RU2352641C1 - Method of diagnosing heredotary predisposition to thrombophilia - Google Patents

Abstract

FIELD: biotechnologies; medicine.

SUBSTANCE: claimed is method of diagnostics of hereditary predisposition to throbophilia, which includes isolation of DNA, amplification of sections of MTHFR genes in humans, V factor of blood clotting (FV) and prothrombin (FII) by carrying out polymerase chain reaction using up to three pairs of specially selected oligonucleotide primers, processing amplification fragments with restriction TaqI endonuclease and determination of obtained fragments size by electrophoresis. In discovering polymorphic replacements C677→T in MTHFR gene, G1691→A in gene FII and G20210→A in gene FII, hereditary predisposition to thrombophilia is diagnosed.

EFFECT: invention can be used in medicine as easier and more accurate method of diagnosing individual predisposition to thrombophilia.

1 dwg, 4 tbl, 2 ex

Description

The invention relates to the field of molecular biology and can be used in medicine in the diagnosis of hereditary predisposition of an individual to thrombophilia.

Thrombophilia - a tendency to develop thrombosis. In people with a genetically determined form of thrombophilia, thrombosis most often develops in the presence of additional risk factors: pregnancy, hormonal contraceptives, increased levels of homocysteine, antiphospholipid antibodies.

A connection was established between acquired and genetically determined (hereditary) thrombophilia not only with recurring thrombosis, myocardial infarction, strokes, etc., but also with such common forms of obstetric pathology as miscarriage in the early stages (the risk increases 3 times), the lag of fetal development , late toxicosis (gestosis), placental insufficiency. Most often, women find thrombosis in the placenta, which is the reason for the increased risk of developing all of the above complications. The high-risk group classically includes pregnant women with a genetic form of thrombophilia who are shown antithrombotic therapy during pregnancy, during childbirth and in the postpartum period (Ministry of Health of the Russian Federation: Letter dated 27.11.2002 N2510 / 11891-02-32 Prevention of pulmonary embolism in obstetric practice).

Prevention and treatment of hereditary thrombophilia is not something special and can be successfully carried out by clinicians armed with heparin and oral anticoagulants. Therefore, the main problems of this part of modern medicine are the identification of markers of thrombophilia and the development of antithrombotic therapy regimens (dosage of drugs and the duration of their administration). Gene markers of hereditary thrombophilia include the methylene tetrahydrofolate reductase mutation, the Leiden mutation, and the prothrombin G20210A gene mutation.

The most studied mutation is the variant in which the cytosine (C) nucleotide at position 677 is replaced by thymidine (T), which leads to the replacement of the amino acid residue of alanine with the residue of valine at the folate binding site. Such an MTHFR polymorphism is referred to as a C677T mutation. Persons homozygous for this mutation show MTHFR thermolability and a decrease in enzyme activity to about 35% of the average. This is accompanied by an increase in the level of homocysteine in the blood and the development of thrombophilic conditions.

The Leiden mutation of the coagulation factor V gene V is characterized by the replacement of the guanine nucleotide with the adenine nucleotide at position 1691. As a result of this mutation, the activated coagulation factor V becomes insensitive to the effects of activated protein C (APC), which is a physiological anticoagulant that inactivates coagulation factors V and VIII. This leads to hyperactivation of the prothrombinase complex and the development of thrombophilia.

The mutation of the prothrombin G20210A gene is characterized by the replacement of the guanine nucleotide with the adenine nucleotide at position 20210. In the presence of this mutation, increased amounts of chemically normal prothrombin are detected. The level of prothrombin can be one and a half to two times higher than normal.

Diagnostics of C677 → T mutations in the human methylenetetrahydrofolate reductase (MTHFR) gene, G1691 → A in the human blood coagulation factor V gene (Leiden mutation), and G20210 → A in the human prothrombin gene is currently carried out using a variety of methods to detect oligonucleotide polymorphs in particular, by direct sequencing (1), mass spectrometric sequencing (2) or pyrosequencing (3), hybridization (4), analysis of restriction fragment length polymorphism (5), allele-specific PCR (6), and others.

As for the sequencing methods, they have high accuracy, but are not suitable for mass use in medical practice, because make high demands on the quality of the tested DNA samples and require extremely expensive equipment and reagents.

The same applies to the most promising from the point of view of performance options for hybridization methods (7). The ability to scale them is very problematic due to the need to use sophisticated equipment for immobilizing DNA (special inkjet printers, photolithography devices, etc.) and expensive optical devices for reading results (fluorescence microscope, equipment for measuring the kinetics of melting, etc.) (8 )

One of the options of the hybridization method is to measure the melting temperature of a fluorescently-labeled hybridization probe (9). This method uses two conventional PCR primers to increase the number of the target fragment and two primers labeled with fluorophores, one of which quenches the fluorescence of the other upon close proximity (resonance fluorescence energy transfer). One of the labeled primers is complementary to one of the alleles, and in the case of the presence of another allele, an unpaired base forms, which changes the melting point of the duplex. The melting point is fixed by the appearance of fluorescence.

A close approach to this approach is to measure the melting point of small amplicons (10). With an amplicon size of about 50 bp a change in one nucleotide will lead to a change in the melting point of the amplicon by 0.4-1.4 ° C. This approach does not require the use of fluorescently-labeled primers or probes (SYBR-Green or LCGreen intercalating dye is used), however, high-resolution equipment is required to detect small changes in the melting temperature.

The resonance fluorescence energy transfer also underlies TaqMan systems for determining single nucleotide substitutions (11). However, in this case, both fluorophores are located on the same probe, complementary to the middle part of the amplified fragment. When Taq polymerase destroys it during the PCR reaction due to exonuclease activity coupled with DNA synthesis, the fluorescent group goes into solution and moves away from the quencher. Using two allele-specific probes with different fluorescent labels, it is possible to reliably distinguish between homo and heterozygotes.

The above methods, having a number of advantages, also require special equipment (thermal cyclers with the ability to detect fluorescence in real time), as well as fluorescence-labeled primers or probes.

Allele-specific PCR (AS-PCR), which is based on the use of primers that specifically bind either to the normal or mutant variant of the gene, followed by the detection of the result either electrophoretically (12) or by chromatography (13) or by fluorescence detection, received wide distribution in the genetic diagnosis of these mutations. However, unfortunately, this approach is characterized by a high level of false-positive results due to non-specific hybridization of the primer, which often manifests itself when changing the brand of thermal cycler. Improving the specificity of the reaction by changing the structures of the primers and the amplification conditions often does not give the desired result.

Well-developed and widely used methods of restriction analysis (RA) have such advantages as simplicity and cost-effectiveness (expensive equipment and reagents are not used), as well as high accuracy in the determination of single nucleotide substitutions. However, this method requires post-amplification treatment with restriction endonuclease and analysis of the length of the obtained fragments, which increases the risk of contamination. Detection of the results is carried out both electrophoretically (14) and using fluorescence detection (15).

Another method using enzymatic processing is the method of invasive cleavage of an oligonucleotide probe with a Flap-endonuclease that recognizes cross-sections of DNA (16). The use of thermostable Flap-endonucleases allows the reaction to be carried out at a temperature close to the annealing temperature of the oligonucleotides, which allows multiple hybridization-denaturation and, accordingly, signal amplification (fluorescence). This approach is very sensitive and allows you to distinguish between homo- and heterozygotes without amplification directly on genomic DNA.

The closest prototype to the claimed method is a method for diagnosing a hereditary predisposition to thrombophilia by detecting C677 → T mutations in the human gene (MTHF), G1691 → A in the human coagulation factor V gene (FV) and G20210 → A in the human prothrombin gene (FII) including amplification of regions of MTHFR, V coagulation factor (FV) and prothrombin (FII) genes by polymerase chain reaction, followed by processing of the amplification fragments with MnlI restriction endonuclease and determining the size fragments by electrophoresis (14). It combines the simplicity of the methods based on PCR-RFLP analysis and the high accuracy of determination of single nucleotide substitutions, however, the use of the expensive and unstable restriction endonuclease MnlI (Sibenzyme, Novosibirsk: 500 U - 1400 rubles) makes this method quite expensive and difficult implemented in Russia.

An object of the invention is to simplify, reduce the cost of the method and increase its reliability while maintaining high accuracy in the diagnosis of hereditary predisposition to thrombophilia.

The stated technical problem is achieved by conducting DNA testing of three polymorphic loci at once (C677 → T in the human methylenetetrahydrofolate reductase (MTHFR) gene, G1691 → A in the human coagulability factor V gene (Leiden mutation) and G20210 → A in the human prothrombin gene) associated with a hereditary predisposition to thrombophilia using specially selected primers and cheap and stable restriction endonuclease.

The proposed method consists in the fact that the analyzed genomic DNA is subjected to PCR amplification using three pairs of primers simultaneously, each of which limits a portion of the gene including one of the variable nucleotides, subsequent restriction of the amplification products using TaqI restriction endonuclease, determining the size of the obtained DNA fragments with by electrophoresis and the identification of polymorphic substitutions C677 → T in the human methylenetetrahydrofolate reductase (MTHFR) gene, G1691 → A in the human coagulation factor V gene V (Leydenovskaya mutation) and G20210 → A in the gene for human prothrombin obtained determination results. The analysis takes 5 hours of working time.

Used oligonucleotide primers are presented in table 1.

Table 1 Gene Direct primer Reverse primer MTGFR gttaccccaaaggccaccc ggaagaatgtgtcagcctcgaag Fv gtaagagcagatccctggacagtc gcagtgatggtactgataaaaatcg Fii ggttcccaataaaagtgactctcatc catctttaatgcctgtaaattcgac

The proposed method is applicable to human DNA samples isolated from different sources (whole blood, buccal epithelium, biopsy samples) and in various ways (phenol-chloroform extraction, sorption on silica gel, thermocoagulation and DNA condensation). Timely diagnosis of C677 → T mutations in the human methylenetetrahydrofolate reductase (MTHFR) gene, G1691 → A in the human blood coagulation factor V gene (Leiden mutation) and G20210 → A in the human prothrombin gene allows predicting the development of thrombophilic conditions and timely antithrombotic therapy .

The determining differences of the proposed method in comparison with the prototype are:

1. As primers, oligonucleotide probes are used that are complementary to regions of the MTHFR, V coagulation factor and human prothrombin V genes, which are selected so that a restriction endonuclease recognition site is introduced that would be impaired if there was an appropriate polymorphic substitution. Moreover, restriction endonuclease recognition sites were added to the primer structures that do not affect polymorphic substitutions and thus serve as an internal control of the completeness of the passage of restriction for each of the above loci.

2. As an enzyme, a cheap and stable TaqI restriction endonuclease is used (Sibenzym, Novosibirsk: 2000 U - 180 rubles), which makes it possible to reduce the cost of the method and simplify it due to the possibility of this enzyme working at 65 ° С under paraffin. This allows amplification and restriction reactions to be performed in a single tube. Also, this enzyme does not lose its activity when stored at 0 ° C for 2 days, which makes it possible to transport it in ice to any regions of Russia without loss of quality of work.

The invention is illustrated by the following specific examples of the method.

Example 1

Patient genomic DNA was isolated from peripheral blood using protein kinase K and phenol / chloroform extraction.

The primers were selected using the VectorNTI and GeneRunner computer programs and synthesized in the SORAN Institute of Chemistry and Biophysics, Novosibirsk (Table 1).

The mixture for PCR amplification with a volume of 15 μl consisted of 7.5 μl of the “lower mixture” and 7.5 μl of the “upper mixture” separated by a septum from the wax. Each of the mixtures was prepared previously in the amount necessary for the analysis of all samples, based on the following calculation of the components for one sample.

The composition of the lower mixture for one sample (volume 7.5 μl):

- 1.5 μl of a solution containing:

30 pmol FV direct primer (FV-Taq-U),

30 pmol FV reverse primer (FV-Taq-R),

30 pmol FII direct primer (FII-Taq-U),

30 pmol FII reverse primer (FII-Taq-R),

10 pmol MTGFR direct primer (MTGFR-Taq-U),

10 pmol MTGFR reverse primer (MTGFR-Taq-R),

- 1.5 μl of 2 mm dNTP solution and

- 4.5 μl of H2O.

The composition of the upper mixture for one sample (volume 4.5 μl):

- 2.9 μl of H ₂ O;

- 0.1 μl of a solution of Taq polymerase with a concentration of 10 U / μl (1U);

- 1.5 μl of 10x buffer of the following composition: 670 mm TrisHCl, pH 8.3; 160 mM (NH ₄ ) 2SO ₄ ; 35 mM MgCl ₂ ; 0.1% tween-20;

In the tubes containing the upper and lower mixtures separated by a wax septum, 3 μl of the analyzed DNA was added and the tubes were placed in the Tertsik thermal cycler of DNA-Technology company.

The polymerase chain reaction was started as a result of combining the upper and lower mixture after melting the wax septum when the sample was heated at the stage of initial denaturation (receiving a “hot start”).

Amplification mode: initial denaturation at 95 ° С - 3 min 30 s; then 38 cycles, each of which consisted of denaturation of 5 s at 95 ° C; annealing - 5 s at 64 ° С and elongation - 12 s at 72 ° С.

Restriction analysis was performed in a volume of 20 μl. The composition of the reaction mixture:

- 2 μl of 10x restriction endonuclease buffer Y + / Tango (33 mM Tris acetate (pH 7.9 at 37 ° C), 10 mM magnesium acetate, 66 mM potassium acetate)

- 3 μl H ₂ O

- 1 unit restriction endonuclease TaqI activity

- 15 μl of PCR product.

Reaction conditions: 65 ° C for 2-12 hours

The separation of restriction products was carried out by electrophoretic separation of DNA fragments in 7% polyacrylamide gel (PAAG) at a voltage of 10-12 V / cm. The restriction products were detected in ultraviolet light after staining with ethidium bromide. The lengths of the restriction products are presented in table.2.

table 2 Gene The length of the PCR product, bp Fragment lengths after restriction, bp Fv 233 G / g G / a A / a G1691 → A 185 + 25 + 23 208 + 185 + 25 + 23 208 + 25 Fii 320 G / g G / a A / a G20210 → A 274 + 25 + 21 299 + 274 + 25 + 21 299 + 21 MTGFR 126 S677 → T 106 + 20 106 + 79 + 27 + 20 79 + 27 + 20

An analysis of Table 2 shows that with complete passage of the restriction, amplification fragments of the initial length should be absent in the restriction mixture (in the electrophoresis picture). This is due to the presence of non-polymorphic restriction endonuclease recognition sites introduced into all amplification products by oligonucleotide primers. Thus, in the proposed method there is an internal control of the completeness of passage of restriction for each of the above loci.

The drawing shows the result of the detection of polymorphic substitutions C677 → T in the human methylene tetrahydrofolate reductase (MTHFR) gene for the examined individuals, G1691 → A in the human coagulation factor V gene (Leiden mutation) and G20210 → A in the human prothrombin gene. It can be seen from the drawing that as a result of amplification, three DNA products are generated at once that contain sections of the FII, FV, and MTHFR genes, the restriction reaction is complete, different DNA samples of the examined individuals have a different genotype, which can be determined by the length of the DNA fragments according to Table 2.

The correctness of the determination of polymorphic substitutions of C677 → T in the human methylenetetrahydrofolate reductase (MTHFR) gene, G1691 → A in the human coagulability factor V gene (Leiden mutation) and G20210 → A in the human prothrombin gene was independently confirmed by the claimed method by direct sequencing. For this, DNA samples were selected whose genotype was previously determined by direct sequencing. According to the results of testing 22 DNA samples using the developed method, the percentage of erroneous determinations was 0%. Thus, the results of the analysis performed using the proposed method and using direct sequencing, completely coincide.

Example 2

A study was made of the population frequency of C677 → T polymorphic loci in the human methylenetetrahydrofolate reductase (MTHFR) gene, G1691 → A in the human coagulation factor V gene (Leiden mutation), and G20210 → A in the human prothrombin gene in healthy donors, as in Example 1. Genotype frequencies all three polymorphic substitutions are given in table.3. The established distribution of genotypes corresponded to the Hardy-Weinberg equation.

Table 3. Gene Polymorphic locus The number of samples studied Genotype Frequency (n) w / w w / m m / m MTGFR S677T 338 157 151 thirty Fv G1691 → A 199 189 10 0 Fii G20210A 200 192 8 0

From the analysis of Table 3, we can conclude that heterozygous carriers of the T allele of the C677 → T polymorphic locus in the human MTHF gene are found at a frequency of 0.446, the A allele of the G1691 → A polymorphic loci in the FV gene and G20210 → A in the human FII gene with a frequency of 0, 05 and 0.04, respectively. Homozygous carriage of the T allele of the C677 → T polymorphic locus in the human MTHF gene is found in the Russian population with a frequency of 0.088, homozygous for the A allele A of the G1691 → A polymorphic loci in the FV gene and G20210 → A in the human FII gene was not found among healthy donors.

Given the reliability and simplicity of determining the polymorphic substitutions of C677 → T in the human methylenetetrahydrofolate reductase (MTHFR) gene, G1691 → A in the human coagulation factor V gene (Leiden mutation) and G20210 → A in the human prothrombin gene using the proposed method, this DNA test appears very promising when establishing a hereditary predisposition to thrombophilia, expressed in increased ability to form blood clots in the presence of additional risk factors: pregnancy, taking hormonal contraceptives s, increasing homocysteine, antiphospholipid antibodies, etc. If, after carrying out the proposed method of DNA testing, one or more mutations are detected in a person, then this person has a risk of developing thrombotic conditions, shown in Table 4, respectively.

Table 4 Category Risk Genotype The frequency of occurrence of the genotype among the studied samples S677 → T MTGFR G1691 → A V factor G20210 → A prothrombin 0 no risk SS Gg Gg 1304 one low risk ST Gg Gg 1046 2 moderate risk TT Gg Gg 238 SS GA Gg 54 CC Gg GA 33 3 high risk CC / CT GA GA 3 CC / CT Gg AA 0 CC / CT AA Gg one TT GA Gg 9 TT Gg GA 8 four very high risk TT GA GA one TT AA Gg 0 TT Gg AA 0

From table 4 it is seen that persons with moderate and high risk (categories 2, 3 and 4), the percentage of which in the studied samples was 14.6, it is recommended that additional antithrombotic prophylaxis in conditions associated with pregnancy, surgical interventions, as well as caution when prescribing drugs related to strengthening the blood coagulation system. The risk of developing thrombosis in other individuals (categories 0 and 1) is slightly higher than the population average, therefore, we can assume that no special diagnostic and therapeutic measures are required.

The method described in the present invention is completely ready for direct use in medical practice. Using the proposed method, an analysis of the genetic predisposition to the development of thrombophilia in 2753 people was carried out. A heterozygous carriage of the T allele of the C677 → T polymorphic locus in the methylene tetrahydrofolate reductase (MTHFR) gene was detected in 1103 people, and 256 people were homozygotes for this allele. According to the polymorphic substitution G1691 → A, 97 heterozygous carriers and 1 person homozygous for this mutation were found in the V gene of the human blood coagulation factor (Leiden mutation). By the polymorphic substitution G20210 → A in the prothrombin gene, 71 people were heterozygous carriers (no homozygotes were found).

Thus, an improved method for the genotyping of C677 → T polymorphic loci in the human methylenetetrahydrofolate reductase (MTHFR) gene, G1691 → A in the human blood coagulation factor V gene (Leiden mutation), and G20210 → A in the human prothrombin gene using PCR-RFLP analysis was proposed. differs in lower prime cost and high reliability in comparison with the closest analogue.

Claims (1)

A method for the diagnosis of a hereditary predisposition to thrombophilia, including DNA isolation, amplification of portions of the human MTHFR, V coagulation factor (FV) and prothrombin (FII) genes by polymerase chain reaction using primers, processing of the amplification fragments with restriction endonuclease and determining the size of the obtained fragments using electrophoresis, characterized in that TaqI restriction endonuclease is used as the enzyme, and the analyzed DNA is subjected to PCR amplification using vaniem while three pairs of specially selected primers:
- for the gene MTGFR:
Direct GTTACCCCAAAGGCCACCC,
Reverse GGAAGAATGTGTCAGCCTCGAAG
- for the FV gene:
Direct GTAAGAGCAGATCCCTGGACAGTC,
Reverse GCAGTGATGGTACTGATAAAAATCG;
- for the FII gene:
Direct GGTTCCCAATAAAAGTGACTCTCATC,
The reverse is CATCTTTAATGCCTGTAAATTCGAC, and when C677 → T polymorphic substitutions are detected in the MTHF gene, G1691 → A in the FV gene and G20210 → A in the FII gene, a hereditary predisposition to thrombophilia is diagnosed.