the DNA fragments comprising the 5 gene polymorphism SNP sites for guiding the application of rocuronium bromide.

2. The kit for detecting gene polymorphism of rocuronium bromide, a skeletal muscle relaxant, according to claim 1, wherein the amplification primers and the extension primers for detecting the 5 SNP loci for guiding rocuronium bromide are respectively:

the NR1I2 gene rs2472677 locus has a forward amplification primer of ACAAGTCCCTTATGGGATATGTGAT, a reverse amplification primer of GTGGTTGGTAAGACAGATTGTCATA and an extension primer of TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGTTTGTTTGTTTTTTAATCA;

rs6785049 site of NR1I2 gene, wherein the forward amplification primer is GTGGAGTTCCCGGAGGTTG, the reverse amplification primer is GAATCTCAGTTGACACAGCTCGA, and the extension primer is TTTTTTTTTTTTTTTCCATCCTCCCTCTTCCTCTC;

rs4363657 locus of SLCO1B1 gene, wherein the forward amplification primer is ACCAGGATGATTCTGGCTTCAA, the reverse amplification primer is GGGAGCATGTATTAACTGGGTCA, and the extension primer is TTTTTCAGAATAATTTAGTACAGTGGGTAC;

rs4762699 locus of SLCO1A2 gene, wherein the forward amplification primer is ATTCCAACCCAGTTTGTCAGTCT, the reverse amplification primer is TTGCCATGTCACGTATTTGTCTA, and the extension primer is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTCAGTGCCTCCCCAT;

UGT1A1 gene rs4148323 locus, wherein the forward amplification primer is ATAAGTAGGAGAGGGCGAACC, the reverse amplification primer is TATGCCCGAGACTAACAAAAGAC and the extension primer is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCTTCAAGGTGTAAAATGCTC.

3. The kit for detecting gene polymorphism of the skeletal muscle relaxant rocuronium bromide drug according to claim 1, further comprising: the amplification reaction solution is used for amplifying DNA containing NR1I2 rs2472677, NR1I2 rs6785049, SLCO1B1 rs4363657, SLCO1A2 rs4762699 and UGT1A1 rs4148323 sites in a sample, and comprises: 10 XPCR Buffer with 15mM MgCl 20.5. mu.l, 25mM MgCl 20.4. mu.l, 25mM dNTP mixture 0.1. mu.l, 0.5uM Primer mix 1. mu.l, 5U/. mu.l HotStar Taq enzyme 0.2. mu.l, 10 ng/. mu.l DNA 1. mu.l, HPLC grade ultra pure water 1.8. mu.l; the purification reaction solution is used for purifying amplified DNA fragments and comprises 1.53 mu l of triple distilled water, 0.17 mu l of SAP Buffer and 0.3 mu l of 1.7U/mu l of SAP enzyme; the extension reaction solution is used for obtaining base detection results of 5 SNP sites, and comprises the following steps: 0.619. mu.l of triple distilled water, 0.2. mu.l of iPLEX Buffer Plus, 0.2. mu.l of iPLEX Terminator Mix, 0.94. mu.l of iPLEX extended Primer Mix, and 0.041. mu.l of iPLEX Enzyme.

4. The use of a reagent for detecting 5 SNP sites of gene polymorphism instructing the administration of rocuronium bromide according to any one of claims 1 to 3 in the preparation of a kit for detecting gene polymorphism instructing the administration of rocuronium bromide, a skeletal muscle relaxant, which is characterized by comprising the following steps:

step 1), extracting genome DNA of a sample to be detected;

step 2), taking the genome DNA obtained in the step 1) as a template, and carrying out PCR amplification reaction by using an amplification primer and a PCR amplification reaction solution to amplify a section of DNA respectively containing the 5 gene polymorphism SNP loci for guiding rocuronium bromide to be used;

step 3), removing the residual deoxyribonucleoside triphosphates and primers in the PCR system obtained in the step 2) by using SAP enzyme to obtain a sample DNA fragment;

step 4), adding extension primers into the reaction liquid obtained in the step 3), performing extension termination reaction on the sample DNA by adopting single-base extension termination reaction liquid, and purifying the reaction product by resin to obtain a target gene for SNP analysis;

and 5) calculating the genotype frequency and the allele frequency, checking the Hardy-Weinberg equilibrium law and the minimum allele frequency, analyzing the difference of the genotype and the allele of the target gene obtained in the step 4) on the site through the Pearson chi-square test, determining the base of the SNP site, and determining the sensitivity of the patient to rocuronium bromide according to the base result of the SNP site.

5. Use according to claim 4, characterized in that: the reaction conditions for carrying out the PCR amplification reaction in the step 2) are as follows: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 deg.C for 10s, annealing at 60 deg.C for 10s, and extension at 72 deg.C for 10s, performing 35 cycles, extension at 72 deg.C for 5min, and storing at 4 deg.C; the reaction conditions under which the extension is carried out are: circulating at 96 deg.C for 2min, at 96 deg.C for 10s, at 50 deg.C for 5s, at 60 deg.C for 30s for 25 times, and storing at 4 deg.C.

6. Use according to claim 4, characterized in that: when the sensitivity of the patient to rocuronium bromide is determined according to the base result of the SNP locus in the step 5): when the base result of the obtained NR1I2 gene rs2472677 site is CT or TT genotype, or when the base result of the obtained NR1I2 gene rs6785049 site is GA or AA genotype, or when the base result of the obtained SLCO1B1 gene rs4363657 site is TC or CC genotype, or when the base result of the obtained UGT1A1 gene rs4148323 site is GA or AA genotype, the method indicates that the patient is highly sensitive to rocuronium bromide, and when the base result of the obtained SLCO1A2 gene rs4762699 site is TC or CC genotype, the method indicates that the patient is less sensitive to rocuronium bromide.

Images