CN113502269B

CN113502269B - Method for inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering UBA2 expression

Info

Publication number: CN113502269B
Application number: CN202110583545.XA
Authority: CN
Inventors: 丁向彬; 张钰婷; 于州; 王轶敏; 张林林; 李新; 郭益文; 郭宏
Original assignee: Tianjin Agricultural University
Current assignee: Tianjin Agricultural University
Priority date: 2021-05-27
Filing date: 2021-05-27
Publication date: 2022-10-11
Anticipated expiration: 2041-05-27
Also published as: CN113502269A

Abstract

The invention discloses a method for inhibiting the proliferation and the myoblast differentiation of bovine skeletal muscle satellite cells by interfering the expression of UBA2, which realizes the inhibition of the proliferation and the myoblast differentiation of bovine skeletal muscle satellite cells by interfering the expression of UBA2, wherein the genome base sequence of the UBA2 is as follows: SEQ NO.1. The method provided by the invention regulates and controls the proliferation and myoblast differentiation process of bovine muscle satellite cells by changing UBA2 expression, can provide revelation for the study of ubiquitin-like modifier activating enzyme of muscle development differentiation, and provides new ideas and references for clinical study and diagnosis and treatment of muscle development differentiation and injury repair.

Description

Method for inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering UBA2 expression

Technical Field

The invention belongs to the technical field of biology, cell and tissue engineering, and particularly relates to a method for inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering UBA2 expression.

Background

Skeletal muscle satellite cells (skeletal muscle satellite cells) are flat and protruded cells in skeletal muscle, which are usually in a resting state between the myofibrillar sarcolemma and the basement membrane and can be activated under certain conditions, and can proliferate, differentiate and fuse into mature myotubes or myofibrils, and the muscle satellite cells play an important role in the growth, development and regeneration of the postnatal muscles of animals. The in vitro proliferation and myoblast differentiation process of the muscle satellite cell well simulates the in vivo muscle development process, and is a good cell model for researching cell differentiation and muscle development. The activation, proliferation and myogenic differentiation processes of the muscle satellite cells are regulated and controlled by various factors, and the proliferation and myogenic differentiation regulation and control mode of the skeletal muscle satellite cells can be known, so that the possibility of artificially controlling the formation of the muscle cells can be increased.

The process of muscle differentiation and growth and development is the result of interaction of various signals in the internal heredity, the epigenetics and the external, the process of skeletal muscle development and differentiation relates to the expression of multiple genes, signal paths and network regulation, the process is extremely complex, and the regulation and control function of ubiquitin-like modifier activating enzyme is more and more emphasized. Ubiquitin-like modifier activating enzyme 2 (ubiquitin in like modifier activating enzyme 2, UBA2) is also called SUMO activating enzyme 2 (SUMO-activating enzyme 2, SAE2), is an important component of E1 enzyme (a heterodimer consisting of AOS1 and UBA 2) in the SUMO system, and can directly influence the SUMO level in human body. The bovine UBA2 gene is located on chromosome 18, and in recent years, a plurality of researches report the relevance of UBA2 gene or UBA2 protein abnormality and clinical diseases. Small ubiquitin-related modifiers (SUMO) are ubiquitin-like molecules that reversibly modify translated proteins and have the ability to modulate target protein stability, localization, and interaction with other proteins. In addition, SUMO is involved in a variety of physiological processes including DNA repair, regulation of cell proliferation and apoptosis, and maintenance of genomic integrity. The inventor conducts muscle proteomics analysis on MSTN-/-cattle and wild cattle in earlier research to find that UBA2 has significant difference between the MSTN-/-cattle and the wild cattle, and the inventor suggests that UBA2 may have a certain regulation and control effect on muscle development and differentiation. UBA2 is an important component of E1 enzyme (heterodimer composed of AOS1 and UBA 2) in SUMO system, SUMO cycle includes multiple processes such as activation, binding, ligation, modification and dissociation, including participation of multiple enzymes such as SUMO-activating enzyme E1 (also called AOS1-UBA2 or SAE1-SAE 2), SUMO-binding enzyme E2 (UBC 9), SUMO-ligase E3 and SUMO protease (SUMO-specific proteases, SENPs). It has been shown that down-regulation of UBA2 expression in colorectal cancer can inhibit migration and invasion of colorectal cancer cells, as well as inhibit cell proliferation and induce apoptosis. In addition, inhibition of UBA2 expression may induce disruption of promyelocytic leukemia (PML) nuclei, promoting apoptosis or senescence. The current reports on modifications of UBA2 and SUMO are in various tumors, while no reports have been found on the related studies of UBA2 in the proliferation and myogenic differentiation of bovine myosatellite cells.

Through searching, no patent publication related to the present patent application has been found.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a method for inhibiting the proliferation and myogenic differentiation of bovine skeletal muscle satellite cells by interfering the expression of UBA 2.

The technical scheme adopted by the invention for solving the technical problems is as follows:

a method for inhibiting proliferation and myogenic differentiation of bovine skeletal muscle satellite cells by interfering with UBA2 expression, wherein the genomic base sequence of UBA2 is: SEQ NO.1.

Further, the concrete steps are as follows:

according to the UBA2 base sequence, si-RNA of UBA2 is designed and synthesized, the si-RNA is used for transfecting bovine skeletal muscle satellite cells, the expression level of UBA2 is reduced, and the inhibition of the proliferation and myogenic differentiation of the bovine skeletal muscle satellite cells is realized.

Further, the gene sequence of the si-RNA is: SEQ NO.2, SEQ NO.3 or SEQ NO.4.

Further, the method of interfering with the expression level of UBA2 comprises: plasmids, viral vectors or gene knockouts that interfere with expression of UBA2 are employed.

The invention has the advantages and positive effects that:

1. the method provided by the invention can regulate and control the proliferation and myoblast differentiation process of the bovine muscle satellite cells by changing UBA2 expression, can provide revelation for the study of ubiquitin-like modifier activating enzyme of muscle development differentiation, and provides new ideas and references for the clinical study and diagnosis and treatment of muscle development differentiation and injury repair.

2. The method for inhibiting the proliferation and myoblast differentiation process of bovine skeletal muscle satellite cells by changing the expression of UBA2 can effectively regulate and control the muscle development and differentiation process, can provide a certain reference for the utilization of UBA2 in muscle development and differentiation and injury repair, and provides a new idea and reference for the clinical research and diagnosis and treatment of muscle development and differentiation and injury repair.

3. Considering that whether UBA2 has a certain regulation effect on bovine skeletal muscle satellite cells and the specific effect is not clear at present, the invention designs and synthesizes si-RNA of UBA2, then uses lip3000 reagent to transfect the bovine skeletal muscle satellite cells, interferes the expression level of UBA2 in the bovine skeletal muscle satellite cells, and inhibits the proliferation and myogenic differentiation processes of the bovine skeletal muscle satellite cells by changing the expression of UBA2 in the bovine skeletal muscle satellite cells. By means of the method, reference can be provided for UBA2 utilization in muscle development differentiation and injury repair, and a new thought and a new method are provided for clinical research and diagnosis and treatment of muscle development differentiation and injury repair.

4. The present inventors conducted previous studies on MSTN ^-/- Muscle proteomics analysis of cattle and wild-type cattle shows that ubiquitin-like modifier activating enzyme UBA2 (ubiquitin like modifier activating enzyme 2, UBA 2) is in MSTN ^-/- Significant differences exist between cattle and wild cattle, and the UBA2 is suggested to have a certain regulation and control effect on muscle development and differentiation. The invention selects UBA2 to carry out regulation and control research on proliferation and myogenic differentiation, aims to establish a method for influencing the proliferation and myogenic differentiation process of bovine skeletal muscle satellite cells by changing the expression of UBA2 in the bovine skeletal muscle satellite cells, and provides a new thought and method for the regulation and control research on ubiquitin-like modifier activating enzyme of muscle development and differentiation.

Drawings

FIG. 1 is a graph showing the results of quantitative qRT-PCR assays of the effect of si-RNA of UBA2 in bovine skeletal muscle satellite cells on the expression level of UBA2 in accordance with the present invention; detecting the mRNA expression level of UBA2 in bovine skeletal muscle satellite cells by qRT-PCR;

FIG. 2 is a graph showing the effect of using si-RNA to interfere with UBA2 expression on bovine skeletal muscle satellite cell proliferation in accordance with the present invention; wherein A is a fluorescence image under an EDU detection fluorescence microscope; b is an EDU detection result visual schematic diagram; c is a result graph of mRNA expression levels of proliferation marker genes PAX7 and MyoD in bovine skeletal muscle satellite cells detected by qRT-PCR; d is a cell map of bovine skeletal muscle satellite cell proliferation for 24h under a light microscope;

FIG. 3 is a graph showing the effect of using si-RNA to interfere with UBA2 expression on bovine skeletal muscle satellite cell differentiation in the present invention; wherein A is a result graph of mRNA expression levels of a differentiation marker gene MyHC in bovine skeletal muscle satellite cells detected by qRT-PCR in 48h and 72h respectively; b is a protein expression level diagram of MyHC respectively in 48h and 72h after interference detection by Western blot; c is a Western blot detection visual schematic diagram; d is the myotube map of bovine skeletal muscle satellite cell differentiation for 48h and 72h under the light microscope.

Detailed Description

The present invention is described in detail below with reference to the following examples, which are intended to be illustrative and not limiting, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

Preferably, the specific steps are as follows:

Preferably, the si-RNA has the gene sequence: SEQ NO.2, SEQ NO.3 or SEQ NO.4.

Preferably, the method of interfering with the expression level of UBA2 comprises: plasmids, viral vectors or gene knockouts that interfere with expression of UBA2 are employed.

Specifically, the preparation and detection are as follows:

one design idea of the invention can be as follows:

and designing and synthesizing si-RNA of UBA2, and then transfecting the bovine skeletal muscle satellite cells by using a lip3000 reagent to interfere the expression level of UBA2 in the bovine skeletal muscle satellite cells, and inhibiting the proliferation and myogenic differentiation process of the bovine skeletal muscle satellite cells by changing the expression of UBA2 in the bovine skeletal muscle satellite cells.

A method of inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering with UBA2 expression comprising the steps of:

the method comprises the steps of first step, bovine skeletal muscle satellite cell separation and culture, establishment of an in vitro myogenic induced differentiation model, UBA2 interfering RNA (si-RNA) design synthesis and interference effect detection.

Separating the bovine skeletal muscle satellite cells by adopting a combined digestion method of pancreatin and collagenase, and establishing a bovine skeletal muscle satellite cell in-vitro myoblast induced differentiation model. 3 si-RNAs are designed and synthesized according to UBA2 base sequences, bovine skeletal muscle satellite cells are transfected respectively, the expression level of UBA2 is detected by adopting a quantitative PCR method, and the interference effect of the si-RNAs on the UBA2 is detected.

The method comprises the following specific steps:

(1) Bovine skeletal muscle satellite cell isolation culture and establishment of in vitro myogenic induced differentiation model.

The bovine skeletal muscle satellite cells are separated by adopting a combined digestion method of pancreatin and collagenase. Collecting hind limb muscle of cattle fetus under aseptic condition, cutting into proper size, washing in PBS buffer solution for several times, sufficiently cutting into pieces with ophthalmic scissors in culture dish, washing with preheated PBS buffer solution once, centrifuging at 1000r/min in centrifuge for 5min, discarding supernatant, adding 5mL of 0.2% collagenase II, digesting in water bath at 37 deg.C for 1h while vortexing for 10s every 10min, adding 0.25% pancreatin for 30min while vortexing for 10s every 10min, adding 3-4mL of serum-containing medium (20 FBS 80 DMEM) to terminate digestion, sieving the above mixed solution with 100 mesh, 200 mesh and 400 mesh cells in sequence, collecting filtrate in 50mL centrifuge tube, centrifuging in centrifuge tube with 100 mesh, 200 mesh and 400 mesh cells in sequence, collecting filtrate in 50mL centrifuge tubeCentrifuging at 1000r/min for 10min, resuspending with culture medium, inoculating into suitable culture dish, and removing CO 5% at 37 deg.C ₂ Culturing in an incubator. Culturing in DMEM growth medium containing 20% fetal calf serum, adding DMEM differentiation medium containing 2% horse serum when the cells grow to 80% fusion to perform in vitro myogenic induced differentiation, observing myosatellite cell differentiation condition and myotube formation state, and establishing a bovine skeletal muscle satellite cell in vitro myogenic induced differentiation model.

(2) Genomic nucleotide sequence of UBA2 (2671 bp): SEQ NO.1

GGCTCGTGGTCGTCCCGCCATGGCACTGTCGAGGGGGCTACCCCGGGAACTGGCTGAGGCCGTGGCCGGGGGCCGGGTCCTGGTGGTGGGGGCGGGAGGCATCGGCTGCGAGCTCCTCAAAAACCTCGTGCTCACC

GGCTTCTCCCACATCGACCTGATTGATCTGGATA

CTATTGATGTCAGCAACCTCAACAGGCAGTTTTTGTTTCAAAAGAAACATGTTGGAAGATCAAAGGCCCAGGTTGCCAAAGAGAGTGTCCTGCAGTTTTACCCGAAAGCTAATATCGTAGCCTACCATGACAGCATTATGAACCCTGACTATAATGTGGAATTTTTTCGACAATTTATATTGGTTATGAATGCTTTAGATAACAGAGCTGCCCGCAACCATGTTAATAGAATGTGTCTAGCAGCTGATGTCCCTCTTATTGAGAGTGGAACTGCTGGTTATCTTGGGCAAGTAACCACTATCAAAAAGGGTGTGACCGAGTGTTACGAATGCCATCCCAAACCAACCCAGAGAACTTTT

CCTGGCTGTACAATTCGTAACACACCTTCAGAACCTATTCATTGCATTGTC

TGGGCGAAATATTTGTTCAACCAGTTGTTTGGAGAAGAAGATGCTGATCAAGAAGTATCTCCTGACAGAGCTGACCCTGAAGCTTCCTGGGAACCAATGGAAGCCGAAGCCAGAGCCAGAGCATCTAATGAAGATGGTGACATTAAACGTGTTTCCACCAAGGAGTGGGCTAAATCAACTGGATATGATCCAGTTAAACTTTTTACCAAGCTTTTTAAAGATGATATCAGATATCTGTTGACGATGGACAAACTATGGCGGAAAAGGAAACCTCCAGTTCCATTGGATTGGGCTGAAGTGCAAAGTCAAGGAGAAGAAACCAGTGCATCAGATCAACAAAACGAACCCCAGTTAGGTCTGAAAGACCAGCAGGTTCTAGATGTCAAGAGCTATGCATGTCTTTTTTCAAAGAGCATTGAGACTTTGAGAGTTCATTTAGCAGAAAAGGGGGATGGAGCTGAGCTCATATGGGACAAGGATGACCCATCTGCAATGGATTTTGTCACCTCTGCTGCAAATCTCAGGATGCATATTTTCAGTATGAATATGAAAAGCAGATTCGATATCAAATCAATGGCAGGGAACATTATTCCTGCTATCGCTACTACTAATGCAGTGATTGCTGGGTTG

ATAGTATTGGAAGGATTGAAGATTTTATCAGGAAAAATAGACCAGTGTAGAACAATTTTTTTGAATAAACAACCAAACCCAAGAAAGAAGCTTCTTGTGCCTTGTGCACTGGATGCTCCCAATCCTAACTGTTACGTATGTGCCAGCAAGCCAGAGGTGACTGTGCGGCTGAATGTTCATAAAGTGACGGTTCTCACCTTACAAGATAAGATTGTGAAAGAAAAATTTGCTATGGTAGCACCAGATGTCCAAATTGAAGATGGAAAAGGAACAATCCTAATATCTTCAGAAGAGGGAGAGACAGAAGCTAATAATCACAAGAAATTGTCAGAATTTGGAATTAGAAATGGGAGCCGACTTCAAGCAGATGACTTCCTTCAGGACTACACTTTATTGATCAACATCCTTCATAGTGAAGACCTAGGAAAGGATGTTGAATTTGAAGTTGTTGGTGATGCCCCAGAAAAAGTGGGGCCCAAGCAAGCTGAAGATGCTGCCAAAAGCATAACCAATGGCAGCGACGATGGAGCTCAGCCTTCCACATCCACAGCACAAGAGCAAGATGATGTGCTCATAGTTGATTCGGATGAAGAAGGTCCCTCAAATAATGCTGATATCAGTGAAGAAGAAAGAAGTCGCAAGAGGAAGCTAGATGAGAAAGAGAGTGTCAGTGCGAAAAGGTCACGCATAGAGCAGGCAGAGGAGCTTGATGAGGTTATAGCATTAGATTGAACAGAAATGCCTCTGAACGGAACCTCTTACTCCATTAAGGCCTTCTGGGCAGAACCAGGTTATTTGTTACGTCCTTTGTTCCAAAGGGAAAATATTGACACCAGTGACTTGAAGATGATTCTGCTCCCTTTGAAAGCATTCATTTTGCTAGAACTATTAGAAACATTGCAGTATGCTGTATTGAAAGTAGGAATATAGTTTTAAAACCCTTTGAACAAAGTATGTGCATAACCAGTCCATGAGATGAAACAACACCGTGCATGTTGCCTTTTTAATGTAAATACCCTTCGGTATCATTTAACAGTTTTAAAATATTGTGGTTTAGTAAAGTTGATACCTGGTTATAAATATTATGCCTTTATTTTTGGTTAGAAGAAGAATTATTTTTAGCCTAGATCTAACCATTTTCATACTCTTAACTGACTGAAACAGATTCAAAGAAGTATCGAGTGCTATGCATTGAAACTTGTTTTTAAATGTTAACTGGCACTATGTATATTAATGTAAAACAGTTGTTAATTTACTCAAGTTTTCAGCTTGTACTGCCTGGTATGTCTGTGTAAGAAGCCAATTTTTGTGTATTGTTACAGTTTCAGGTTATTTATATTTGATGTTTTGTAAAACTCAAATACAACTATACTGTACTTATGGACCAAATAAATGACATCTGCATACTTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA

(3) UBA2 interfering RNA (si-RNA) design synthesis and interference effect detection

The method comprises the following specific steps:

3.1UBA2 interfering RNA (si-RNA) design synthesis.

3 si-RNAs (si-UBA 2-1, si-UBA2-2, si-UBA 2-3), (si-UBA 2-1 (SEQ NO.2: GCATTATGAACCTGACTA), si-UBA2-2 (SEQ NO.3: CAACCAACCCAAGAAGA), and si-UBA2-3 (SEQ NO.4: GGTGACATTAAAACGTTT) were designed based on the UBA2 base sequence using si-RNA design software and synthesized by a biological company.

3.2 detection of the effect of si-RNA interference on UBA2 expression.

Transfecting the 3 si-RNAs of UBA2 with a lip3000 reagent respectively to obtain bovine skeletal muscle satellite cells, inoculating the bovine skeletal muscle satellite cells into a 60mm cell culture dish respectively, culturing with a growth medium, preparing transfection when the cell growth density is 70-80%, and replacing the medium with a growth medium without antibiotics one day before transfection. Transfection was performed with si-RNA and a negative control at a final concentration of 50nM, according to the recommended concentrations in the reagent instructions. When transfection is carried out, the culture medium is replaced by a serum-free Opti-MEM culture medium, the si-RNA or the corresponding negative control is mixed in 50 mu L of the Opti-MEM culture medium, simultaneously 0.75 mu L of lip3000 transfection reagent is mixed in 50 mu L of the Opti-MEM culture medium, standing is carried out for 5min respectively, 50 mu L of the Opti-MEM culture medium containing the si-RNA or the corresponding negative control is added in the Opti-MEM culture medium containing the Roche transfection reagent, the mixed solution is gently mixed and uniformly mixed and then stands for 15min, the mixed solution is uniformly dripped into a 60mm cell culture dish, and the dripping volume of the mixed solution is based on the final concentration of the si-RNA or the corresponding negative control. After 24h of transfection, total RNA of transfected cells is extracted by adopting a cell RNA rapid extraction kit, and the expression of UBA2 is detected by adopting a real-time fluorescent quantitative PCR method, wherein the operations of total RNA extraction, reverse transcription of RNA and quantitative PCR are as follows.

And extracting the total RNA of the proliferated and differentiated cells by adopting a cell RNA rapid extraction kit. The extraction step comprises: 350 μ L of cell lysate was added to a 24-well cell culture plate and repeatedly pipetted until the cells were sufficiently lysed. After observing the complete lysis of the cells under a microscope, the above lysate was collected into a 1.5ml RNase-free tube. The lysis mixture was applied to the DNA clean-up column in its entirety. Centrifuge at 13000rpm for 60s at once. The volume of the filtrate was accurately estimated using a micropipette, an equal volume of 70% ethanol was added, and the mixture was immediately shaken and mixed without centrifugation. The mixture was immediately added to an adsorption column RA, centrifuged at 13000rpm for 30s and the waste liquid discarded. Add 700. Mu.L of deproteinizing solution RW1, stand at room temperature for 1 minute, centrifuge at 12000rpm for 30 seconds, and discard the waste liquid. Add 500. Mu.L of the rinsing solution RW, centrifuge at 12000rpm for 30s, and discard the waste solution. Add 500. Mu.L of the rinse RW and repeat. The adsorption column RA was returned to empty and collected, and centrifuged at 13000rpm for 2 minutes to remove the rinse as much as possible so as to prevent the residual ethanol in the rinse from inhibiting the downstream reaction. The adsorption column RA was taken out and put into an enzyme-free centrifuge tube, and 30 to 50. Mu.L of enzyme-free water was added to the middle part of the adsorption membrane according to the expected RNA yield, and the membrane was left at room temperature for 1 minute and centrifuged at 12000rpm for 1 minute.

RNA reverse transcription system and conditions:

to prepare 20. Mu.L of a mixed solution.

Vortex, shake and mix evenly, centrifuge briefly, collect the solution on the tube wall to the bottom of the PCR tube.

Placing the prepared mixed solution on a PCR instrument, and setting a program: the incubation was first carried out at 42 ℃ for 15min and then at 85 ℃ for 5min. After the above procedure was completed, the mixture was centrifuged briefly, and the reverse transcribed cDNA mixture was taken out and cooled on ice.

(1) Quantitative PCR detection system:

preparation of reaction solution: and (3) preparing reaction liquid on ice, carrying out a multi-hole experiment on detection indexes in each sample, carrying out a single-hole NTC experiment, and carrying out quantitative PCR detection by adopting a white 8 connecting pipe.

The reaction solution in each single tube of the 8-tube tubes was configured as follows:

total 20. Mu.L reaction volume

Reaction conditions for qRT-PCR:

and (3) after the reaction solution is fully and uniformly mixed, centrifuging to enable the reaction solution to reach the bottom of the reaction tube, and placing on a real-time fluorescent quantitative PCR instrument. The specific reaction design procedure is as follows:

pre-denaturation: 60s at 95 DEG C

Denaturation: at 95 deg.C for 10s

And (3) annealing: at 61 deg.C for 20s

Extension: at 72 deg.C for 15s

The denaturation to annealing step was repeated 35 times.

After the reaction is finished, a dissolution curve is drawn, and the temperature range of the detected fluorescence in the experiment is as follows: 65-95 ℃, the heating rate is 0.5 ℃/time cycle, and the constant temperature time is 10 s/time cycle.

After all reactions were completed, the reaction tube was kept at 37 ℃ for 30 seconds to prevent the reaction tube from being scalded when the reaction tube was taken out after the reaction was completed.

When the quantitative PCR detection method is used for detecting the expression quantity of the proliferation UBA2 gene, the adopted gene primers are as follows:

F-CCACCAAGGAGTGGGCTAAA, the nucleotide sequence of which is shown in SEQ NO. 5;

R-TGGAGGTTCCTTTTCCGCC, the nucleotide sequence of which is shown in SEQ NO. 6;

when the quantitative PCR detection method is used for detecting the expression quantity of other genes in the test, all adopted reference genes are GAPDH, and primers are as follows:

F-TGTTGTGGATCTGACCTGCC, the nucleotide sequence of which is shown in SEQ NO. 13;

R-AAGTCGCAGGAGACAACCTG, the nucleotide sequence of which is shown in SEQ NO. 14;

the sequences of the used primers are shown in Table 1, the detection results are shown in FIG. 1, the experimental results show that 3 si-RNAs have obvious interference effect on the expression of UBA2, the expression level of UBA2 is remarkably reduced (p is less than 0.01 compared with that of control NC), and the si-UBA2-2 effect can be best used for UBA2 expression regulation research.

TABLE 1UBA2 real-time quantitative PCR primer sequences

Second, interfering with the effect of UBA2 expression on bovine myosatellite cell proliferation:

transfecting bovine skeletal muscle satellite cells with si-RNA-2 to interfere the expression of UBA2, carrying out proliferation culture on the cells, and judging the influence of the interference of UBA2 expression on the proliferation of the bovine muscle satellite cells through the cell proliferation state and related tests; the method comprises the following specific steps:

the si-UBA2-2 of UBA2 was transfected into bovine skeletal muscle satellite cells using lip3000 reagent in the same manner as for the si-RNA transfection in the first step.

Detecting the mRNA level expression quantity of bovine skeletal muscle satellite cell proliferation marker genes PAX7 and MyoD by adopting a real-time fluorescent quantitative PCR method; RNA extraction and reverse transcription and quantitative PCR operation were performed according to the kit instructions, and the specific operation was the same as in the first step.

When the quantitative PCR detection method is used for detecting the expression quantity of the proliferation marker gene PAX7, the adopted gene primers are as follows:

F-AGCCAGAGTTTCAACGGGAG, the nucleotide sequence of which is shown in SEQ NO. 7;

R-GTCGCCAACAGACAACACAC, the nucleotide sequence of which is shown in SEQ NO. 8;

when the quantitative PCR detection method is used for detecting the expression quantity of the proliferation marker gene MyoD, the adopted gene primers are as follows:

F-GACGGCTCTCTGCAACTT, the nucleotide sequence of which is shown in SEQ NO. 9;

R-CGGCGCGGATCCAGGT, the nucleotide sequence of which is shown in SEQ NO. 10;

the primer sequences used are shown in Table 1, GAPDH as internal reference.

Detecting the influence of interfering UBA2 expression on the bovine muscle satellite cell proliferation by adopting an EdU cell proliferation experiment; the EdU cell proliferation assay was performed as follows:

inoculating bovine skeletal muscle satellite cells after passage into a 96-well plate, performing proliferation culture for 24h after treatment according to test groups, adding 100 mu L of 50 mu mol/L EdU culture medium, incubating at 37 ℃ for 2h, washing the cells with PBS for 2 times, adding 50 mu L of cell fixing solution for fixing for 30min, adding 50 mu L of 2mg/mL glycine, washing the cells with PBS for 2 times after decoloration for 5min, and then adding 100 mu L of cell fixing solution

The reaction solution was stained, incubated at room temperature for 30min in the dark, discarded, washed with 100. Mu.L of formaldehyde for 5min, and washed with PBS for 2 times. 100 μ L of DAPI reaction solution was added, protected from light, incubated at room temperature for 30min, washed with PBS for 2 times, and finally retained in PBS. The number of EdU-positive cells was examined under a fluorescence microscope and 3 replicates per biological sample were collectedFor each field, proliferation rate was calculated from the number of EdU-positive cells/number of DAPI-labeled cells.

After 24h of proliferation culture, the cell proliferation status was observed under a light microscope, and a cell light microscope image (see the result in FIG. 2) was photographed, from which it was seen that the number of myosatellite cells transfected with si-UBA2-2 was reduced as compared with the control group (si-RNA-NC). The results of the above tests are shown in fig. 2, (. Sup.p <0.05 compared with control NC), and the expression levels of proliferation marker genes PAX7 and MyoD were significantly reduced in the myosatellite cells transfected with si-UBA2-2 compared with the control group (si-RNA-NC). The results of the proliferation rate calculation based on the number of EdU-positive cells/number of DAPI-labeled cells show a significant decrease in the positive cell rate of si-UBA 2-transfected myosatellite cells compared to the control group (si-RNA-NC). .

Thirdly, interfering the influence of UBA2 expression on bovine muscle satellite cell differentiation:

bovine skeletal muscle satellite cells transfected with si-RNA-2 interfere with UBA2 expression, and after proliferation culture of the cells, the cells are induced to differentiate. Judging the influence of interfering UBA2 expression on the differentiation of the bovine muscle satellite cells through the state of cell differentiation and related tests; the method comprises the following specific steps: the proliferation medium was changed to the differentiation medium, and the myogenic induction culture was continued, and the state of cell differentiation was observed under a light microscope, and the photo-images of the cells were stored by photographing at the corresponding periods, respectively (see FIG. 3 for the results). The RNA and protein were collected during differentiation (48 h and 72 h), total RNA extraction, reverse transcription of RNA and quantitative PCR were performed as in the first step, and the primer sequences used are shown in Table 1, GAPDH as internal reference.

When the quantitative PCR detection method is used for detecting the expression quantity of the differentiation marker gene MyHC, the adopted gene primers are as follows:

F-CTGGAATCCGGAGGCAGAA, the nucleotide sequence of which is shown in SEQ NO. 11;

R-TTTTCGAAGGTAGGGAGCGG, the nucleotide sequence of which is shown in SEQ NO. 12;

and detecting the expression level of the bovine skeletal muscle satellite cell differentiation period protein MyHC.

Extracting protein of bovine skeletal muscle satellite cells in the proliferation and differentiation periods, measuring the protein concentration by using a BCA method, preparing an upper layer glue and a lower layer glue, adding 4mL of the lower layer glue into a glass plate gap, adding ethanol to the top end of the plate, pouring out the ethanol after 10min, and slightly dipping a small amount of residual ethanol by using filter paper. (care should not leak glue). Adding 2mL of the upper layer glue into the upper layer of the separation glue, and inserting a comb. Denaturation of protein samples was carried out with waiting time, protein loading required 20-30. Mu.g, 4 XPro buffer diluted to 1 XPro with PBS and boiled at 100 ℃. And (3) taking off the prepared rubber plate, placing the rubber plate on an electrophoresis rack (paying attention to the fact that the short glass plate needs to be aligned with the green sponge of the rack to prevent air leakage), installing the rubber plate and placing the rubber plate into an electrophoresis tank, filling electrophoresis liquid into the electrophoresis tank, filling the electrophoresis liquid by using a 10 mu L gun, and recording the filling sequence. In the large tank, electrophoresis liquid is added by half. (recovering electrophoresis liquid after electrophoresis, preparing electrophoresis liquid, namely directly diluting 5X electrophoresis liquid to 1X, namely taking 200mL of 5X electrophoresis liquid, and fixing the volume to 1000 mL.) electrophoresis is carried out for 30-40min at 80V, and carrying out 120V electrophoresis for 1h, so that the strip runs to the lower green part. 80V electrophoresis for 30-40min,120V electrophoresis for 1h. The waiting time of electrophoresis is used for preparing electric transfer: electric rotary liquid, electric rotary groove and cover, 2 ice bags, ice blocks and basin. Adding the electrotransformation liquid into electrotransformation tanks, putting an ice bag into each electrotransformation tank, and then putting the electrotransformation liquid into a basin filled with ice-water mixture. White porcelain dish (little discharge liquid), glass rod, tweezers, green scraper blade, culture dish containing methanol. The filter paper is cut and slightly larger than the target gel, the PVDF membrane is soaked in methanol before membrane transfer, the upper filter paper and the lower filter paper cannot be contacted, and otherwise, the membrane transfer fails, so that the PVDF membrane is slightly larger than the filter paper. Placing a sandwich on one side of the white porcelain plate: upper white board-sponge-filter paper-glue-film (remove bubbles) -filter paper (remove bubbles) -sponge-lower blackboard. And (5) after electrophoresis is finished, closing the switch and taking down the rubber plate. The slab was placed on the other side of the white porcelain plate, pushed gently with the tip of a green squeegee, the small glass plate was lifted off, the gel was concentrated, and the gel strips of the mesh were cut with a green squeegee according to the 50kda and 223kda strips of the marker. The sandwich was placed in an electrical rotating bath with black plates against black (note the label for each plate). Film transferring conditions: 300mA is transferred into the film for 2h. The film transferring time is proper to prevent the film from being transferred too much. The top left corner of the glue was cut off and when viewed (exposed), the right corner was a notch because the tape was underneath the film when the film was rotated. Preparing sealing liquid and TBS cleaning liquid half an hour before the film transfer is finished: preparing a sealing liquid: weighing 10g of milk powder, adding 200ml of prepared TBST, and electromagnetically stirring. TBST 1.65ml Tween 20% +35mLTBS +700mL water. And (5) after the membrane is transferred, taking down the sandwich, putting the membrane into a dish containing sealing liquid, and sealing for at least 2 hours. And (5) incubating the primary antibody. The membrane was sealed in a hybridization bag, which was labeled, sealed and left overnight at 4 ℃. PBS was washed 5 times and secondary antibodies were incubated. PBS wash 5 times, expose for observation.

The cell differentiation state was observed under a light microscope in combination with the formation state of the myotubes of the cells (the cell light microscope images were stored by photographing at the corresponding periods respectively (the results are shown in FIG. 3)) and the effect of interfering UBA2 expression on the differentiation of the adult bovine myosatellite cells was judged in the relevant experiments, and from the light microscope images, the number and diameter of the myotubes of the myosatellite cells transfected with si-UBA2-2 tended to decrease compared with the control group (si-RNA-NC). The expression level of mRNA of the differentiation marker gene MyHC is quantitatively detected, the related detection result is shown in figure 3 (p is less than 0.01 compared with control NC), the expression level of the protein level of the differentiation marker gene MyHC is detected by Western blotting, the detection result is shown in figure 3 (p is less than 0.01 compared with control NC), compared with the control group (si-RNA-NC), the mRNA and protein level of the differentiation marker gene MyHC in the myosatellite cells after transfection of si-UBA2-2 are extremely reduced remarkably, the myogenic differentiation of the myosatellite cells can be inhibited by down-regulating UBA2, and the experimental result shows that UBA2 can positively regulate the proliferation and myogenic differentiation processes of bovine skeletal muscle satellite cells. The research results suggest that the expression of UBA2 related to muscle development and differentiation in the bovine skeletal muscle satellite cells is changed, and the proliferation and myogenic differentiation processes of the bovine skeletal muscle satellite cells can be influenced.

Of course, methods for altering the expression level of UBA2 include designing synthetic interfering RNA (si-RNA), and other means capable of altering the expression level of UBA2, including plasmids, viral vectors, and gene knock-outs that interfere with UBA2 expression.

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the disclosure of the embodiments and the accompanying drawings.

Sequence listing

<110> Tianjin college of agriculture

<120> a method for inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering with UBA2 expression

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2671

<212> DNA/RNA

<213> genome base sequence of UBA2 (Unknown)

<400> 1

ggctcgtggt cgtcccgcca tggcactgtc gagggggcta ccccgggaac tggctgaggc 60

cgtggccggg ggccgggtcc tggtggtggg ggcgggaggc atcggctgcg agctcctcaa 120

aaacctcgtg ctcaccggct tctcccacat cgacctgatt gatctggata ctattgatgt 180

cagcaacctc aacaggcagt ttttgtttca aaagaaacat gttggaagat caaaggccca 240

ggttgccaaa gagagtgtcc tgcagtttta cccgaaagct aatatcgtag cctaccatga 300

cagcattatg aaccctgact ataatgtgga attttttcga caatttatat tggttatgaa 360

tgctttagat aacagagctg cccgcaacca tgttaataga atgtgtctag cagctgatgt 420

ccctcttatt gagagtggaa ctgctggtta tcttgggcaa gtaaccacta tcaaaaaggg 480

tgtgaccgag tgttacgaat gccatcccaa accaacccag agaacttttc ctggctgtac 540

aattcgtaac acaccttcag aacctattca ttgcattgtc tgggcgaaat atttgttcaa 600

ccagttgttt ggagaagaag atgctgatca agaagtatct cctgacagag ctgaccctga 660

agcttcctgg gaaccaatgg aagccgaagc cagagccaga gcatctaatg aagatggtga 720

cattaaacgt gtttccacca aggagtgggc taaatcaact ggatatgatc cagttaaact 780

ttttaccaag ctttttaaag atgatatcag atatctgttg acgatggaca aactatggcg 840

gaaaaggaaa cctccagttc cattggattg ggctgaagtg caaagtcaag gagaagaaac 900

cagtgcatca gatcaacaaa acgaacccca gttaggtctg aaagaccagc aggttctaga 960

tgtcaagagc tatgcatgtc ttttttcaaa gagcattgag actttgagag ttcatttagc 1020

agaaaagggg gatggagctg agctcatatg ggacaaggat gacccatctg caatggattt 1080

tgtcacctct gctgcaaatc tcaggatgca tattttcagt atgaatatga aaagcagatt 1140

cgatatcaaa tcaatggcag ggaacattat tcctgctatc gctactacta atgcagtgat 1200

tgctgggttg atagtattgg aaggattgaa gattttatca ggaaaaatag accagtgtag 1260

aacaattttt ttgaataaac aaccaaaccc aagaaagaag cttcttgtgc cttgtgcact 1320

ggatgctccc aatcctaact gttacgtatg tgccagcaag ccagaggtga ctgtgcggct 1380

gaatgttcat aaagtgacgg ttctcacctt acaagataag attgtgaaag aaaaatttgc 1440

tatggtagca ccagatgtcc aaattgaaga tggaaaagga acaatcctaa tatcttcaga 1500

agagggagag acagaagcta ataatcacaa gaaattgtca gaatttggaa ttagaaatgg 1560

gagccgactt caagcagatg acttccttca ggactacact ttattgatca acatccttca 1620

tagtgaagac ctaggaaagg atgttgaatt tgaagttgtt ggtgatgccc cagaaaaagt 1680

ggggcccaag caagctgaag atgctgccaa aagcataacc aatggcagcg acgatggagc 1740

tcagccttcc acatccacag cacaagagca agatgatgtg ctcatagttg attcggatga 1800

agaaggtccc tcaaataatg ctgatatcag tgaagaagaa agaagtcgca agaggaagct 1860

agatgagaaa gagagtgtca gtgcgaaaag gtcacgcata gagcaggcag aggagcttga 1920

tgaggttata gcattagatt gaacagaaat gcctctgaac ggaacctctt actccattaa 1980

ggccttctgg gcagaaccag gttatttgtt acgtcctttg ttccaaaggg aaaatattga 2040

caccagtgac ttgaagatga ttctgctccc tttgaaagca ttcattttgc tagaactatt 2100

agaaacattg cagtatgctg tattgaaagt aggaatatag ttttaaaacc ctttgaacaa 2160

agtatgtgca taaccagtcc atgagatgaa acaacaccgt gcatgttgcc tttttaatgt 2220

aaataccctt cggtatcatt taacagtttt aaaatattgt ggtttagtaa agttgatacc 2280

tggttataaa tattatgcct ttatttttgg ttagaagaag aattattttt agcctagatc 2340

taaccatttt catactctta actgactgaa acagattcaa agaagtatcg agtgctatgc 2400

attgaaactt gtttttaaat gttaactggc actatgtata ttaatgtaaa acagttgtta 2460

atttactcaa gttttcagct tgtactgcct ggtatgtctg tgtaagaagc caatttttgt 2520

gtattgttac agtttcaggt tatttatatt tgatgttttg taaaactcaa atacaactat 2580

actgtactta tggaccaaat aaatgacatc tgcatacttg ttaaaaaaaa aaaaaaaaaa 2640

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa a 2671

<210> 2

<211> 19

<212> DNA/RNA

<213> si-UBA2-1(Unknown)

<400> 2

gcattatgaa ccctgacta 19

<210> 3

<211> 19

<212> DNA/RNA

<213> si-UBA2-2(Unknown)

<400> 3

caaccaaacc caagaaaga 19

<210> 4

<211> 19

<212> DNA/RNA

<213> si-UBA2-3(Unknown)

<400> 4

ggtgacatta aacgtgttt 19

<210> 5

<211> 20

<212> DNA/RNA

<213> UBA2-F(Unknown)

<400> 5

ccaccaagga gtgggctaaa 20

<210> 6

<211> 20

<212> DNA/RNA

<213> UBA2-R(Unknown)

<400> 6

tggaggtttc cttttccgcc 20

<210> 7

<211> 20

<212> DNA/RNA

<213> PAX7-F(Unknown)

<400> 7

agccagagtt tcaacgggag 20

<210> 8

<211> 20

<212> DNA/RNA

<213> PAX7-R(Unknown)

<400> 8

gtcgccaaca gacaacacac 20

<210> 9

<211> 20

<212> DNA/RNA

<213> MyoD-F(Unknown)

<400> 9

gacggctctc tctgcaactt 20

<210> 10

<211> 16

<212> DNA/RNA

<213> MyoD-R(Unknown)

<400> 10

cggcgcggat ccaggt 16

<210> 11

<211> 19

<212> DNA/RNA

<213> MyHC-F(Unknown)

<400> 11

ctggaatccg gaggcagaa 19

<210> 12

<211> 20

<212> DNA/RNA

<213> MyHC-R(Unknown)

<400> 12

ttttcgaagg tagggagcgg 20

<210> 13

<211> 20

<212> DNA/RNA

<213> GAPDH-F(Unknown)

<400> 13

tgttgtggat ctgacctgcc 20

<210> 14

<211> 20

<212> DNA/RNA

<213> GAPDH-R(Unknown)

<400> 14

aagtcgcagg agacaacctg 20

Claims

1. A method of inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering with UBA2 expression, comprising: the method is used for inhibiting the proliferation and myogenic differentiation of bovine skeletal muscle satellite cells by interfering the expression of UBA2, wherein the genome base sequence of the UBA2 is as follows: SEQ NO.1.

2. The method of inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering with UBA2 expression of claim 1, wherein: the method comprises the following specific steps:

3. The method of inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering with UBA2 expression of claim 2, wherein: the gene sequence of the si-RNA is as follows: SEQ NO.2, SEQ NO.3 or SEQ NO.4.

4. The method of inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering with UBA2 expression of claim 1, wherein: methods of interfering with expression levels of UBA2 include: plasmids, viral vectors or gene knockouts that interfere with expression of UBA2 are employed.