CN109628404B

CN109628404B - Construction method and application of porcine subcutaneous adipocyte precursor immortalized cell line

Info

Publication number: CN109628404B
Application number: CN201811548566.2A
Authority: CN
Inventors: 单体中; 刘嘉琪; 有文静; 徐子叶; 农秋雲; 汪以真
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2018-12-18
Filing date: 2018-12-18
Publication date: 2020-04-28
Anticipated expiration: 2038-12-18
Also published as: CN109628404A

Abstract

The invention discloses a method for constructing an immortalized cell line of subcutaneous adipose precursor cells of a pig, which comprises the following steps: obtaining primary porcine subcutaneous adipocytes; culturing cells, and transfecting pBABE-puro-hTERT plasmid when the cells grow to the density of 60-70%; screening with DMEM medium containing 30% serum of 4 mug/mL puromycin 48 +/-2 h after transfection; after screening for 48 +/-2 h, changing the culture solution into a DMEM culture medium for culture; and when the cells form cell clones, digesting the obtained cell clones, and culturing until the immortalized subcutaneous fat precursor cell model is obtained through identification. The application of the porcine subcutaneous adipocyte precursor immortalized cell line is as follows: is used for researching the proliferation of the lipogenic precursor cells or the mechanism and the regulation mechanism of polyester differentiation.

Description

Construction method and application of porcine subcutaneous adipocyte precursor immortalized cell line

Technical Field

The invention constructs subcutaneous fat precursor cells of a pig over-expressing telomerase reverse transcription gene by a method of transfecting telomerase plasmids to obtain an immortalized cell line, belonging to the application technology in the technical field of biology and modern agriculture.

Background

Adipose tissue plays an important role in the energy metabolism of the animal body, being an important site for storage and energy supply. Adipose tissue plays an important role in metabolic diseases such as obesity and diabetes as some fat factors such as adiponectin and leptin secreted by endocrine organs. Among them, fat deposition is mainly determined by proliferation, differentiation and polyester maturation of fat precursor cells, which directly affect glycolipid metabolism and human health. On the other hand, from the perspective of livestock production, subcutaneous fat deposition directly affects the quality of pork and the utilization efficiency of feed, reducing economic benefits. Therefore, the research on fat deposition is particularly urgent. And by establishing a pig subcutaneous fat precursor cell in-vitro culture model, the mechanism and regulation mechanism of differentiation, proliferation and polyester of pig preadipocytes are explored, and a theoretical basis is provided for further understanding the formation of fat tissues and the lipid metabolism process and further regulating and controlling the formation of fat deposition and meat quality. Therefore, establishing a precursor cell in vitro culture model and further exploring the adipocyte differentiation polyester has important scientific significance in the fields of medicine, life science, zootechnics and the like.

At present, life science research usually involves two types of cells, one is primary cells, and the other is immortalized cells or cell lines. At present, the culture of primary adipose precursor cells of pigs is not beneficial to passage, and 3-7 days old piglets need to be slaughtered every time primary adipose cells are separated, so that the experiment cost and the success rate of the experiment are greatly improved. However, no cell line or immortalized cell of pig fat cell is found at present. Telomerase reverse transcriptase (TERT) prolongs telomeres (shortened telomeres are restricted in their ability to replicate), thereby enhancing the proliferative capacity of cells in vitro, and can be used to construct immortalized cell lines.

Disclosure of Invention

The invention aims to solve the technical problem of providing a construction method of a porcine subcutaneous adipose precursor cell immortalized cell line and application of the cell line.

In order to solve the technical problems, the invention provides a method for constructing immortalized porcine subcutaneous adipose precursor cells (a method for constructing immortalized porcine subcutaneous adipose precursor cell lines) by stably transfecting hTERT, which comprises the following steps:

1) obtaining primary pig subcutaneous fat cells (inoculating pig subcutaneous fat precursor cells);

2) culturing the cells, and transfecting pBABE-puro-hTERT plasmid when the cells grow to the density of 60-70%;

3) screening by using a DMEM medium containing 30% serum of 4 mu g/mL puromycin after 48 +/-2 hours of transfection;

4) after screening for 48 +/-2 hours, changing the culture solution into a DMEM culture medium (namely, a common complete culture medium) for culture;

5) and when the cells form cell clones, digesting the obtained cell clones, and culturing (subculturing in a new 12-hole plate) until an immortalized porcine subcutaneous adipose precursor cell model (a porcine subcutaneous adipose precursor cell immortalized cell line) is obtained through identification.

In the step 5), the immortalized subcutaneous adipose precursor cell model is obtained through multiple passages, identification and the like.

As an improvement of the construction method of the porcine subcutaneous adipocyte precursor immortalized cell line, the step 5) adopts the semi-quantitative detection of hTERT gene expression:

specific primers for hTERT were:

hTERT-F GACCTCCATCAGAGCCAGTC

hTERT-R GTTCTTGGCTTTCAGGATGG；

a cell line expressing hTERT gene is selected.

As an improvement of the construction method of the porcine subcutaneous adipose precursor cell immortalized cell line, the expression conditions of the proliferation marker genes DHFR and KI67 are detected by fluorescent quantitative PCR; the fluorescent quantitative PCR primers are respectively as follows:

DHRF-F:GGTGATTATGGGTAGGAAGACCT

DHRF-R:ATTCTGGCTGCTCAGTAAGTTTT

Ki67-F:GCACCAGGCTTTACGGAAG

Ki67-R:ATTTTAGCCACTTCTGACTTTCG。

the invention also provides the application of the porcine subcutaneous adipocyte precursor immortalized cell line: is used for researching the proliferation of the lipogenic precursor cells or the mechanism and the regulation mechanism of polyester differentiation.

The immortalized subcutaneous adipose precursor cells obtained by the invention have the following purposes: the immortalized subcutaneous adipose precursor cells are important in-vitro research models and can be used for the research on the aspects of the proliferation, the polyester differentiation mechanism, the regulation and control mechanism and the like of the adipose precursor cells; meanwhile, the separation frequency of the primary adipocytes of the piglets can be reduced, and the method is suitable for developing more experiments related to the adipocytes and has a wide application prospect.

The invention has the following technical advantages: the established immortalized adipocyte precursor stably expresses hTERT, the activity of the hTERT is enhanced, the speed of the cell entering the clonal aging is slowed down, the cell can be subjected to multiple passages, the good proliferation and differentiation characteristics can be kept, and the method can be widely used for developing related researches.

The invention is based on separating and obtaining primary pig subcutaneous adipocyte precursor, through transfecting plasmid containing human telomerase reverse transcriptase (hTERT) gene, and screening pig subcutaneous adipocyte precursor which can stably over-express hTERT through antibiotics. The immortalized cell line can be used for the research of pig subcutaneous fat cell proliferation, differentiation, nutrition regulation and the like, is an important in vitro research model of pig fat precursor cells, and has very wide application prospect.

Drawings

The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.

FIG. 1 is a map of the plasmid used.

FIG. 2 is an electron microscope image of the morphology of the cells of the selected stably transfected cell clones; graph A- -40 times; b, graph-100 times.

FIG. 3 is a nucleic acid electrophoresis image of hTERT expression in 12 single cell clones obtained by semi-quantitative detection screening.

FIG. 4 is an electron microscope image of cell morphology from 1 day to 6 days after passage of the 8 th generation of immortalized subcutaneous precursor adipocytes.

FIG. 5 is the nucleic acid electrophoresis of hTERT expression at passage 4(p4), 10(p10) and 30(p30) of the selected stably transfected clone cells.

FIG. 6 shows the result of MTT assay for immortalized cell proliferation. PAC- -passage 9 immortalized porcine subcutaneous adipose precursor cells, Con- -common porcine subcutaneous adipose precursor cells.

FIG. 7 shows the results of detecting the proliferation of immortalized cells by crystal violet staining. A- -primary porcine subcutaneous adipose precursor cells, B- -10 th generation immortalized porcine subcutaneous adipose precursor cells.

FIG. 8 shows the results of immunofluorescence assay for immortalized cell proliferation. The cells used were passage 12 immortalized cells. A- -DAPI staining results; b- -proliferation antibody KI67 immunofluorescence staining results; c- -Merge results.

FIG. 9 shows the results of fluorescent quantitative determination of the expression of cell proliferation marker gene DHFR. CON- -passage 10 primary porcine subcutaneous adipocytes; PAC- -10 th generation of immortalized porcine subcutaneous fat precursor cells.

FIG. 10 shows the result of fluorescent quantitative determination of the expression of cell proliferation marker gene Ki 67. CON- -generation 10 primary porcine subcutaneous adipose precursor cells; PAC- -10 th generation of immortalized porcine subcutaneous fat precursor cells.

FIG. 11 is the results of oil red staining after differentiation of immortalized cells.

FIG. 12 shows the result of fluorescent quantitative detection of mature fat marker gene expression after polyester differentiation of immortalized cells.

Detailed Description

First, primary pig subcutaneous fat precursor cell is separated and cultured

1. The subcutaneous adipose tissue was isolated under sterile conditions, rinsed three times with PBS (containing penicillin and streptomycin), and cut to 1-2mm in PBS³The tissue mass of (1). The preparation method of PBS (containing penicillin and streptomycin) comprises the following steps: penicillin and streptomycin were added to 100ml of PBS buffer (pH 7.2-7.4) at a final concentration of 100U/ml.

2. Adding 0.15% collagenase type I digestive solution into 10g tissue block, and digesting in water bath at 37 deg.C for 70-90 min.

The formula of the digestive juice is as follows: adding 0.15g type I collagenase into 100ml of digestive juice to obtain digestive juice containing 0.15% type I collagenase; collagenase type i is available, for example, from Gibco.

3. After digestion was complete, digestion was stopped by adding an equal volume of DMEM complete medium (DMEM + 10% fetal bovine serum) to the digestion solution, followed by warp cloth filtration, 100 mesh screen filtration, centrifugation at 1000rpm for 5min and discarding the supernatant.

4. The pellet obtained in step 3 was resuspended in 1ml of DMEM complete medium containing 10% fetal calf serum (DMEM + 10% fetal calf serum).

5. The cells obtained in step 4 were seeded on a 10cm dish and cultured in a 5% CO2 incubator at 37 ℃. Obtaining primary pig subcutaneous fat cells (pig primary subcutaneous fat precursor cells). The solution was then changed 1 time every 2 days. The liquid change is DMEM culture liquid, and the using amount is the same as that in the step 3.

(II) establishment of culture model of immortalized subcutaneous fat precursor cells

1. After the isolated primary porcine subcutaneous adipocyte precursor cells were grown to 80% confluence (about 3-4d), after 1 time of PBS rinsing, they were digested with 0.25% trypsin (about 1ml) at 37 ℃ for 1-3min, after the digestion was terminated with complete medium, they were centrifuged at 1000rpm for 5min, PBS rinsed 3 times, and the cells were resuspended with 1ml DMEM complete medium.

2. The cells were then transferred to 6-well cell culture plates, cultured at 37 ℃ under 5% CO2, and allowed to fuse at about 70% (cell density, about the next day) for subsequent lipofection experiments.

3. And (3) carrying out lipofection: the pBABE-puro-hTERT plasmid was transfected with Lipofectamine 2000 (FIG. 1);

4. screening with DMEM medium containing 30% puromycin and 4 mug/mL puromycin 48h after transfection;

5. after screening for 48 hours, the culture medium is changed into a common complete culture medium for culture; the solution was changed 1 time every 2 days.

6. Monoclonal cell clusters of porcine subcutaneous adipocyte precursor cells appeared after 4-6 days of selection culture (FIG. 2).

7. The obtained cell monoclonal is subjected to digestion and amplification culture and then is subjected to immortalized cell identification.

(III) morphology observation and identification of immortalized porcine subcutaneous fat precursor cells

1, identifying the expression of hTERT: and (3) selecting 12 monoclonal cell strains obtained in the step (II), carrying out trypsinization on the monoclonal cell strains, transferring the monoclonal cell strains to a 12-hole cell culture plate for culture, carrying out amplification culture, and carrying out semi-quantitative detection on hTERT gene expression (the semi-quantitative identification is carried out according to a conventional RT-PCR method), wherein the designed specific primers of the hTERT are as follows:

hTERT-F GACCTCCATCAGAGCCAGTC

hTERT-R GTTCTTGGCTTTCAGGATGG

the PCR system comprises 10 muL of 2X T5 PCR Mix, 0.5 muL of hTERT-F, 0.5 muL of hTERT-R, 1 muL of cDNA and H₂O:3μL；

The PCR reaction procedure is (1) pre-denaturation at 95 ℃ for 3 min; (2) denaturation at 95 ℃ for 10s, annealing at 60 ℃ and extension for 10s for 40 cycles; (3) storing at 72 deg.C for 2min and 4 deg.C. 95 ℃ for 3min, 95 ℃ for 10s, 60 ℃ for 10s, 72 ℃ for 15s (35 cycles), 72 ℃ for 2min, 4 ℃ for storage.

The PCR product was 262bp in length, and the expression of hTERT gene was found in 1-12 monoclonal cell lines except the 10 th line (FIG. 3). In the subsequent study, the cells except the 10 th cell line were cultured at 37 ℃ under 5% CO₂Culturing in an incubator.

2. Morphology feature observation of immortalized cells: carrying out subculture on the cell strain for identifying the expression of the hTERT, taking the 8 th generation of immortalized subcutaneous adipose precursor cells for morphological observation, finding that the cell morphology is uniform, a large number of spindle-shaped cells can be attached to the wall after 24h (figure 4A), the cells begin to stretch and deform after 48h, most of the cell morphology is long spindle-shaped or star-shaped, and the few cells are irregular triangles (figure 4-B); cell proliferation was rapid after 72h, with a large increase in spindle and irregular cells (fig. 4C); the number of cells increased significantly from day 4 to day 5, reaching approximately 80%, and passaging was possible (FIG. 4D, E); the cells were morphologically elongated and tended to differentiate on day 6 (FIG. 4F).

3. Detecting and identifying the expression of the immortalized porcine subcutaneous fat precursor cell hTERT: the morphology of immortalized porcine subcutaneous adipocyte precursor cells is similar to that of primary porcine subcutaneous adipocyte precursor cells of previous generations, however, after 10 passages of primary adipocyte precursor cells, senescence begins and cytoplasm (cell volume) increases. In order to determine the activity of the immortalized porcine subcutaneous adipocyte precursor cells, the expression condition of hTERT in the immortalized cells of different generations (4, 10 and 30 generations) is detected by semi-quantitative PCR, and the PCR reaction system and conditions are the same as 1. the result shows that the hTERT gene is expressed in the immortalized cells of the 4 th, 10 th and 30 th generations (figure 5), and the hTERT gene which is still over-expressed in the immortalized adipocyte precursor cells of more than 30 generations is proved.

(IV) the proliferation activity of the immortalized porcine subcutaneous fat precursor cells is researched:

the proliferation activity of the established immortalized cinnabar subcutaneous fat precursor cells is mainly identified through MTT experiments, crystal violet staining, immunofluorescence Ki67, proliferation marker gene expression detection and other experiments.

The identification method of the MTT experiment comprises the following steps: seeding of passage 9 1X10 in 96-well plates⁴The immortalized porcine subcutaneous adipose precursor cells and the primary porcine subcutaneous adipose precursor cells are cultured in an incubator at 37 ℃ and 5% carbon dioxide. Cell proliferation was measured using MTT at

days

0,2,4,6, and 8. MTT assay was as follows: adding 50 mu L of prepared MTT working solution (5mg/ml in PBS) into each well, and incubating for 4h at 37 ℃ to reduce MTT into formazan; the incubation was terminated, the culture supernatant was carefully aspirated off the wells, the supernatant aspirated, 150. mu.L of DMSO was added to each well, shaking was carried out on a shaker for 10 minutes, and the absorbance was measured at 490 nm. And recording the result, and drawing a cell growth curve by taking time as an abscissa and converting the time into the number of cells according to the light absorption value as an ordinate. The results show that the proliferation of immortalized cells was significantly higher than the control cells (fig. 6).

2. The method for identifying cell proliferation by crystal violet staining comprises the following steps: inoculation of 1X10 in 6-well plates⁴After the primary pig adipose precursor cells and the immortalized pig subcutaneous adipose precursor cells are cultured in an incubator with 37 ℃ and 5% carbon dioxide for 3-5 days, the cells are washed by PBS for 1-2 times, 4% paraformaldehyde is added for fixation for 15min, then 0.1% crystal violet working solution (prepared by PBS) is used for staining for 15min, and observation and shooting are carried out after the cells are washed by PBS for three times. The results are shown in fig. 7, and the immortalized subcutaneous adipocyte precursor cells are more in number when compared with the primary cells by crystal violet staining, which indicates that the immortalized cells have faster proliferation rate.

3. The method for identifying cell proliferation by immunofluorescence staining comprises the following steps: washing the 10 th generation of immortalized subcutaneous fat precursor cells with PBS for one time, adding 4% paraformaldehyde for fixing for 15min, washing with PBS for three times, adding 0.1M glycine, standing for 10min at room temperature, washing with PBS for three times, adding 200 mu L of sealing solution into each hole, standing for 60min at room temperature, adding primary anti-Ki 67 (diluting with the sealing solution), and standing overnight at 4 ℃; the primary antibody is discarded the next day and washed with PBS for three times, the secondary antibody and HOCHST (PBS diluted) are added to stain for 45-60min in the dark at room temperature, the staining is carried out for three times with PBS, fluorescence shooting is carried out, and the mixture is stored for one week at 4 ℃. Ki67 is a marker protein for cell proliferation, and KI67 positive cells indicate that the cells are in a proliferative state. FIG. 8 shows that immortalized porcine subcutaneous adipocyte precursor cells have better proliferative capacity.

4. The method for quantitatively identifying cell proliferation by fluorescence comprises the following steps: after the cells are cultured by passage (generation 20), total RNA is extracted by using Trizol reagent, and the expression of proliferation marker genes DHFR and KI67 is detected by using fluorescent quantitative PCR. The fluorescent quantitative PCR primers are respectively as follows:

DHRF-F:GGTGATTATGGGTAGGAAGACCT

DHRF-R:ATTCTGGCTGCTCAGTAAGTTTT

Ki67-F:GCACCAGGCTTTACGGAAG

Ki67-R:ATTTTAGCCACTTCTGACTTTCG

PCR amplification System: SYBR Rox (2X) 5. mu.L, Forward primer (10. mu. mol/L) 0.2. mu.L, Reverprimer (10. mu. mol/L) 0.2. mu.L, DNA template 1. mu.L, dd H₂O 3.6μL，Total 10μL。

Amplification conditions: (1) pre-denaturation at 95 ℃ for 10 s; (2) denaturation at 95 ℃ for 5s, annealing and extension at 60 ℃ for 30s and fluorescence signal acquisition for 40 cycles. The primer sequences for amplifying the DHFR and ki67 genes are respectively as follows:

the fluorescent quantitative detection result shows that compared with primary control cells, the expression of DHFR (figure 9) and KI67 (figure 10) in the immortalized subcutaneous adipose precursor cells is obviously improved, and further, the immortalized cells have stronger proliferation capacity.

(V) research on differentiation of immortalized porcine subcutaneous adipocytes

And (3) inoculating the immortalized cells after 20 generations to a 12-pore plate, inducing and differentiating the cells by using a adipogenic induction culture medium after the cells are completely fused, and testing the polyester differentiation capacity of the cells. The induction medium consists of: 50nmol/L Insulin, 100nmol/L Dex, 0.25mmol/L IMBX and 100nmol/L rosiglitazone were added to the complete medium. The first day of induction was recorded as 0 day, the induction medium was induced for 4 days, and then the differentiation medium (50 nmol/L Insulin in DMEM complete medium) was used for 4 days. After 8 days of induced differentiation, numerous small lipid droplets began to aggregate and fuse, increased in volume, formed large lipid droplets within the cells, and were then identified by oil red O staining.

And (3) dyeing and identifying oil red O: firstly, preparing oil red O storage solution, dissolving 0.5g of oil red in 100mL of isopropanol for ultrasonic dissolution, filtering by using filter paper, and then placing in a palm bottle for storage. The oil red O working solution is used as a ready-to-use preparation, is uniformly mixed and stands for 10min according to the proportion of 6mL of stock solution and 4mL of water, and is used after being filtered by filter paper. After the cells in the six-well plate were washed once with PBS, 4% paraformaldehyde was added for fixation for 20min, after the paraformaldehyde was discarded, 1.5mL of working solution was added to each well for staining for 20min, after staining, 60% isopropyl alcohol was used for two times, the cells were stored in 60% glycerol for photography, and after the differentiated immortalized cells were stained with oil red O, orange mature adipocytes were visible (fig. 11). From FIG. 11, it is understood that lipid droplets are produced upon addition of the adipogenic induction medium. Indicating that the immortalized cell line is an adipocyte cell line.

(VI) researching differentiation related gene expression by using immortalized porcine subcutaneous fat precursor cells

After the immortalized subcutaneous fat precursor cells after passage of 20 generations are induced and differentiated, the expression of mature fat marker genes PPAR gamma, C/EBP a and AdipoQ is identified by fluorescent quantitative detection. The fluorescent quantitative primers are as follows:

PPARγ-F TGTGGACCTGTCGGTGATG

PPARγ-R TGGAGTGGAAATGCTGGAGA

C/EBPa-F GGTGGACAAGAACAGCAACG

C/EBPa-R TCACTGGTCAGCTCCAGCAC

AdipoQ-F ACGGTCTACTTGAAGGATGTGA

AdipoQ-R TCCAGATAGAGGAGCACAGAG

according to FIG. 12, it can be known that after differentiation, the polyester related genes PPAR-gamma, C/EBP β and AdipoQ are increased significantly compared with those before differentiation, which indicates that the immortalized cell line can be used as a cell model for the related researches such as differentiated polyester gene expression, lipid metabolism regulation and the like.

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Zhejiang university

Construction method and application of pig subcutaneous fat precursor cell immortalized cell line

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gacctccatc agagccagtc 20

<210>2

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gttcttggct ttcaggatgg 20

<210>3

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ggtgattatg ggtaggaaga cct 23

<210>4

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

attctggctg ctcagtaagt ttt 23

<210>5

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gcaccaggct ttacggaag 19

<210>6

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

attttagcca cttctgactt tcg 23

Claims

1. A method for constructing an immortalized cell line of subcutaneous adipocyte precursor of pig belongs to a method for constructing the immortalized subcutaneous adipocyte precursor of pig by stable hTERT transfection, which is characterized by comprising the following steps:

1) digesting with 0.15% type I collagenase to obtain primary subcutaneous fat cells of the pig, and inoculating subcutaneous fat precursor cells of the pig;

3) and the screening method and the period are as follows: screening with DMEM medium containing 30% serum of 4 mug/mL puromycin 48 +/-2 h after transfection;

4) after screening for 48 +/-2 hours, changing the culture solution into a DMEM culture medium for culture; screening and culturing for 4-6 days to obtain monoclonal cell clusters of subcutaneous fat precursor cells of the pigs;

5) and carrying out pancreatin digestion and separation on the screened monoclonal cell clusters, and respectively carrying out amplification culture and hTERT gene expression detection, proliferation and differentiation function identification to finally obtain the porcine subcutaneous adipocyte precursor immortalized cell line.

2. The method for constructing the immortalized cell line of porcine subcutaneous adipocyte precursor cells according to claim 1, wherein:

the hTERT gene expression detection is semi-quantitative detection, comprises the steps of designing a semi-quantitative PCR primer of a specific hTERT gene, wherein the length of a PCR product is 262bp, and adopting the semi-quantitative PCR to detect the hTERT gene expression condition in different generations of porcine adipose precursor cell immortalized cells:

specific semi-quantitative PCR primers of hTERT are as follows:

hTERT-F： GACCTCCATCAGAGCCAGTC

hTERT-R：GTTCTTGGCTTTCAGGATGG。

3. the method for constructing the immortalized cell line of porcine subcutaneous adipocyte precursor cells according to claim 1, wherein: designing specific fluorescent quantitative PCR primers of pig proliferation marker genes DHFR and KI67, and detecting the expression conditions of pig DHFR and KI67 by adopting fluorescent quantitative PCR; the fluorescent quantitative PCR primers for specifically amplifying the pig DHFR and the KI67 are respectively as follows:

DHRF-F: GGTGATTATGGGTAGGAAGACCT

DHRF-R: ATTCTGGCTGCTCAGTAAGTTTT

Ki67-F: GCACCAGGCTTTACGGAAG

Ki67-R: ATTTTAGCCACTTCTGACTTTCG。