CN116694748A - Gene polymorphism primer composition, detection kit and detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect - Google Patents

Gene polymorphism primer composition, detection kit and detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect Download PDF

Info

Publication number
CN116694748A
CN116694748A CN202310052507.0A CN202310052507A CN116694748A CN 116694748 A CN116694748 A CN 116694748A CN 202310052507 A CN202310052507 A CN 202310052507A CN 116694748 A CN116694748 A CN 116694748A
Authority
CN
China
Prior art keywords
gene
early warning
rocuronium bromide
primer
equal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310052507.0A
Other languages
Chinese (zh)
Inventor
刘明周
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan Provincial Peoples Hospital
Original Assignee
Henan Provincial Peoples Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan Provincial Peoples Hospital filed Critical Henan Provincial Peoples Hospital
Priority to CN202310052507.0A priority Critical patent/CN116694748A/en
Publication of CN116694748A publication Critical patent/CN116694748A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of personalized medicine gene detection, and particularly relates to a gene polymorphism primer composition, a detection kit and a detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect, wherein the primer composition comprisesSLCO1A2Amplification primer at rs7967354 site,SLCO1A2The rs11045995 locus amplification primer and the sequencing primer are key components of the detection kit, can ensure no cross interference during multiplex PCR reaction, and simultaneously generate two amplification products, namelySLCO1A2rs7967354 polymorphic site amplification products 83bp andSLCO1A2rs11045995 polymorphic site amplification primerObject 149 bp; the pyrophosphoric acid sequencing technology related to the detection method is a novel nucleic acid sequence analysis technology based on real-time reaction and sequencing-by-synthesis, and has the advantages of simplicity and convenience in operation, low detection cost, rapidness, accuracy, high-throughput detection, no need of operations such as fluorescent labeling, electrophoresis analysis and the like, and good application value in the aspect of rocuronium bromide adverse reaction early warning.

Description

Gene polymorphism primer composition, detection kit and detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect
Technical Field
The invention belongs to the technical field of personalized medicine gene detection, and particularly relates to a gene polymorphism primer composition, a detection kit and a detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect.
Background
Rocuronium bromide (Rocuronium Bromide) is the non-depolarizing muscle relaxant with the most widely applied clinical perioperative anesthesia induction, and can block the normal transmission of neuromuscular excitation information by acting on the acetylcholine receptor of the neuromuscular junction to generate the function of relaxing skeletal muscle, and has the advantages of quick effect, short duration of muscle relaxation, quick recovery, better cardiovascular system stability and the like [1] 。
However, rocuronium bromide also brings hidden danger of residual muscle relaxation blocking effect while meeting the needs of tracheal intubation and surgery, and the residual muscle relaxation blocking effect is a common adverse event generated in the use process of rocuronium bromide, so that a patient can have residual neuromuscular blocking effect after surgery Bi Bachu tracheal catheter, and the patient can feel uncomfortable subjectively, such as: uncomfortable symptoms such as debilitation, compound vision and the like, and a series of pulmonary complications such as respiratory muscle debilitation, hypoxia, reflux aspiration and the like.
In addition, studies have shown that the residual blocking effect of muscle relaxation is a major cause of death in different types of surgery and can lead to undesirable outcomes such as prolonged ICU residence time, readmission, prolonged post-operative hospitalization and increased costs [2] . Even in the more common United states and Canada countries where monitoring of the residual blocking effect of muscular relaxations is carried out, the incidence rate of the residual blocking effect of muscular relaxations reaches 64.7% during the post-operative extubation [3] And 63.5% [4] Indicating that the use of quantitative neuromuscular monitoring alone and of a muscle-relaxing antagonist does not completely avoid the onset of residual blocking effects of rocuronium bromide.
In summary, the existing clinical early warning scheme for the residual blocking effect of rocuronium bromide lacks objective and quantitative, and the residual blocking effect of muscle relaxation is hidden frequently, so that adverse effects are brought to patients and medical burden is increased, and therefore the early warning for the residual blocking effect of rocuronium bromide, and the clinical safe medication of rocuronium bromide is still very important.
Drug transporters are a special transporter system existing in biological membranes and can mediate drug transmembrane transport, and play a vital role in drug target tissue distribution and in-vivo treatment processes. The presence of multiple single nucleotide polymorphisms in drug transporters can lead to alterations in drug distribution, metabolism and excretion, which are important causes of inter-individual variability in drug exposure.
The OATP1A2 protein encoded by the SLCO1A2 (Solute carrier organic anion transporter family member A2) gene is an OATPs family member located on chromosome 12 and mediates the transport of a variety of endogenous and exogenous drugs. Rocuronium bromide is one of the substrates for OATP1A2 [5] . Research shows that [6] The SLCO1A2 gene has single nucleotide polymorphisms (rs 7967354 and rs 11045995). The single nucleotide polymorphism is obviously related to the dosage requirement of the breast cancer operation patient on rocuronium bromide, and the gene mutation can weaken the transfer function of the transporter, reduce the plasma clearance rate of rocuronium bromide and prolong the action time of rocuronium bromide. Patient populations carrying these gene mutation sites may be at risk for residual blocking of muscle relaxation. Currently, the degree of elimination of the muscle relaxant effect is estimated by clinical signs and experience to be not completely accurate, and the hidden danger of the blocking effect of the muscle relaxant residue exists in the fashion of removing the tracheal catheter. The drug gene polymorphism detection can predict the drug curative effect, estimate the initial drug dosage, guide and adjust the drug administration scheme and prevent the occurrence of adverse drug reaction according to the genotype characteristics of different patients, thereby achieving better clinical effect [7] 。
The method for detecting the polymorphic site of the drug gene can be clinically used and comprises a Sanger sequencing method, a gene chip method, a real-time fluorescent quantitative PCR method, a common PCR combined electrophoresis analysis and other detection methods, but the methods have the problems of insufficient sensitivity, time consumption, cross contamination, incapability of high-throughput detection, high cost and the like. At present, the published literature is searched, and the fact that only a multiplex PCR amplification method is adopted to detect gene mutation sites related to rocuronium bromide drug is found, wherein the multiplex PCR technology is an amplification technology improved on the basis of conventional PCR, more than two pairs of primers are added into the same reaction system, so that a plurality of nucleic acid fragments are amplified, and the defect that only one pair of primers can be used for amplifying one nucleic acid fragment in conventional PCR is overcome. However, the experimental design of multiple PCR is more complex than that of single PCR, so that the optimized detection programs obtained by different researches have no universality, the applicability and the result reliability of the multiple PCR are greatly reduced, and the clinical application and popularization range of the multiple PCR are limited.
Reference is made to:
[1]Stauble C G,Blobner M.The future of neuromuscular blocking agents[J].Curr Opin Anaesthesiol.2020,33(4):490-498.
[2]Rahmanian P B,A,Langebartels G,et al.Impact of major non-cardiac complications on outcome following cardiac surgery procedures:logistic regression analysis in a very recent patient cohort.[J].Interactive cardiovascular and thoracic surgery.2013,17(2).
[3]Saager L,Maiese E M,Bash L D,et al.Incidence,risk factors,and conSequences of residual neuromuscular block in the United States:The prospective,observational,multicenter RECITE-US study[J].J Clin Anesth.2019,55:33-41.
[4]Fortier L P,Mckeen D,Turner K,et al.The RECITE Study:A Canadian Prospective,Multicenter Study of the Incidence and Severity of Residual Neuromuscular Blockade[J].Anesth Analg.2015,121(2):366-372.
[5]Fujino H,Saito T,Ogawa S,et al.Transporter-mediated influx and efflux mechanisms of pitavastatin,a new inhibitor of HMG-CoA reductase[J].J Pharm Pharmacol.2005,57(10):1305-1311.
[6]Ahlstrom S,Bergman P,Jokela R,et al.First genome-wide association study on rocuronium dose requirements shows association with SLCO1A2[J].Br J Anaesth.2021,126(5):949-957.
[7] medicine metabolism enzyme and medicine action target gene detection technical guideline (trial) outline [ J ]. Practical organ transplantation electronic journal 2015,3 (05): 257-267.
Disclosure of Invention
The invention aims to provide a primer composition, a detection kit and a detection method for detecting rocuronium bromide residual blocking effect early warning gene polymorphism, and aims to guide the establishment of a personalized rocuronium bromide dosing scheme and the adjustment of dosing amount in clinical practice, promote the rational dosing of rocuronium bromide and prevent the occurrence of adverse drug reactions such as muscle relaxation residual blocking effect.
In order to solve the technical problems, the invention adopts the following technical scheme:
the primer composition can amplify 2 SNP loci of an SLCO1A2 gene in the same PCR system, and the primer composition comprises the following components:
(1) Forward amplification primer (SEQ ID No. l) for rs7967354 locus of SLCO1A2 gene:
5’-CAGTGATTGGATTTAAGCCTATG-3’；
(2) Reverse amplification primer (SEQ ID NO. 2) for rs7967354 locus of SLCO1A2 gene:
5’-TTTGCAAATAGAGCATTTACAAG-3’；
(3) Forward amplification primer for rs11045995 locus of SLCO1A2 gene (SEQ ID NO. 4):
5’-AGACCAGAGCCACTAAATCATTTC-3’；
(4) Reverse amplification primer for rs11045995 locus of SLCO1A2 gene (SEQ ID NO. 5):
5’-TGGGAGGACTCTTCAGGATAAA-3’。
preferably, the primer composition further comprises the following sequencing primers:
(1) The rs7967354 locus sequencing primer (SEQ ID NO. 3) of the SLCO1A2 gene:
5’-GATTGGATTTAAGCCTATG-3’；
(2) Rs11045995 locus sequencing primer of SLCO1A2 gene (SEQ ID NO. 6):
5’-CATTTTAAAGACTTCTGAGC-3’。
preferably, the forward amplification primer of the rs7967354 locus of the SLCO1A2 gene and the 5' end of the forward amplification primer of the rs11045995 locus of the SLCO1A2 gene are respectively subjected to biotin labeling.
The invention also provides a gene polymorphism detection kit applied to the early warning of the rocuronium bromide myorelaxer residual blocking effect, which comprises the gene polymorphism primer composition applied to the early warning of the rocuronium bromide myorelaxer residual blocking effect, a multiplex PCR amplification reaction reagent, a pyrosequencing reagent and a kit body, wherein the gene polymorphism primer composition applied to the early warning of the rocuronium bromide myorelaxer residual blocking effect, the multiplex PCR amplification reaction reagent and the pyrosequencing reagent are arranged in the kit body.
Preferably, the multiplex PCR amplification reaction reagent adopts a pyrophosphoric acid sequencing PCR kitPCR Kit, main component PyroMark PCR Master Mix (2×), comprising: hot start Taq DNA polymerase, deoxyribonucleoside triphosphates dNTPs, mgCl 2 (3 mM); other components include: amplification reaction specificity enhancer Q-solutions (5×), coralLoad Concentrate (10×);
preferably, the pyrosequencing reagent comprises: pyroMark annealing buffer; a DNA polymerase including ATP sulfurylase, luciferase, apyrase, and apyrase required for pyrosequencing; a substrate complex, the substrate complex being adenosine-5' -phosphosulfuric anhydride; deoxynucleotide triphosphate complex dNTP, which is artificially modified alpha-thiodeoxyadenosine triphosphate; deoxycytidine triphosphate, deoxyguanosine triphosphate and deoxythymidine triphosphate are unmodified;
preferably, a blank reference substance is also arranged in the kit body, and the blank reference substance is sterilized distilled water.
The invention also provides a gene polymorphism detection method applied to the early warning of the residual blocking effect of rocuronium bromide muscular relaxations, which adopts the gene polymorphism detection kit applied to the early warning of the residual blocking effect of rocuronium bromide muscular relaxations, and comprises the following steps:
(1) Human DNA extraction: firstly, red blood cells without DNA are removed by red blood cell lysate pyrolysis, white blood cells are released by cell nucleus lysate pyrolysis, then, protein is removed by selective precipitation of protein precipitation liquid, the genome DNA in a reversible adsorption system of a silica gel membrane column is digested by protease, impurities such as protein, lipid and the like are removed by rinsing liquid, and pure human whole blood genome DNA is obtained by eluting with purified liquid;
(2) PCR amplification reaction: the primer composition and the multiplex PCR amplification reaction reagent which are applied to the detection kit of the gene polymorphism for early warning of the rocuronium bromide myorelaxant residual blocking effect are adopted, wherein the reaction system and the reaction conditions are shown in the table 1 and the table 2:
TABLE 1 multiplex PCR amplification reaction System (25. Mu.L)
TABLE 2 multiplex PCR amplification reaction conditions
(3) Single-stranded DNA sample separation and purification;
(4) Pyrosequencing and results analysis.
Preferably, the single-stranded DNA isolation and purification reagent required for the step (3) includes: streptavidin; pyroMark binding buffer; pyroMark denaturing solution; pyroMark elution buffer (10×) was concentrated; the operation content of the step mainly comprises: under the condition of pyroMark binding buffer solution, the streptavidin is combined with the PCR product with biotin to separate single-stranded DNA products, and then the single-stranded DNA products are treated by 68-73% ethanol, pyroMark eluting buffer solution and pyroMark denaturing solution respectively to obtain purified single-stranded DNA samples.
Preferably, the step (4) adopts a sequencing primer and a pyrosequencing reagent in the gene polymorphism detection kit applied to the early warning of rocuronium bromide myorelaxer residual blocking effect; the method specifically comprises the following steps: diluting the SLCO1A2rs7967354 site sequencing primer and the SLCO1A2rs11045995 site sequencing primer by using a pyroMark annealing buffer solution, and then placing the diluted single-stranded DNA products; continuously heating at 78-82 ℃ for 1.5-2.5min, cooling at 16-23 ℃ for 5-8min, simultaneously adding enzyme complex, substrate complex and four deoxyribonucleoside triphosphates with required volumes into a reagent bin, then running a sequencing program on a special instrument, and finally performing result analysis on special analysis software after sequencing is finished;
wherein, in the pyrosequencing result:
in the DNA sequencing peak diagram of SLCO1A2rs7967354, if the frequency of cytosine C is more than or equal to 90% and the frequency of thymine T is less than or equal to 10%, the SLCO1A2rs7967354 is considered to be wild type; if the frequency of cytosine C is less than or equal to 40 percent and less than or equal to 60 percent and the frequency of thymine T is less than or equal to 40 percent and less than or equal to 60 percent, SLCO1A2rs7967354 is considered to be mutation heterozygous; if the frequency of thymine T is more than or equal to 90% and the frequency of cytosine C is less than or equal to 10%, SLCO1A2rs7967354 is considered to be mutation homozygosity.
For a DNA sequencing peak diagram of SLCO1A2rs11045995, if the frequency of adenine A is more than or equal to 90 percent and the frequency of guanine G is less than or equal to 10 percent, the SLCO1A2rs11045995 is considered to be wild type; if the frequency of adenine A is less than or equal to 40% and less than or equal to 60%, the frequency of guanine G is less than or equal to 40% and less than or equal to 60%, namely SLCO1A2rs11045995 is considered to be mutation heterozygous; if the frequency of guanine G is more than or equal to 90% and the frequency of adenine A is less than or equal to 10%, SLCO1A2rs11045995 is considered to be mutation homozygosity.
Compared with the prior art, the invention has the beneficial effects that:
1. the gene polymorphism primer composition applied to the early warning of rocuronium bromide myorelaxant residual blocking effect comprises an SLCO1A2rs7967354 locus amplification primer (SEQ ID NO. l-SEQ ID NO. 2), a sequencing primer (SEQ ID NO. 3) and an SLCO1A2rs11045995 locus amplification primer (SEQ ID NO. 4-SEQ ID NO. 5) and a sequencing primer (SEQ ID NO. 6), is a key component of the detection kit, has good specificity, can ensure no cross interference during multiple PCR reaction, and simultaneously generates two amplification products, namely 83bp of SLCO1A2rs7967354 polymorphism locus genotype amplification products and 149bp of SLCO1A2rs11045995 polymorphism locus genes.
2. The detection method adopted by the invention can accurately sequence the SLCO1A2rs7967354 wild type sequence (SEQ ID NO. 7) GCAATCCAGTATAACCACATTTAACTT and the mutant sequence (SEQ ID NO. 8) GTAATCCAGTATAACCACATTTAACTT, and the SLCO1A2rs11045995 wild type sequence TATATAGACAAATTCTACTCTATAAAG (SEQ ID NO. 9) and the mutant sequence TGTATAGACAAATTCTACTCTATAAAG (SEQ ID NO. 10).
3. The detection kit integrates all reagent components from target gene polymorphic locus amplification to pyrosequencing key steps, and is beneficial to subsequent commercial production and clinical application and popularization.
4. The pyrophosphoric acid sequencing technology is a novel nucleic acid sequence analysis technology based on real-time reaction and sequencing-by-synthesis, is a novel enzyme-linked cascade sequencing technology, is suitable for sequencing analysis of known short sequences, has repeatability and accuracy comparable to those of the existing Sanger DNA (deoxyribonucleic acid) sequencing methods, greatly improves the detection speed, simultaneously has the capability of sequencing analysis of a large number of samples, and is suitable for large-flux, low-cost, timely, rapid and visual single nucleotide polymorphism research and clinical examination. The technology is simple and convenient to operate, does not need operations such as fluorescent labeling, electrophoresis analysis and the like, and has good application value in the aspect of clinical rational drug related gene detection.
The technical guidelines for detecting drug metabolizing enzyme and drug action target gene (test run) issued by the state Wei Jian Committee emphasizes that a performance verification standard should be established for each detection system before the conventional clinical practice is introduced, but no research report on a kit and a detection method for detecting SLCO1A2 gene single nucleotide polymorphism (rs 7967354 and rs 11045995) by a pyrosequencing method exists at present. The detection kit for the polymorphism of the rocuronium bromide personalized medicine gene is designed and verified based on the pyrophosphoric acid sequencing technology, so that the kit has the advantages of accurate quality, high sensitivity and strong specificity when detecting SLCO1A2rs11045995 and rs7967354 gene polymorphism; in addition, the method has the advantage of directly giving out frequency analysis of the detection sites and intuitive results.
5. The method can be applied to clinically guiding patients needing anesthesia induction in the perioperative period to reasonably select rocuronium bromide and the treatment dosage thereof according to the genotype of individuals, is beneficial to optimizing individual treatment schemes, and can screen and early warn the patients possibly developing the risk of granulation promoting pine residue blocking, so that the medication safety is ensured.
Meanwhile, the invention provides the early warning of human rocuronium bromide muscle relaxation residual blocking effect by utilizing the single target gene double-site gene polymorphism on the basis of a large sample clinical test for the first time, and compared with the early warning mechanism of multiple gene multi-mutation sites, the early warning mechanism has more specificity, can greatly reduce the treatment cost of patients, and is more beneficial to clinical popularization. The gene polymorphism kit for detecting early warning of human rocuronium bromide residual blocking effect based on the pyrosequencing method and the detection method thereof fill the blank of the drug gene polymorphism detection technology in the field of rocuronium bromide adverse reaction early warning, provide reference for clinical rocuronium bromide safe medication guidance, and greatly ensure the rights and interests of patients.
Drawings
The accompanying drawings are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate the invention and together with the embodiments of the invention, serve to explain the invention. In the drawings:
FIG. 1 is a schematic diagram of the structure of a kit body in an embodiment of the invention for detecting gene polymorphism applied to early warning of rocuronium bromide myorelaxer residual blocking.
FIG. 2 is a gel electrophoresis chart of seven random samples SLCO1A2rs7967354 polymorphic site PCR amplified products in an embodiment of the method for detecting gene polymorphism applied to early warning of rocuronium bromide muscle relaxation residual blocking effect.
FIG. 3 is a gel electrophoresis chart of seven random samples SLCO1A2rs11045995 polymorphic site PCR amplified products in an embodiment of the method for detecting gene polymorphism applied to early warning of rocuronium bromide muscle relaxation residual blocking effect.
FIG. 4 is a diagram showing the result of sequencing a typical SLCO1A2rs7967354 homozygous mutant pyrophosphate in an embodiment of the method for detecting a gene polymorphism applied to early warning of residual blocking of rocuronium bromide in accordance with the present invention.
FIG. 5 is a diagram showing the result of sequencing a typical SLCO1A2rs7967354 heterozygous mutant pyrophosphate in an embodiment of a method for detecting a gene polymorphism applied to early warning of residual blocking of rocuronium bromide.
FIG. 6 is a diagram showing a typical result of SLCO1A2rs11045995 wild-type pyrophosphate sequencing in an embodiment of the method for detecting a gene polymorphism applied to early warning of rocuronium bromide myorelaxer resistance according to the present invention.
FIG. 7 is a diagram showing the result of sequencing a typical SLCO1A2rs11045995 heterozygous mutant pyrophosphate in an embodiment of the method for detecting a gene polymorphism applied to early warning of residual blocking effect of rocuronium bromide.
Detailed Description
The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
In one embodiment, a gene polymorphism detection kit for rocuronium bromide myorelaxant residual blocking effect early warning is provided.
Referring to fig. 1, the gene polymorphism detection kit applied to early warning of rocuronium bromide myorelaxer residual blocking effect provided by the invention is provided with a primer group and a reagent required by key steps such as target gene mutation site multiplex PCR amplification, pyrosequencing and the like, and specifically comprises the following steps: 1.SLCO1A2 rs7967354 forward amplification primer (SEQ ID NO. l); 2.SLCO1A2 rs7967354 reverse amplification primer (SEQ ID NO. 2); 3.SLCO1A2 rs7967354 site sequencing primer (SEQ ID NO. 3); 4.SLCO1A2 rs11045995 forward amplification primer (SEQ ID NO. 4); 5.SLCO1A2 rs11045995 reverse amplification primer (SEQ ID NO. 5); 6.SLCO1A2 rs11045995 site sequencing primer (SEQ ID NO. 6); 7.PyroMark PCR Master Mix (2×); 8.Q-Solution (5×); 9.CoralLoad Concentrate (10×); pyroMark annealing buffer; DNA polymerase; 12. a substrate complex; 13. deoxynucleotide triphosphate complex dNTPs. 14. Nuclease-free water; 15. negative control reagent.
PyroMark PCR Master Mix (pyrosequencing PCR kit), Q-Solution (amplification reaction specificity enhancer), coralLoad Concentrate, pyroMark annealing buffer, DNA polymerase (all enzymes needed by pyrosequencing specifically include ATP sulfurylase, luciferase and apyrase), substrate complex (adenosine 5' -phosphosulfuric anhydride), deoxynucleotide triphosphate complex dNTP (wherein dNTP is artificially modified alpha-thiodeoxyadenosine triphosphate, and the rest deoxycytidine triphosphate, deoxyguanosine triphosphate and deoxythymidine triphosphate are not modified) all adopt reagents produced by QIAGEN company of Germany. The negative control reagent is blank control, and sterilized distilled water is adopted.
All primers and reagents of the detection kit are respectively arranged in test tubes 3 shown in fig. 1, each test tube 3 is arranged in a box body 1, a foam block 2 is arranged in the box body 1, the foam block 2 fills up the inner space of the box body 1, 15 jacks 21 are arranged on the foam block 2, each jack 21 can be inserted with one test tube 3, the upper 15 reagents are respectively arranged in different test tubes, and a label area 11 is arranged on the side face of the box body 1 and used for labeling to mark each reagent name.
The design of the gene polymorphism detection kit applied to the early warning of rocuronium bromide myorelaxant residual blocking effect comprises the following steps:
1. designing and synthesizing a primer: designing primers aiming at single nucleotide polymorphism sites detected by a human SLCO1A2 gene, namely rs7967354 and rs11045995 sites, using PyroMark Assay Design SW 2.0 software to design primers, including target gene single nucleotide polymorphism site amplification primers and sequencing primers, using Primer 5 software to analyze Tm value and secondary structure of the primers, optimizing the primers, synthesizing all primers according to design results, purifying the synthesized primers by denaturing polyacrylamide gel electrophoresis, recovering target Primer fragments from the gel, and purifying again by high-efficiency liquid chromatography, wherein the 5' -end of the PCR forward amplification Primer of the mutation site is labeled by biotin.
The gene sequence of SLCO1A2rs7967354 polymorphic site is:
＞chr12:21270969-21271169
wherein the bolded and underlined base is the candidate single nucleotide polymorphism site.
The gene sequence of SLCO1A2rs11045995 polymorphic site is:
＞chr12:21355144-21355344
wherein the bolded and underlined base is the candidate single nucleotide polymorphism site.
Based on the above gene sequences, the key components of the kit are multiplex PCR amplification primers and sequencing primer sequences as follows:
(1) SLCO1A2rs7967354 site forward amplification primer (SEQ ID NO. l):
5’-CAGTGATTGGATTTAAGCCTATG-3’；
(2) SLCO1A2rs7967354 site reverse amplification primer (SEQ ID NO. 2):
5’-TTTGCAAATAGAGCATTTACAAG-3’；
(3) SLCO1A2rs7967354 site sequencing primer (SEQ ID NO. 3):
5’-GATTGGATTTAAGCCTATG-3’；
(4) SLCO1A2rs11045995 site forward amplification primer (SEQ ID NO. 4):
5’-AGACCAGAGCCACTAAATCATTTC-3’；
(5) SLCO1A2rs11045995 site reverse amplification primer (SEQ ID NO. 5):
5’-TGGGAGGACTCTTCAGGATAAA-3’；
(6) SLCO1A2rs11045995 site sequencing primer (SEQ ID NO. 6):
5’-CATTTTAAAGACTTCTGAGC-3’；
2. multiplex PCR amplification reaction reagents: PCR kit for multiplex PCR amplification reaction by adopting pyrophosphoric acid sequencingPCR Kit, main component PyroMark PCR Master Mix (2×), comprising: hot start Taq DNA polymerase, deoxyribonucleoside triphosphates dNTPs, mgCl 2 (3 mM). Other components include: amplification reaction specificity enhancer Q-Solution (5X), coralLoad Concentrate (10X), all reagents were purchased from QIAGEN, germany.
3. Pyrosequencing reagent: the pyrophosphoric acid sequencing reagent is a conventional reagent for DNA pyrophosphoric acid sequencing, and mainly comprises: pyroMark annealing buffer, DNA polymerase (all required enzymes for pyrosequencing, ATP sulfurylase, luciferase, apyrase), substrate complex (adenosine-5' -phosphothioate) and deoxynucleotide triphosphate complex dNTPs (where dNTPs are artificially modified alpha-thiodeoxyadenosine triphosphate, the remaining deoxycytidine triphosphates, deoxyguanosine triphosphates, deoxythymidine triphosphates are unmodified), all reagents were purchased from QIAGEN, germany.
In one embodiment, a method for detecting a gene polymorphism applied to early warning of rocuronium bromide myorelaxant residual blocking is provided, and the detection method adopts the detection kit applied to early warning of rocuronium bromide myorelaxant residual blocking, and comprises the following steps:
1. collecting a biological sample to be tested:
randomly taking rocuronium bromide to be selected as a patient for anesthesia auxiliary medication, collecting 2mL of peripheral venous blood, performing EDTA anticoagulation, and performing gene polymorphism detection of rocuronium bromide residual blocking effect early warning based on the kit and the detection flow.
2. Genomic DNA extraction:
the method mainly comprises the following steps: firstly, red blood cells without DNA are removed by red blood cell lysate pyrolysis, white blood cells are released by cell nucleus lysate pyrolysis, then, protein is removed by selective precipitation of protein precipitation liquid, the genome DNA in a reversible adsorption system of a silica gel membrane column is digested by protease, impurities such as protein, lipid and the like are removed by rinsing liquid, and then, pure human whole blood genome DNA is obtained by eluting with purified liquid.
PCR amplification reaction
The specific reaction system and reaction conditions using the multiplex PCR primer composition and multiplex PCR amplification reaction reagents in the above detection kit are shown in tables 1 and 2.
TABLE 1PCR amplification reaction System Components (25. Mu.L)
TABLE 2 conditions for PCR amplification reactions
After the PCR amplification step is completed, the resultant product is subjected to agarose gel examination of the PCR result, and the specificity of the primer is judged for the next procedure.
See fig. 2 and 3 for gel electrophoresis plots of seven random samples of the PCR amplification products of the SLCO1A2 polymorphic sites (rs 7967354 and rs 11045995).
4. Single-stranded DNA sample isolation and purification:
the part of operation content mainly comprises: under the condition of a PyroMark binding buffer solution, streptavidin (high-performance streptavidin agarose) is combined with a PCR product with biotin, single-stranded DNA products are separated, and then purified single-stranded DNA samples are obtained through 68-72% ethanol, pyroMark denaturing solution and PyroMark eluting buffer solution respectively.
5. Pyrosequencing and results analysis: the implementation process of the part mainly uses the pyrosequencing reagent and the pyrosequencing primer which are arranged in the gene polymorphism detection kit for early warning of rocuronium bromide muscular relaxant residual blocking effect.
5.1 preparation of reagents
5.1.1 all reagents were left at room temperature for 10min before use to allow the temperature to equilibrate to room temperature for further use. Opening the kit, taking out the enzyme complex and substrate complex freeze-dried powder, dissolving the enzyme and the substrate by using water without the nucleotidase according to the marked volume of the reagent bottle, and standing for 5min at room temperature after the preparation is finished.
5.1.2 adding enzyme complex, substrate complex and alpha-thiodeoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, deoxythymidine triphosphate and other reagents into corresponding positions in a reagent bin of a sequencer according to the volume of the reagent calculated by the matched software of the pyroMark Q48 Autoprep automatic pyrophosphate sequencer.
5.2 sequencing of genes to be tested on PyroMark Q48 Autoprep automatic pyrophosphate sequencer
5.2.1A sequencing program to be run is compiled in the PyroMark Q48 Autoprep automatic pyrophosphate sequencer software.
5.2.2 backing up the program to instrument specific storage disk, connecting to the automatic pyrophosphate sequencer USB interface of PyroMark Q48.
And 5.2.3 clicking a Sequence button on the touch screen of the instrument, and loading the edited running program in the special storage disk.
5.2.4 the lid of the instrument is opened and the lid of each reagent cartridge is opened.
5.2.5 selecting a reagent cartridge to be used, wherein the selected reagent cartridge displays a water drop-like icon.
5.2.6 according to the volume of each reagent displayed on the touch screen, slowly adding the reagents into each reagent bin by adhering to the wall in sequence, and avoiding generating bubbles.
5.2.7 after adding the various reagents required for the sequencing assay, the reagent cartridge was capped and locked with confirmation.
And 5.2.8 clicking a Start button to Start self-checking, wherein a green arrow appears behind the reagent bin after the self-checking passes.
5.2.9 the loading disc is placed into the instrument, aligned with the positioning holes in the disc, and the fixing screws for fixing the disc are screwed.
5.2.10 mixing the bead suspension, then adding the beads to the loading disc using a pipette, 3 μl per well.
5.2.11 to the wells of the loading disc 10. Mu.L of biotin-containing labeled PCR product, e.g.less than 10. Mu.L of PCR product, was added and the 10. Mu.L was supplemented with pure water to ensure complete coverage of the magnetic beads with PCR product liquid.
5.2.12 click "Start" and run the sequencing program. After the operation is finished, the sequencing result is automatically imported into the special storage disk, the storage disk is withdrawn, and the instrument closing program is operated to close the instrument.
5.2.13 test data were derived from a dedicated memory disk for analysis of the focused phosphate sequencing results.
5.3 determination of the results of pyrosequencing
In the DNA sequencing peak diagram of 5.3.1SLCO1A2 rs7967354, the frequency of C (Cytosine) is more than or equal to 90%, the frequency of T (Thymine) is less than or equal to 10%, namely the SLCO1A2rs7967354 wild type is considered; the frequency of C is less than or equal to 60 percent, the frequency of T is less than or equal to 60 percent, namely SLCO1A2rs7967354 mutation heterozygosity is considered; the frequency of T is more than or equal to 90 percent, the frequency of C is less than or equal to 10 percent, namely the SLCO1A2rs7967354 mutation is considered to be homozygous.
In the DNA sequencing peak diagram of 5.3.2SLCO1A2 rs11045995, the frequency of A (Adenine) is more than or equal to 90 percent, and the frequency of G (guanine) is less than or equal to 10 percent, namely the SLCO1A2rs11045995 wild type is considered; the frequency of A is less than or equal to 60 percent and the frequency of G is less than or equal to 60 percent, namely SLCO1A2rs11045995 mutation heterozygosity is considered; the frequency of G is more than or equal to 90 percent, the frequency of A is less than or equal to 10 percent, namely the SLCO1A2rs11045995 mutation is considered to be homozygous;
5.3.3 blank control: the sequencing result graph is shown as red shading, and the "Quality" prompt box shows that the analysis result is "Failed" or "N/A".
5.3.4 if the sequencing result graph shows red shading, a "Quality" prompt box shows that the analysis result is "Failed" or "N/A", namely, the result is considered to be invalid or not detected; if the sequencing result graph shows blue shading, a "Quality" prompt box shows that the analysis result is "Passed", and the result is considered to be valid.
5.3.5 above conditions must be all met in the same experiment, otherwise, the experimental result is invalid.
5.4 report evaluation of results
FIG. 4 shows a typical SLCO1A2rs7967354 homozygous mutant pyrophosphate sequencing result; FIG. 5 shows a typical SLCO1A2rs7967354 heterozygous mutant pyrophosphate sequencing result; FIG. 6 shows a typical plot of the results of wild-type pyrosequencing of SLCO1A2rs 11045995; FIG. 7 shows a typical SLCO1A2rs11045995 heterozygous mutant pyrophosphate sequencing result.
Wherein, in fig. 4 to 7, well represents a sequencing channel number; assay represents a test object; sample ID represents a Sample number; note represents an annotation on a test object; analysis version indicates the version number of the Analysis software; sequence to analyze the sequence to be analyzed; position represents the number of the order of the analysis sequence; name represents the order number of the analysis sequence; a represents adenine; c represents cytosine; g represents guanine; t represents thymine.
The criteria for the pyrosequencing results and the associated personalized medicine recommendations are shown in Table 12.
Table 12 criteria for sequencing results of pyrophosphate and personalized drug recommendation for rocuronium bromide
/>
Remarks: c (Cytosine; cytosine), T (Thymine), a (Adenine; adenine); g (Guanosine; guanine)
The foregoing description is only illustrative of the present invention and is not intended to limit the scope of the invention, and all equivalent processes or direct or indirect applications in other related arts using the present invention are included in the scope of the present invention. It should be noted that, in this document, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made therein without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Claims (10)

1. The gene polymorphism primer composition for early warning of rocuronium bromide myorelaxant residual blocking effect is characterized in that the primer composition can amplify two single nucleotide mutation sites of an SLCO1A2 gene in the same PCR system, and the primer composition comprises:
(1) Forward amplification primer (SEQ ID No. l) for rs7967354 locus of SLCO1A2 gene: 5'-CAGTGATTGGATTTAAGCCTATG-3';
(2) Reverse amplification primer (SEQ ID NO. 2) for rs7967354 locus of SLCO1A2 gene: 5'-TTTGCAAATAGAGCATTTACAAG-3';
(3) Forward amplification primer for rs11045995 locus of SLCO1A2 gene (SEQ ID NO. 4): 5'-AGACCAGAGCCACTAAATCATTTC-3';
(4) Reverse amplification primer for rs11045995 locus of SLCO1A2 gene (SEQ ID NO. 5): 5'-TGGGAGGACTCTTCAGGATAAA-3'.
2. The gene polymorphism primer composition for early warning of rocuronium bromide myorelaxer resistance according to claim 1, wherein the primer composition further comprises the following sequencing primers:
(1) The rs7967354 locus sequencing primer (SEQ ID NO. 3) of the SLCO1A2 gene:
5’-GATTGGATTTAAGCCTATG-3’；
(2) Rs11045995 locus sequencing primer of SLCO1A2 gene (SEQ ID NO. 6):
5’-CATTTTAAAGACTTCTGAGC-3’。
3. the gene polymorphism primer composition for early warning of rocuronium bromide muscular relaxant residual blocking effect according to claim 1, wherein the forward amplification primer of the rs7967354 locus of the SLCO1A2 gene and the 5' end of the forward amplification primer of the rs11045995 locus of the SLCO1A2 gene are subjected to biotin labeling.
4. The gene polymorphism detection kit for rocuronium bromide muscular-relaxation residual blocking effect early warning is characterized by comprising the primer composition for rocuronium bromide residual blocking effect early warning related gene polymorphism, a multiplex PCR amplification reaction reagent, a pyrosequencing reagent and a kit body as claimed in claim 3, wherein the primer composition for rocuronium bromide residual blocking effect early warning related gene polymorphism, the multiplex PCR amplification reaction reagent and the pyrosequencing reagent are arranged in the kit body.
5. The kit for detecting polymorphism of rocuronium bromide residual blocking related genes according to claim 4, wherein the multiplex PCR amplification reaction reagent adopts a pyrophosphoric acid sequencing PCR kitPCR Kit, main component PyroMark PCR Master Mix (2×), comprising: hot start Taq DNA polymerase, deoxyribonucleoside triphosphates dNTPs, mgCl 2 (3 mM); other components include: amplification reaction specificity enhancer Q-solutions (5X), coralLoad Concentrate (10X).
6. The kit for detecting polymorphism of rocuronium bromide residual block effect pre-warning related genes according to claim 5, wherein the pyrosequencing reagent comprises: pyroMark annealing buffer; a DNA polymerase including ATP sulfurylase, luciferase, apyrase, and apyrase required for pyrosequencing; a substrate complex, the substrate complex being adenosine-5' -phosphosulfuric anhydride; deoxynucleotide triphosphate complex dNTP, which is artificially modified alpha-thiodeoxyadenosine triphosphate; deoxycytidine triphosphate, deoxyguanosine triphosphate and deoxythymidine triphosphate are all unmodified.
7. The kit for detecting gene polymorphism applied to early warning of rocuronium bromide myorelaxer residual blocking effect according to claim 6, wherein a blank reference substance is further arranged in the kit body, and the blank reference substance is sterilized distilled water.
8. The method for detecting the gene polymorphism applied to the early warning of the residual blocking effect of rocuronium bromide muscular relaxations is characterized by adopting the gene polymorphism detection kit applied to the early warning of the residual blocking effect of rocuronium bromide muscular relaxations as claimed in claim 7, and comprises the following steps:
(1) DNA extraction: firstly, red blood cells without DNA are removed by red blood cell lysate pyrolysis, white blood cells are released by cell nucleus lysate pyrolysis, then, protein is removed by selective precipitation of protein precipitation liquid, the genome DNA in a reversible adsorption system of a silica gel membrane column is digested by protease, impurities such as protein, lipid and the like are removed by rinsing liquid, and pure human whole blood genome DNA is obtained by eluting with purified liquid;
(2) PCR amplification reaction: the primer composition and the multiplex PCR amplification reaction reagent applied to the gene polymorphism detection kit for early warning of rocuronium bromide myorelaxant residual blocking effect are adopted, wherein the reaction system and the reaction conditions are shown in the following table 1 and the table 2:
TABLE 1 multiplex PCR amplification reaction System (25. Mu.L)
TABLE 2 multiplex PCR amplification reaction conditions
(3) Single-stranded DNA sample separation and purification;
(4) Pyrosequencing and results analysis.
9. The method for detecting gene polymorphism applied to early warning of rocuronium bromide muscular relaxant residual blocking according to claim 8, wherein the single-stranded DNA separation and purification reagent required in the step (3) comprises: streptavidin; pyroMark binding buffer; pyroMark denaturing solution; pyroMark elution buffer (10×) was concentrated; the operation content of the step mainly comprises: under the condition of pyroMark binding buffer solution, the streptavidin is combined with the PCR product with biotin to separate single-stranded DNA products, and then the single-stranded DNA products are treated by 68-73% ethanol, pyroMark eluting buffer solution and pyroMark denaturing solution respectively to obtain purified single-stranded DNA samples.
10. The method for detecting gene polymorphism applied to early warning of rocuronium bromide muscular relaxant residual blocking according to claim 8, wherein the step (4) adopts a sequencing primer and a pyrosequencing reagent in the gene polymorphism detection kit applied to early warning of rocuronium bromide muscular relaxant residual blocking; the method specifically comprises the following steps: diluting the SLCO1A2rs7967354 site sequencing primer and the SLCO1A2rs11045995 site sequencing primer by using a pyroMark annealing buffer solution, and then placing the diluted single-stranded DNA products; continuously heating at 78-82 ℃ for 1.5-2.5min, cooling at 16-23 ℃ for 5-8min, simultaneously adding enzyme complex, substrate complex and four deoxyribonucleoside triphosphates with required volumes into a reagent bin, then running a sequencing program on a special instrument, and finally performing result analysis on special analysis software after sequencing is finished;
wherein, in the pyrosequencing result:
in the DNA sequencing peak diagram of SLCO1A2rs7967354, if the frequency of cytosine C is more than or equal to 90% and the frequency of thymine T is less than or equal to 10%, the SLCO1A2rs7967354 is considered to be wild type; if the frequency of cytosine C is less than or equal to 40 percent and less than or equal to 60 percent and the frequency of thymine T is less than or equal to 40 percent and less than or equal to 60 percent, SLCO1A2rs7967354 is considered to be mutation heterozygous; if the frequency of thymine T is more than or equal to 90% and the frequency of cytosine C is less than or equal to 10%, SLCO1A2rs7967354 is considered to be mutation homozygosity.
For a DNA sequencing peak diagram of SLCO1A2rs11045995, if the frequency of adenine A is more than or equal to 90 percent and the frequency of guanine G is less than or equal to 10 percent, the SLCO1A2rs11045995 is considered to be wild type; if the frequency of adenine A is less than or equal to 40% and less than or equal to 60%, the frequency of guanine G is less than or equal to 40% and less than or equal to 60%, namely SLCO1A2rs11045995 is considered to be mutation heterozygous; if the frequency of guanine G is more than or equal to 90% and the frequency of adenine A is less than or equal to 10%, SLCO1A2rs11045995 is considered to be mutation homozygosity.
CN202310052507.0A 2023-02-02 2023-02-02 Gene polymorphism primer composition, detection kit and detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect Pending CN116694748A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310052507.0A CN116694748A (en) 2023-02-02 2023-02-02 Gene polymorphism primer composition, detection kit and detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310052507.0A CN116694748A (en) 2023-02-02 2023-02-02 Gene polymorphism primer composition, detection kit and detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect

Publications (1)

Publication Number Publication Date
CN116694748A true CN116694748A (en) 2023-09-05

Family

ID=87834601

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310052507.0A Pending CN116694748A (en) 2023-02-02 2023-02-02 Gene polymorphism primer composition, detection kit and detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect

Country Status (1)

Country Link
CN (1) CN116694748A (en)

Similar Documents

Publication Publication Date Title
CN107034273B (en) CYP2C19 and ABCB1 gene detecting kits
EP3755813B1 (en) Improved detection of microsatellite instability
AU2017318669B2 (en) Methods and composition for the prediction of the activity of enzastaurin
CN110846408A (en) Primer combination for detecting TTN gene mutation and application thereof
WO2013060005A1 (en) Method for detecting specific single nucleotide polymorphism related to ankylosing spondylitis and kit therefor
Borgbo et al. Genotyping common FSHR polymorphisms based on competitive amplification of differentially melting amplicons (CADMA).
KR100707196B1 (en) Method for screening multiple single nucleotide polymorphisms associated with susceptibility of specific disease or drug
CN116694748A (en) Gene polymorphism primer composition, detection kit and detection method applied to early warning of rocuronium bromide myorelaxant residual blocking effect
Zahari et al. A nested allele-specific multiplex polymerase chain reaction method for the detection of DRD2 polymorphisms
KR101992952B1 (en) Composition, kit for predicting the risk of developing cardiovascular disease related to Cholesterol efflux capacity, and method using the same
KR101023194B1 (en) Marker for diagnosing atopic dermatitis and use thereof
KR102268059B1 (en) Composition, kit for predicting weight control according to exercise, and method using the same
CN112980946B (en) Gene polymorphism detection kit and detection method for guiding administration of rocuronium bromide serving as skeletal muscle relaxant
KR20200066946A (en) Composition, kit for predicting weight control according to dietary habits, and method using the same
CN111197078A (en) Method for distinguishing nifedipine personalized medicine by mass spectrometry through product detection
CN111197077A (en) Kit for detecting medication guidance gene of nifedipine serving as antihypertensive drug
CN111235255A (en) Method for distinguishing individual medication of nitrendipine by using primer composition through mass spectrometry
CN111100914A (en) Method for carrying out perindopril personalized medication guidance by detecting product
CN114752666B (en) Tegrelor-related dyspnea genotype detection reagent or kit
US20080145853A1 (en) Methods and Kits for Detection of Chromosome Aneuploidy by High Performance Liquid Chromatography with Post-Column Fluorescence Detection
CN116904584B (en) Kit for aspirin resistance medication guidance related gene polymorphic site and using method thereof
CN108018351A (en) The relevant biomarker of metabolic disease and its application caused by a kind of high lipid food with intake
JP4538637B2 (en) Apolipoprotein E gene polymorphism detection method, genotype determination method and reagent for apolipoprotein E gene polymorphism
WO2006033384A1 (en) Dna oligomer, gene marker and dna oligomer set for predicting the onset of side effect in radiotherapy and method of predicting the onset of side effect
JP4677646B2 (en) Apolipoprotein E gene polymorphism detection method, genotype determination method and reagent for apolipoprotein E gene polymorphism

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination