CN109762908A - Identify hiruto specific primer to and method, application - Google Patents

Abstract

The invention discloses a kind of for identifying the specific primer pair of hiruto, is made of primers F N-5 ' and primers F N-3 ', and the primers F N-5 ' and the primers F N-3 ' are single strand dna, and nucleotide sequence is followed successively by sequence 1 and sequence 2 in sequence table.PCR amplification is carried out using genomic DNA of the specific primer to sample to be tested, if it is possible to realize effectively amplification, then contain in the sample to be tested or candidate contains hiruto；If can not achieve effective amplification, do not contained in the sample to be tested or candidate without containing hiruto.The present invention can be obtained effectively and distinguish hiruto and other leech samples, quick, easy.

Description

Identify hiruto specific primer to and method, application

Technical field

The invention belongs to technical field of molecular biology, and in particular to a kind of method and specific primer for identifying hiruto It is right.

Background technique

Leech (HIRUDO) alias horseleech, Chinese ephedra Qi, horseleech belong to Annelida Hirudinea and cure leech shape suborder Yi Zhi section." mind Agriculture book on Chinese herbal medicine warp " it records: " leech master closes, the accumulation ... of blood-breaking lump in the abdomen the moon by extravesated blood, hemostasis " as Chinese medicine, has more than 3000 so far The history in year.Modern Chinese medicine thinks the blood-activating and menstruation-regulating medicinal of Hirudo drug for invigorating blood circulation and eliminating stasis subordinate classification, can inhibit blood platelet Release reduces blood lipid, inhibits fibroblast proliferation；For preventing and treating thrombus disease, the transfer of control cancer cell and increment etc..Water The effect of leech and its blood coagulation resisting function are closely related, and the best anticoagulant active substance of most important one, curative effect is hirudin (Hirudin), it is most effective and safest natural thrombin inhibitor in the world so far, with insulin, qinghaosu " three element of the world " for referred to as saving human diseases, has high medical value.

2015 editions " pharmacopeia " regulations are Hirudinidae animal whitmania Whitmania pigra Whitman for medicinal leech (i.e. eurysome golden thread leech), leech Hirudo nippponica whitman (i.e. Hirudo japonica) or willow leaf leech Whitmania Acranulata Whitman (i.e. tapering gold thread leech).It is worth noting that, leech in the world has more than 500 kinds, China has 97 Kind, they belong to different mesh, section and category, in morphosis, feeding habit, living environment and internal contained bioactivity It is all very different in terms of the structure and function of substance.Inventor is to Hui nationality, China, Yuzhou of Henan, Sichuan Chengdu lotus The leech of the several main Chinese Medicinal Materials Markets sale of Hua Chi and Hubei Qichun and the raw material of nearly ten kinds of leech Chinese patent drugs are investigated It was found that the resource of Chinese traditional medicine leech is extremely in short supply；Meanwhile the production and trade of leech lack industry standard, source is chaotic, there is Serious similar varieties leech kind obscures medication problem.The discrepant leech kind of different cultivars, curative effect is mixed to influence leech Chinese medicine quality also brings great security risk to clinical application.In order to which clinical application is safe and accurate and effective, for outer Difference traditional Chinese medicinal materials assortment similar in shape establish it is a kind of effectively accurately identification method become have become extremely urgent demand.

The conventional identification method of leech be identified by character, the methods of microscopical characters, these discrimination methods be easy by Many influences such as appraiser, medicinal material growing environment, growth year and Habitat producing；Also, at present still without a kind of maturation Physical and chemical identification method be used for leech Variety identification.And the Study on Diversity as molecular biology rapidly develops, on DNA level It makes a breakthrough, using DNA bar code technology and the polymerase chain reaction method based on specific primer as representative, uses It is also becoming better and approaching perfection day by day in the Molecular Identification technology of medicinal animals and plants.(leech DNA identification, active peptides separation and its work such as Xiao Ling With the research of mechanism, Hubei University of Chinese Medicine, 2015) amplification obtain eurysome golden thread leech, hiruto, Hirudo japonica, tapering gold ITS2, CO I, 12Sr RNA, the 16Sr of 8 species such as line leech, Whitmania laevis, stick line ox leech, haemadipsa japonica and erpobdella octoculata The sequence of the gene segments such as RNA compares interspecific difference in this 4 gene segment candidate sequence kinds；It is medical for obtaining 12Sr RNA The more appropriate DNA bar code sequence of leeches.CN2014101625452 is passed through with DNA bar code technical appraisement eurysome golden thread leech To the determined dna sequence of standard target gene and analysis is compared, the species mirror determined according to the similitude with theoretical sequence Determine technology.But this method is in the detection process slowly without promoting, and that there is criterion is not stringent, practical for this method Application not equal limitation by force.Concrete reason mainly has following three aspects: first is that process is complicated, time and effort consuming.DNA bar code is real Needs are tested by extracting DNA, polymerase chain reaction (PCR), the verifying of PCR product electrophoresis, commission sequencing and sequencing result By hand check and correction, sequence assembly, all multi-steps such as be compared with open sequence, be not suitable for quick, high-throughput using detecting. Second is that as a result stability is poor, sequencing step is complicated, and the result of sequencing reaction receives sample pre-treatments and reaction condition Influence and quality is different, influence species determine conclusion.Third is that lacks specific criterion, if usually target gene and institute The homology of theoretical gene order SEQ ID NO.1 is stated 99% or more, that is, can determine whether the species of sample to be tested.But according to Gene is different, and species to be measured are different, and degree of variation of the sequence between species is different.Therefore, lack stabilization, a standard Really, clearly homology standard is determined.

Hiruto is and is not included in Hementaria officianalis kind specified in pharmacopeia.But due to individual it is larger, be easy to raise and by A large amount of artificial breeding, become main Hementaria officianalis adulterant.There is presently no specificity methods to identify hiruto.Therefore, it needs Establish it is a kind of quickly, accurate, high resolution, easily operated hiruto identification method with make up identification field blank with it is existing The deficiency that the complexity of technology is time-consuming, accuracy is not high.

Summary of the invention

The technical problem to be solved by the present invention is to provide a kind of identification phenanthrene in view of the deficiency of the prior art The method and specific primer pair of ox leech, it is so effective that distinguish hiruto and other leech samples, it is quick, easy.

The present invention be solve the problems, such as it is set forth above used by technical solution are as follows:

Present invention firstly provides a kind of for identifying the specific primer pair of hiruto, can be by primers F N-5 ' and primers F N- 3 ' compositions, the primers F N-5 ' and the primers F N-3 ' are single strand dna, and nucleotide sequence is followed successively by sequence table 2 (5 '-CATAATTGAATATACATTTACAGCAGAA- of sequence 1 (5 '-GTAATTAGAATCGTAATAGCTC-3 ') and sequence 3’)。

The above-mentioned specific primer centering for being used to identify hiruto, mole of the primers F N-5 ' and the primers F N-3 ' Than that can be 1:1.

The application of the above-mentioned specific primer pair for being used to identify hiruto is any in following a)-f):

A) kit for detecting or assisting detection hiruto is prepared；

B) it detects or assists whether to contain in detection sample to be tested or candidate contains hiruto；

C) kit for identifying or assisting identification hiruto is prepared；

D) identify or assist to identify sample to be tested whether be or candidate is hiruto；

E) kit for identifying or assisting to identify the true or false of commercially available hiruto is prepared；

F) identify or assist the true or false of the commercially available hiruto of identification.

The present invention also provides for identifying the kit of hiruto.The examination provided by the present invention for being used to identify hiruto Agent box contains above-mentioned for identifying the primer pair of hiruto.Wherein, it further includes Taq archaeal dna polymerase, dNTP and reaction buffering Liquid.

The above-mentioned application for identifying the kit of hiruto also belongs to protection scope of the present invention.It is above-mentioned to be used to identify phenanthrene The kit of ox leech application can be following b1) b2) or b3):

B1 it) detects or assists whether to contain in detection sample to be tested or candidate contains hiruto；

B2) identify or assist to identify sample to be tested whether be or candidate is hiruto；

B3) identify or assist the true or false of the commercially available hiruto of identification.

Whether contain the present invention also provides a kind of detection sample to be tested or the candidate method containing hiruto, it may include such as Lower step: extracting the total DNA of sample to be tested as template, using it is above-mentioned for identify the primer pair (or kit) of hiruto into Row PCR amplification, if it is possible to realize effectively amplification, then contain in the sample to be tested or candidate contains hiruto；If cannot It realizes effectively amplification, is not then contained in the sample to be tested or candidate is without containing hiruto.

The present invention also provides it is a kind of identify sample to be tested whether be or candidate is the method for hiruto, it may include following step It is rapid: extract the genomic DNA of sample to be tested as template, using it is above-mentioned for identify the primer pair (or kit) of hiruto into Row PCR amplification, if it is possible to realize effectively amplification, then the sample to be tested is or candidate is hiruto；If can not achieve Effect amplification, then the sample to be tested is not or candidate is not hiruto.

The present invention also provides a kind of methods of true or false for identifying commercially available hiruto, it may include following steps: extracting city The genomic DNA of hiruto is sold as template, PCR expansion is carried out using the above-mentioned primer pair (or kit) for identifying hiruto Increase, if it is possible to realize effectively amplification, then the commercially available hiruto is or candidate is genuine piece；If can not achieve effective amplification, Then the commercially available hiruto is or candidate is adulterant.

In any of the above-described the method, described " can be realized effective amplification " is to contain 300-400bp in pcr amplification product DNA fragmentation；Described " can not achieve effective amplification " is the DNA fragmentation that 300-400bp is not contained in pcr amplification product.Wherein, The DNA fragmentation of the 300-400bp can be the DNA fragmentation of the 333bp, (GTAATTAGAATCGTA as shown in sequence 3 in sequence table ATAGCTCTTTTAGCTATAGCATTTTATACTTTATTAGAGCGAAAATTATTGGGATATATACAATTGCGTAAAGGAC CTAATAAAGTAATATTGCTAGGTTTACCACAACCTATAGCTGATGCTATAAAATTATTTTTAAAAGAACAACCTTA TTTAATTTATTCTAATAAGATGTATTTTATTTATGGTCCACTATTAAGACTTAGATTATCATTATTATTATGGATA ATTTATCCTTTTAATAATCCTAGATGGTGATTTTCATTTAGATTAGTATATTTTTTATGCATTTCTGCTGTAAATG TATATTCAATTATG)。

In the above method, when carrying out the PCR amplification, concretely 55 DEG C of the annealing temperature of use.

In the above method, when carrying out the PCR amplification, the amplification program of use concretely 94 DEG C of initial denaturation 3min；94 DEG C denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；35~38 circulations；72 DEG C of extension 5min.

In the above method, when carrying out the PCR amplification, the system of the PCR amplification can are as follows: when total volume is 20 μ l, 0.8 μM of upstream primer of 10 μ l, FN-5 ' of SYBR Premix Ex Taq II, 0.8 μM of FN-3 ' downstream primer, template 10-30ng, 20 μ l of sterile purified water polishing.

Compared with prior art, the beneficial effects of the present invention are:

Firstly, FN-5 ' (upstream primer) and FN-3 ' (downstream primer) are selected the present invention relates to primer pair specificity is good It has selected the 3 ' ends more than the site of two continuous mutations as specific primer and has generated continuous two bit mismatch, the decrease of high degree Specific primer potential nonspecific possibility；Also reaction condition, amplification have been fully considered when in addition designing specific primer A variety of specific primers are used in mixed way by the compatibility in terms of primer size convenient for subsequent.Finally the experimental results showed that utilizing this It invents the luxuriant and rich with fragrance ox doctor leech specific primer and carries out PCR, nonspecific reaction is not generated with the DNA fragmentation other than target, and Its reaction condition is identical as other leech specific primer reaction conditions, carries out convenient for multiple experimental synchronous or mixing sample is more It is identified while kind component.In addition, the PCR product size that hiruto primer amplified obtains is clear, with other leech Specific band can be distinguished obviously.Therefore, the disposable idiosyncrasy of hiruto specific primer of the invention can be by sample Hiruto ingredient in product identifies, and without generating nonspecific reaction to other leech kinds, it is quick, accurate to can be used for The identification hiruto kind true and false.

Furthermore the invention further relates to a kind of high-resolution DNA detection method, in conjunction with minor effect genes (Shimadzu Corporation, MultiNA it) is directly detected, realizes the quick detection to leech medicinal material.Compared to specified in pharmacopeia to pcr amplification product The agarose gel electrophoresis method for detecting detected, this side's sensitivity is good, high resolution, analysis cost are low, easy to operate, can be quick Realize the identification of traditional Chinese medicinal materials assortment.

Detailed description of the invention

Fig. 1 specific primer investigates gel figure；Left side L:DNA Marker, from top to bottom successively are as follows: 500bp, 450bp, 425bp、400bp、375bp、350bp、325bp、300bp、275bp、250bp、225bp、200bp、175bp、150bp、 125bp,100bp,75bp,50bp,25bp；Template: 1- eurysome golden thread leech, 2- Hirudo japonica, 3- hiruto, 4- water, blank pair According to.Arrow is hiruto specific band.

Fig. 2 is the corresponding electrophoretogram of template 3- hiruto in Fig. 1.

Fig. 3 is the applicability that hiruto specific primer pair is investigated using the hiruto in a variety of sources and specific gel Figure；Left side L:DNA Marker, from top to bottom successively are as follows: 500bp, 450bp, 425bp, 400bp, 375bp, 350bp, 325bp, 300bp,275bp,250bp,225bp,200bp,175bp,150bp,125bp,100bp,75bp,50bp,25bp；Template: 1- 4: the hiruto of separate sources, 5: water, blank control.Arrow is hiruto specific band.

Fig. 4 is the corresponding electrophoretogram of Fig. 3.

The leech multiplex PCR of Fig. 5 different batches Commercial sources identifies electrophoretogram；Left side L:DNA Marker, from top to bottom Successively are as follows: 500bp, 450bp, 425bp, 400bp, 375bp, 350bp, 325bp, 300bp, 275bp, 250bp, 225bp, 200bp,175bp,150bp,125bp,100bp,75bp,50bp,25bp；Template: 1-8 is the leech sample of different batches, in detail It is shown in Table 1；Arrow is hiruto specific band.Primer: the primer mixture of specific primer containing Hirudo japonica pair, the primer are mixed Object is closed by KT-5 ' TATGTATTGAAAGGGTATTCAATCG, KT-3 ' TTAAGAATGATCATCAGTATATAGTG, FN-5 ' GTAATTAGAATCGTAATAGCTC, FN-3 ' CATAATTGAATATACATTTACAGCAGAA, RY-5 ' CCAGCTATATCATTAAGTCAAT, RY-3 ' CTTAATGGAGTATTTTGAATT composition.

Specific embodiment

For a better understanding of the present invention, below with reference to the embodiment content that the present invention is furture elucidated, but the present invention is not It is limited only to the following examples.

In following embodiments, involved key instrument and reagent are as follows: minor effect genes (Shimadzu Corporation MultiNNA MCE-202), PCR instrument (Shimadzu Corporation), ultraviolet-spectrophotometer (Shimadzu Corporation Biospec-nano), supercentrifuge (Eppendort 5418)；DAN polymerase (SYBR Premix Ex Taq II, precious biology RR820), DNA dyestuff ( Gold Nucleic Acid Gel Stain, U.S. hero life technology Co., Ltd S-11494), minor effect genes kit (DNA-500 Reagent Kit for MultiNA, Shimadzu Corporation 292-27910-91), DNA molecular amount standard (25bp DNA Ladder, U.S. hero life technology Co., Ltd 10597-011), genome DNA extracting reagent kit (DNeasy Blood& Tissue Kit, QIAGEN 69504).

In following embodiments, involved medicinal material sample includes Hirudo japonica, eurysome golden thread leech, hiruto and on the market not With the leech medicinal material of batch.

Embodiment 1

It for identifying the specific primer pair of hiruto, is made of primers F N-5 ' and primers F N-3 ', the primers F N-5 ' It is single strand dna with the primers F N-3 ', nucleotide sequence is followed successively by the sequence 1 (5 '-in sequence table GTAATTAGAATCGTAATAGCTC-3 ') and sequence 2 (5 '-CATAATTGAATATACATTTACAGCAGAA-3 ').

Identify the method for leech sample using above-mentioned primer pair, steps are as follows:

(1) extracting genome DNA: leech sample to be tested takes 30mg, extracts total DNA with animal DNA extracts kit.According to DNA extraction kit specification is operated, -4 DEG C of preservations；DNA extract takes 1 μ L, is verified using ultraviolet-spectrophotometer DNA mass, it is 1.7-1.9 that concentration, which is greater than 10ng/ μ l, A260/A280 ratio, and the ratio of A260/A230 is greater than 2.0；

Sample to be tested is respectively that source is clear and the eurysome golden thread leech Jing Guo the authenticated kind of conventional method, day in this step This doctor leech, hiruto standard items, have verified that the specificity of primer pair of the present invention；

(2) foundation of PCR amplification system with react: 20 μ L of PCR reaction system total volume, including SYBR Premix 10 μ l of Ex Taq II, the 1 μ l (30ng) of DNA profiling of extraction, primer pair FN-5 ', FN-3 ' dosage are 0.8 μM, sterile double steamings Water supplements system to 20 μ L；

PCR response parameter: 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；35 are followed Ring；72 DEG C of extension 5min；4 DEG C of preservations；

(3) result detects: after pcr amplification reaction, taking 1 μ L of PCR reaction product, minor effect genes detection, kit It selects minor effect genes 500bp kit (DNA-500 Reagent Kit for MultiNA), system automatically generated gel figure With electrophoretogram.

From Fig. 1 and Fig. 2: hiruto theory PCR product is 333bp, when sample to be tested is hiruto, at 333bp There is single band, the fragment length that minor effect genes detect is consistent with PCR target product.And with Hirudo japonica, expanded letter gold thread When leech and water are sample to be tested, there is no band respectively as between 300-400bp in the amplified production of template, it was demonstrated that the primer pair Can specificity identification hiruto.

Embodiment 2

Reaction system and detection method are referring to embodiment 1, and wherein DNA profiling is the genome of a variety of source phenanthrene ox leech DNA profiling, pcr amplification product is with Micro Chip Electrophoresis Analyser MultiNA detection.As a result by Fig. 3,4 displays, every kind of hiruto sample is all It is detected by Successful amplification and by Micro Chip Electrophoresis Analyser MultiNA, negative control (water) does not have band.Prove that the primer pair can be with It is widely used in specifically identifying hiruto ingredient.

Embodiment 3

Using above-mentioned reaction system and response parameter, wherein primer pair is mix primer pair, the primer pair of eurysome golden thread leech KT concentration is 0.4 μM, and the primer pair RY concentration of Hirudo japonica is 0.2 μM, and the primer pair FN concentration of hiruto is 0.4 μM, again Method applicability verifying is carried out to the PCR identification system established with the leech medicinal material of 8 kinds of different batches, sample message is shown in Table 1, Wherein expected results are the leech kind authenticated by conventional method, and specific electrophoretogram is shown in Fig. 5.

1 different batches leech sample message of table

As shown in Figure 5, the specific fragment of the amplifiable 333bp out of the hiruto sample of leech, and other leech samples are then The specific fragment of 333bp can not be amplified, it was demonstrated that primer pair specificity of the present invention is good, and strong applicability can be to hiruto Intuitively, fast and accurately identify.

To sum up, method provided by the invention only accurately, quickly and reliably can be mixed easily from several by a PCR amplification Identify hiruto in the leech kind confused, and the present invention is detected by minor effect genes, sensitivity is good, high resolution, analysis It is at low cost, easy to operate, it is Chinese medicine and the strong analysis method of food Variety identification.

The above is only a preferred embodiment of the present invention, it is noted that come for those of ordinary skill in the art It says, without departing from the concept of the premise of the invention, several modifications and variations can also be made, these belong to of the invention Protection scope.

110 business administration of > Shimadzu (China) Co., Ltd of <

120 > of < identify hiruto specific primer to and method, application

160 > 7 of <

<210>1

<211>22

<212>DNA

<213>artificial sequence

<400>1

gtaattagaa tcgtaatagc tc 22

<210>2

<211>28

<212>DNA

<213>artificial sequence

<400>2

cataattgaa tatacattta cagcagaa 28

<210>3

<211>333

<212>DNA

<213>hiruto

<400>3

gtaattagaa tcgtaatagc tcttttagct atagcatttt atactttatt agagcgaaaa 60

ttattgggat atatacaatt gcgtaaagga cctaataaag taatattgct aggtttacca 120

caacctatag ctgatgctat aaaattattt ttaaaagaac aaccttattt aatttattct 180

aataagatgt attttattta tggtccacta ttaagactta gattatcatt attattatgg 240

ataatttatc cttttaataa tcctagatgg tgattttcat ttagattagt atatttttta 300

tgcatttctg ctgtaaatgt atattcaatt atg 333

<210>4

<211>25

<212>DNA

<213>artificial sequence

<400>4

tatgtattga aagggtattc aatcg 25

<210>5

<211>26

<212>DNA

<213>artificial sequence

<400>5

ttaagaatga tcatcagtat atagtg 26

<210>6

<211>22

<212>DNA

<213>artificial sequence

<400>6

ccagctatat cattaagtca at 22

<210>7

<211>21

<212>DNA

<213>artificial sequence

<400>7

cttaatggag tattttgaat t 21

Claims (10)

1. for identifying the specific primer pair of hiruto, it is characterised in that be made of primers F N-5 ' and primers F NFN-3 ', institute It states primers F N-5 ' and the primers F N-3 ' is single strand dna, nucleotide sequence is followed successively by the sequence 1 (5 '-in sequence table GTAATTAGAATCGTAATAGCTC-3 ') and sequence 2 (5 '-CATAATTGAATATACATTTACAGCAGAA-3 ').

2. the application of specific primer pair described in claim 1, it is characterised in that be any in following a)-f):

A) kit for detecting or assisting detection hiruto is prepared；

B) it detects or assists whether to contain in detection sample to be tested or candidate contains hiruto；

C) kit for identifying or assisting identification hiruto is prepared；

D) identify or assist to identify sample to be tested whether be or candidate is hiruto；

E) kit for identifying or assisting to identify the true or false of commercially available hiruto is prepared；

F) identify or assist the true or false of the commercially available hiruto of identification.

3. the kit containing specific primer pair described in claim 1, it is characterised in that the kit for identify or Auxiliary identification hiruto.

4. kit as claimed in claim 3, it is characterised in that the kit further includes Taq archaeal dna polymerase, dNTP and anti- Answer buffer or water.

5. the application of kit as claimed in claim 3, it is characterised in that be following b1) b2) or b3):

B1 it) detects or assists whether to contain in detection sample to be tested or candidate contains hiruto；

B2) identify or assist to identify sample to be tested whether be or candidate is hiruto；

B3) identify or assist the true or false of the commercially available hiruto of identification.

6. whether a kind of detection sample to be tested contains or the candidate method containing hiruto, it is characterised in that include the following steps: The total DNA of sample to be tested is extracted as template, using specific primer described in claim 1 to PCR amplification is carried out, if energy It is enough to realize effectively amplification, then contain in the sample to be tested or candidate contains hiruto；If can not achieve effective amplification, institute It states and is not contained in sample to be tested or candidate without containing hiruto.

7. it is a kind of identify sample to be tested whether be or candidate is the method for hiruto, it is characterised in that include the following steps: to extract The genomic DNA of sample to be tested is as template, using specific primer described in claim 1 to PCR amplification is carried out, if energy Enough to realize effectively amplification, then the sample to be tested is or candidate is hiruto；It is described to be measured if can not achieve effective amplification Sample is not or candidate is not hiruto.

8. a kind of method for the true or false for identifying commercially available hiruto, it may include following steps: extract the genome of commercially available hiruto DNA is as template, using specific primer described in claim 1 to progress PCR amplification, if it is possible to realize effectively amplification, Then the commercially available hiruto is or candidate is genuine piece；If can not achieve effective amplification, the commercially available hiruto is or candidate For adulterant.

9. the method as described in claim 6 or 7 or 8, it is characterised in that described " can be realized effective amplification " is PCR amplification production Contain the DNA fragmentation of 300-400bp in object；Described " can not achieve effective amplification " is that 300- is not contained in pcr amplification product The DNA fragmentation of 400bp.

10. the method as described in claim 6 or 7 or 8, it is characterised in that when carrying out the PCR amplification, the amplification program of use Concretely 94 DEG C of initial denaturation 3min；94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；35 circulations；72 DEG C of extensions 5min；The system of the PCR amplification can are as follows: when total volume is 20 μ l, on SYBR Premix Ex Taq II 10 μ l, FN-5 ' 0.8 μM of primer of trip, 0.8 μM of FN-3 ' downstream primer, template 10-30ng, 20 μ l of sterile purified water polishing.