CN104293736A - Telomerase immortal cattle thyroid cell line and purpose thereof - Google Patents
Telomerase immortal cattle thyroid cell line and purpose thereof Download PDFInfo
- Publication number
- CN104293736A CN104293736A CN201410421962.4A CN201410421962A CN104293736A CN 104293736 A CN104293736 A CN 104293736A CN 201410421962 A CN201410421962 A CN 201410421962A CN 104293736 A CN104293736 A CN 104293736A
- Authority
- CN
- China
- Prior art keywords
- cell
- clone
- calf
- thyroid cell
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a telomerase immortal cattle thyroid cell line. The cattle thyroid cell line is named as hTERT-BTY, and is persevered in a China Center for Type Culture Collection (CCTCC) with a preservation number of C2014109 on 19th, June, 2014. The cell line can be used for separating, detecting and culturing foot and mouth disease virus. The cell line can be used for a cattle source in-vitro research model used for foot and mouth disease, or used for preparing a foot and mouth disease virus detection reagent.
Description
Technical field
The present invention relates to a kind of bovine thyroid clone and uses thereof and preparation method, the present invention relates to a kind of telomerase immortalized bovine thyroid clone exactly.
Background technology
Foot and mouth disease virus (foot-and-mouth disease virus, FMDV) be the single strand plus RNA virus belonging to Picornaviridae Hostis, can artiodactyls be infected and cause occurring with positions such as oral area, nose and hoofs acute, hot, the hyperinfection disease that bubble is feature.FMD is classified as by OIE legally must report disease, belongs to a class sick in China, is that harm livestock industry develops in a healthy way " No.1 epidemic disease ".
At present, foot and mouth disease virus is separated, detect, cultivate and study the most successfully experimental model system mainly suckling mouse and Hamster kidney cell line (BHK-21), is secondly porcine kidney cell line IBRS-2 and PK-15.The susceptibility of these systems to different strain is different, and because across kind of a separation and Culture, can cause virus variation.Researchist is had to find when ox source foot and mouth disease virus separation detection, the titre of virus on primary bovine thyroid cell (BTY) is higher than titre in other systems above-mentioned, primary bovine thyroid cell to the sensitivity of foot and mouth disease virus also than other cell height 100-1000 doubly, see: the current bovine thyroid cell of W.A.Snowdon, 1966.Growth of Foot-and-mouth Disease Virus in Monolayer Culture of Calf Thyroid Cells. has been used to separation and the research of the viruses such as the experiment of foot and mouth disease virus investigation and maligant catarrh fever.But, primary BTY cell can reach 6-10 generation, along with propagation or frozen meeting make its sensitivity reduce, in diagnosis and scientific research process, the primary BTY cell of each preparation will be slaughtered tire ox to obtain and be got parathyroid tissue, not only run counter to the original intention of " animal welfare ", and be a job of wasting time and energy very much, and batch between often differ greatly.Therefore, based on primary BTY cell, build a clone consistent with primary BTY cell characteristics and then can provide great facility for the separation and Culture of FMDV, checkout and diagnosis and fundamental research.
To the Study on Pathogenicity of FMDV mainly for ox and pig.Ox FMD is normally infected by respiratory infectious approach transmitted virus, and the initial position that virus infection copies is lung or pharyngeal, immediately viral rapid dispersion to oral cavity, hoof epithelium position.Ruminating animal infects after FMDV, through the severe infections stage some animal can lapse to as persistent infection state.Immune animal, after infection virus, also likely changes persistent infection animal into.The bottleneck throat (comprising soft palate) of ruminating animal is FMDV persistent infection position, can be separated to FMDV alive from esophagus-bottleneck throat (esophageal/pharyngeal, O/P) the scraping liquid of the convalescent ox of FMD.The animal house of ill domestic animal etc. and infected is crossed in the feed that pig is polluted by FMDV by feeding usually or directly contact FMD infection animal or stable breeding.By airborne transmission approach ox than pig more susceptible, but after pig infection, shedding virus is more than the virus quantity of discharging after ox or sheep infection.The continuous evolution of FMDV causes the multiple phenotypes such as its host's preferendum, virulence and antigenicity to morph, form the strain that a large amount of phenotype is different, there is the pathogenic property different from traditional strain in part strain, not only have cattle and sheep serious pathogenic, but also have and have very strong infection and pathogenic to pig.Viral duplicating dynamics, Infective and regulation and control and signal transduction mechanism is illustrated to deeply compare, except the experiment of animal body, a good in vitro study model is absolutely necessary, but there is no a kind of ox source cell system that can infect FMDV at present, therefore build the bovine somatic cells system that a strain can infect FMDV and be necessary.
Summary of the invention
The invention provides a kind of ox source cell system that can infect FMDV, this clone can be used as FMDV to the Study on Pathogenicity of ox excellent model, and can be used for being separated, detecting and cultivate foot and mouth disease virus, or preparation foot and mouth disease virus detection reagent.
Bovine thyroid clone of the present invention is named as hTERT-BTY, and on June 19th, 2014 China typical culture collection center in the Wuhan University of Wuhan, China carry out preservation, preserving number is CCTCC No:C2014109.
Clone of the present invention can be used for being separated, detecting and cultivate foot and mouth disease virus.
Clone of the present invention also can be used as the ox source in vitro study model of foot and mouth disease virus, or for the preparation of foot and mouth disease virus detection reagent.
The construction process of clone of the present invention comprises the following steps:
(1) be separated and cultivate primary calf thyroid cell;
(2) transfection pCIneo-hTERT plasmid in primary calf thyroid cell;
(3) antibiotic-screening obtains and can stablize the calf thyroid cell enlarged culturing that go down to posterity.
In the construction process of telomerase immortalized calf thyroid cell of the present invention, the primary calf thyroid cell in its step (1) is the cell of separation and Culture from 0-24h healthy calf in age parathyroid tissue.Primary cell culture is drawn materials and is all had requirement to organization type, differentiation degree, age etc., and the more individual tissue of general embryonic tissue is easily cultivated, and breaks up low comparatively to break up high easy cultivation.Live embryo due to ox is difficult to obtain, and the 0-24h calf in age that therefore we select histocyte differentiation degree lower carries out thyroid cell separation and Culture.
In the construction process of telomerase immortalized calf thyroid cell system of the present invention, in its step (2), the plasmid of transfection is pCIneo-hTERT.This plasmid telomerase reverse transcript is connected to the upper structure of pCIneo carrier (a kind of mammalian cell stable expressed vector is G418 resistance) to form, and transfection mammalian cell can make this cytotostatic express Telomerase.Cell lacks Telomerase, and to cause a split that telomere length in process constantly loses be one of the main mechanism of cell aging, and import exogenous telomerase reversed transcriptive enzyme (human telomerase reverse transcriptase, hTERT) gene can the activity of inducing cell telomerase, telomere length so just can be made to keep stable, extend the cells survival phase and strengthen ability of cell proliferation.Activated end granzyme inducing cell immortalization is similar to the physiological pathway existed in embryonic stem cell, finally can obtain, proterties metastable immortalized cell line close with primary thyroid cell biological behaviour.
In the construction process of telomerase immortalized calf thyroid cell system of the present invention, in its step (3), screening positive clone adopts G418 medicine to screen, and after transfection 24h, pressurization screening antibiotic concentration is 400 μ g/mL, and screening time is 15 days; Screening antibiotic concentration after picking mono-clonal is 200 μ g/mL.Pressurization screening concentration kills and wounds curve by the G418 of BTY cell to determine, concrete grammar adds the substratum containing G418 when being and reaching 80% fusion without the normal BTY cell of transfection, the G418 concentration used is respectively 50,100,200,400,800 μ g/mL, changes the fresh culture containing respective concentration G418 every 3 days.Minimum G418 concentration during cultured continuously two weeks needed for complete cell death is examination positive colony concentration used.The screening concentration determined in this experiment is 400 μ g/mL, so just can ensure farthest to kill negative cells when not killing positive cell.After mono-clonal occurs, G418 concentration reduces by half and continues screening, until cell maintains stable G418 resistance.
In the construction process of telomerase immortalized calf thyroid cell system of the present invention, transport sub-NIS detection method to calf thyroid cell system characterizing gene thyrotropin receptor gene TSHR and sodium/iodine to be undertaken by RT-PCR, the amplimer used is respectively: SEQ ID No, 1, SEQ ID No, 2, SEQ ID No, 3 and SEQ ID No, 4.Above primer, according to ox TSHR and the design of NIS complete genome sequence, detects wherein a section in these two genes respectively, and PCR primer checks order afterwards and complete genome sequence is compared, and comparison result homology is more than 95%.
The present invention has following beneficial effect:
(1) cell lacks Telomerase telomere length in process of causing a split and constantly shortens, this is one of main mechanism of cell aging, exogenous importing telomerase reverse transcriptase gene can express Telomerase in inducing cell, thus make telomere length keep stablizing constant, extend the lifetime of cell and strengthen the multiplication capacity of cell.The method of granzyme-induced cellular immortalization is a kind of approach close to physiological process being similar to embryonic stem cell principle, making cell that the possibility of unpredictable sudden change occur less, so just providing sound assurance for obtaining desirable FMDV in vitro study model.The present invention is that the method choosing human telomerase catalytic subunit hTERT Transfected primary bovine thyroid cell-stimulating Telomerase builds bovine thyroid clone, clone of the present invention still keeps the characteristic of primary bovine thyroid cell, can high level expression bovine thyroid specific gene.
(2) chromosome karyotype analysis shows immortalized cells of the present invention is normal somatic cell, and the distortion of chromosome number and structure does not occur, and presents securities such as anchor dependence and contact inhibition.
(3) foot and mouth disease virus can copy propagation on cell of the present invention, and therefore this clone can be used for the separation detection of the FMDV field strain in the sample such as animal tissues or blister fluid.
(4) research finds, in animal experiment in vivo a strain to the pathogenic different FMDV strain of pig and ox hTERT-BTY clone with on an other strain pig cell lines to copy situation consistent with experimentation on animals.Therefore clone of the present invention can be used as the in vitro study model of FMDV; Also can be used for increasing in a large number the antigen of FMDV virus as vaccine or diagnosis.
Accompanying drawing explanation
Fig. 1 is the morphological observation (common light microscopic 100 ×) of embodiment 1 primary bovine thyroid cell.
Fig. 2 is embodiment 1 hTERT-BTY morphological observation (common light microscopic 100 ×).Fig. 2 A be the 5th generation form; 2B be the 30 generation form.
Fig. 3 is that embodiment 1 the 30th generation hTERT-BTY Tiroidina specific gene TSHR and NIS detects PCR primer gel electrophoresis figure.In figure 3, the DNA marker of M:100-2000bp; TSHR:TSHR fragment amplification product, 1.951kb; NIS:NIS fragment amplification product, 333bp.
Fig. 4 is the chromosome analysis (GTG-Band dyeing) of embodiment 1 the 30th generation hTERT-BTY cell.Wherein: Fig. 4 A1 is primary BTY cell chromosome caryogram (contrast); Fig. 4 A2 is that primary BTY cell GTG-Band dyes; Fig. 4 B1 is the karyotype of the 30th generation hTERT-BTY cell; Fig. 4 B2 is that the 30th generation hTERT-BTY cell GTG-Band dyes.
Fig. 5 is that embodiment 2 FMDV/O/mya98 virus strain infection hTERT-BTY cell forms CPE situation (common light microscopic 100 ×).Wherein: Fig. 5 A: normal control cells; Fig. 5 B: infect FMDV/O/mya98 strain cell.
Fig. 6 is that the different FMDV strain of embodiment 2 A, B, C tri-strains copies situation on hTERT-BTY cell.
Fig. 7 is embodiment 2 flow cytomery FMDV/O/mya98 strain induction hTERT-BTY apoptosis situation.Wherein: Fig. 7 A: normal control cells apoptosis situation; Fig. 7 B: infect FMDV/O/mya98 strain apoptosis situation.Wherein X-coordinate is FITC fluorescence intensity, and ordinate zou is PI fluorescence intensity.Q1 is mechanical error; Q2 is non-viable apoptotic cell; Q3 is normal cell; Q4 is viable apoptotic cell.
Fig. 8 is the different FMDV strain induction hTERT-BTY apoptosis situation of embodiment 2 flow cytomery three strain.Wherein: A, B, C of Fig. 8 A:0.015 MOI dosage tri-strain strain cell death inducing situation; A, B, C tri-strain strain cell death inducing situation of Fig. 8 B:0.025 MOI dosage.
Embodiment
Below in conjunction with specific embodiment, such scheme is described further.
The separation and Culture of embodiment 1 calf Tiroidina primary cell and the structure of telomerase immortalized calf thyroid cell system and biological characteristics detect
One original cuiture
China holstein cows, male, 1 age in days, gets Tiroidina and takes out together with larynx and one section of tracheae, send into laboratory under low temperature after sacrificed by exsanguination; The alcohol putting into 75% after tissue wash is sterilized 10 minutes, cuts off adventitia and muscle tendinous tissue, with being added with dual anti-PBS cleaning twice, claiming net weight, being generally 10-15g, being cut into small rice grain size, the smaller the better; Add the trypsin solution of 6 ~ 8ml 0. 25% by net weight every gram tissue, spin upside down and liquid is fully contacted with tissue; 37 DEG C shake digestion 40 ~ 60min, discard primary Digestive system, Digestive system each after collecting, and each digestion is complete, then add trypsin solution continuation digestion residue tissue, and so repetition 2-3 times, limpid to supernatant liquor; The cell collected divides and is filled in 25mL Tissue Culture Flask, DMEM-F12 complete culture solution is added (containing 10% foetal calf serum in bottle, 0.01IU/mL thyrotropic hormone, 5 μ g/mL Sigma I8405s, 5 μ g/mL Transferrins,iron complexess, 2mmol/L L-glutaminate, 100U/mL penicillin G, 100 μ g/mL Streptomycin sulphates and 0.25 μ g/mL amphotericin B) the carbonic acid gas incubator of 37 DEG C 5% cultivates.
This primary calf thyroid cell mainly in shuttle-type, is shown in Fig. 1.
Two Establishment of Cell Line methods
Concrete steps are: treat that primary thyroid cell grows to 80% fusion, can carry out transfection.Adopt Lipofectamine 2000 transfection reagent box to carry out routine transfection to specifications, every bottle of cell transfecting pCIneo-hTERT plasmid 8 μ g, changes perfect medium (antibiotic-free) and cultivates after transfection 6h.According to the ratio Secondary Culture of 1:10 after transfection 24h, add 400 μ g/mL G418 microbiotic in perfect medium and carry out pressurization screening, within screening process every 3 days, change the fresh culture containing G418, and remove dead cell and cell debris.Screen after 15 days, picking mono-clonal is cultivated with containing the antibiotic perfect medium of 200 μ g/mL G418.Exchange for when cell normal growth and do not carry out cultivating, going down to posterity containing the antibiotic normal perfect medium of screening.
HTERT-BTY clone the 5th generation and the 30th generation form as shown in Figure 2.
Three hTERT-BTY clone biological characteristicses detect (following biological characteristics test experience cell used be the 30th generation telomerase immortalized calf thyroid cell.）
(1) cellular form: the cell of the hTERT-BTY clone in the 30th generation is shuttle-type, with primary calf thyroid cell homomorphosis.
(2) hTERT-BTY clone specific gene qualification.
Collect the telomerase immortalized calf thyroid cell of fresh culture, use Trizol lysing cell, chloroform and isopropanol extraction total serum IgE.CDNA is obtained with random primer reverse transcription.According to ox TSHR(Gene ID 281553 in Genebank) and NIS(Gene ID 505310) complete genome sequence design RT-PCR primer (NIS upstream primer: 5'CCTCCAGGGCCGTGCTCATCAAC3'; NIS downstream primer: 5'GCCCCTCCCCTCCCCCATAACA 3'; TSHR upstream primer: 5'ATGGAGGGGCAGGGGATACG 3'; TSHR downstream primer: 5'ATGCGCTGCTTCTAAGAGGAGTGC 3'), PCR reaction conditions is: 94 DEG C of denaturation 3min; PCR circulates: 94 DEG C of 30s, 59.8 DEG C of 30s, 72 DEG C of 80s, totally 35 circulations, and last 72 DEG C extend 10min; Product length is respectively TSHR 1.951kb; NIS 333bp.PCR primer is identified with 2% agarose gel electrophoresis and is checked order.In this clone of Gel electrophoresis results (Fig. 3) surface, TSHR and NIS is expressed as the positive.Illustrate that this clone still has the characteristic feature of bovine thyroid cell when the 30th generation, be not divided into other cells.
(3) Chromosome Identification.
After the calf Tiroidina primary cell of cultivation and hTERT-BTY clone are placed in 4 DEG C of 12h, add the colchicine that final concentration is 0.4 μ g/mL, in 37 DEG C of incubators, cultivate 10h.Gathering the cell of metaphase, be fixed with stationary liquid, then cell suspension being dripped in meeting on cold slide glass, with the dyeing of Giemas staining fluid, in counted under microscope chromosome number.The results are shown in Figure 4.Visible 30th generation telomerase immortalized calf thyroid cell chromosome number consistent with primary cell chromosome number, be 2n=60, this clone chromosome number distorts.And GTG-Band dyeing is carried out to primary thyroid cell and telomerase immortalized calf thyroid cell system karyomit(e), whether paired observation has chromosomal structural aberration.As shown in Figure 5, and primary Tiroidina karyogram does not find that obvious chromosomal structural aberration appears in the 30th generation hTERT-BTY cell to result.Illustrate that canceration does not occur this immortalized cell line, still keep normal bovine somatic cells characteristic.40th generation hTERT-BTY is preserved in CCTCC.
Embodiment 2 foot and mouth disease virus (FMDV) biological characteristic research in hTERT-BTY clone.
One, foot and mouth disease virus FMDV/O/mya98 virus strain infection hTERT-BTY clone form CPE situation.
Cell is inoculated in 96 orifice plates, and grow to 80% ~ 90% and merge, be inoculated in cell by serum-free MEM substratum virus dilution to 0.05MOI, after 24h, Microscopic observation is taken pictures.As shown in Figure 5, after 24h, a large amount of cell rounding comes off, and occurs obvious CPE.Illustrate that this foot and mouth disease strain can infect telomerase immortalized calf thyroid cell system and make cell generation pathology.
Two, foot and mouth disease virus FMDV strain copies situation in hTERT-BTY clone.
By cell according to 1.5 × 10
5the density of individual cells/well is inoculated in 24 orifice plates, and incubated overnight merges, by virus according to 200 × 10 to cell 80% ~ 90%
4copies/ hole is inoculated in cell, PBS cleaning 3 ~ 5 times after effect 1h, then hatching 0,6,12,24,36h gathers in the crops virus, each sample is got 200 μ L and is extracted RNA, measures the copy viral RNA number of each time point and curve plotting with real-time PCR.As shown in Figure 6, the different FMDV/O/mya98 strain of three strains all can copy by high level result in hTERT-BTY clone.
Three, the application of hTERT-BTY clone in FMDV fundamental research.
(1) situation of foot and mouth disease virus FMDV/O/mya98 strain induction hTERT-BTY clone generation apoptosis.
Cell is inoculated in 96 orifice plates, grows to 80% ~ 90% and merges, be inoculated in cell with serum-free MEM substratum virus dilution to 0.05 MOI, with the collected by trypsinisation cell not containing EDTA after 24h, and the PBS washed cell of precooling twice.Cell concn to 1 × 10 are adjusted with the PBS containing BSA
6individual cell/mL, adds 5 μ L Annexin V-FITC in cell suspension, mixes rear 4 DEG C of lucifuges and hatches 15min.Add the rear 4 DEG C of lucifuges of 10 μ L PI mixing and hatch 5min, flow cytomery apoptosis situation.As shown in Figure 7, after virus infection 24h, early apoptosis of cells and late apoptic summation reach 89.6% to result.
The situation of the FMDV strain induction hTERT-BTY apoptosis that (two) three strains are different.
Experimental technique, with (one), detects the apoptotic situation of FMDV strain induction hTERT-BTY that A, B, C tri-strains of 0.015MOI and 0.025MOI two dosage are different.As shown in Figure 8, after virus infection 24h, the degree of three strain induction hTERT-BTY apoptosis has certain difference to result, and two various dose trend are consistent.
In sum, embodiment 1 successfully constructs telomerase immortalized calf thyroid cell system, and detects this clone biological characteristics.Result shows that this clone can be stablized and is passaged to 50 generations more than, and the 30 generation still can high level expression bovine thyroid specific gene TSHR and NIS, illustrates that this clone still keeps the characteristic of thyroid cell.And compared with primary bovine thyroid cell, this clone the 30 generation cell chromosome, without number and structural aberration, is still normal bovine somatic cells.
In embodiment two, series of studies is carried out to the application of this clone, choosing different FMDV strains is inoculated in this clone, find that the FMDV of low dosage (0.05MOI) can infect this clone and form obvious CPE, along with the increase of infection time, copy viral RNA number shows a rising trend.This series of results shows that FMDV can infect this cell and breed in this time multiplexed cell system, therefore this clone can be used for the FMDV field strain in the samples such as separating animal's tissue or blister fluid, also can be used for the antigen of mass propgation FMDV as vaccine or diagnosis.Also preliminary exploration should be used as to this clone in fundamental research in embodiment two, for the research of FMDV strain inducing host cell apoptosis, find that FMDV strain can induce this clone generation apoptosis, and the degree that the different strains of dosage are apoptosis-induced equally has certain difference.This result show different strains due to the characteristic such as it is pathogenic, replication different, the ability of its inducing host cell apoptosis also just difference to some extent.Therefore, by hTERT-BTY cell as cell model, the Apoptosis mechanism of different strain can be studied.The same manner, this cell is also expected to the research such as immunologic mechanism, virus replication regulation and control, persistent infection and preferendum difference carrying out FMDV as ox source cell model.
<110> Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
Telomerase immortalized bovine thyroid clone of <120> mono-kind and uses thereof
<160> 4
<210> 1
<211> 23
<212> DNA
<213> artificial sequence (NIS upstream primer)
<400>
cctccagggc cgtgctcatc aac 23
<210> 2
<211> 22
<212> DNA
<213> artificial sequence (NIS downstream primer)
<400>
gcccctcccc tcccccataa ca 22
<210> 3
<211> 20
<212> DNA
<213> artificial sequence (TSHR upstream primer)
<400>
atggaggggc aggggatacg 20
<210> 4
<211> 24
<212> DNA
<213> artificial sequence (TSHR downstream primer)
<400>
atgcgctgct tctaagagga gtgc 24
Claims (9)
1. a bovine thyroid clone, this clone called after hTERT-BTY, CCTCC preserving number is C2014109.
2. the purposes of clone as claimed in claim 1, is characterized in that being separated, detecting and cultivate the application in foot and mouth disease virus.
3. the purposes of clone as claimed in claim 1, is characterized in that the ox source in vitro study model being used as foot and mouth disease virus.
4. the purposes of clone as claimed in claim 1, is characterized in that preparing the application in foot and mouth disease virus detection reagent.
5. the construction process of the clone described in right 1, is characterized in that said method comprising the steps of:
(1) be separated and cultivate primary calf thyroid cell;
(2) transfection pCIneo-hTERT plasmid in primary calf thyroid cell;
(3) antibiotic-screening obtains and can stablize the calf thyroid cell enlarged culturing that go down to posterity.
6. the construction process of telomerase immortalized calf thyroid cell according to claim 5, the primary calf thyroid cell that it is characterized in that in described step (1) is the cell of separation and Culture from 0-24h healthy calf in age parathyroid tissue.
7. the construction process of telomerase immortalized calf thyroid cell system according to claim 6, is characterized in that the plasmid of transfection in described step (2) is pCIneo-hTERT.
8. the construction process of telomerase immortalized calf thyroid cell system according to claim 7, it is characterized in that in described step (3), screening positive clone adopts G418 medicine to screen, after transfection 24h, pressurization screening antibiotic concentration is 400 μ g/mL, and screening time is 15 days; Screening antibiotic concentration after picking mono-clonal is 200 μ g/mL.
9. the calf thyroid cell system characterizing gene thyrotropin receptor gene TSHR of the construction process of telomerase immortalized calf thyroid cell system that states of claim 5 to 8 and sodium/iodine transport sub-NIS detection method, it is characterized in that being undertaken by RT-PCR described detection method, its amplimer used is respectively:
SEQ ID No 1, SEQ ID No 2, SEQ ID No 3 and SEQ ID No 4, wherein:
SEQ ID No 1(NIS upstream primer): 5'CCTCCAGGGCCGTGCTCATCAAC3';
SEQ ID No 2(NIS downstream primer): 5'GCCCCTCCCCTCCCCCATAACA 3';
SEQ ID No 3(TSHR upstream primer): 5'ATGGAGGGGCAGGGGATACG 3';
SEQ ID No 4(TSHR downstream primer): 5'ATGCGCTGCTTCTAAGAGGAGTGC 3'.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410421962.4A CN104293736B (en) | 2014-08-25 | 2014-08-25 | A kind of telomerase immortalized bovine thyroid cell line and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410421962.4A CN104293736B (en) | 2014-08-25 | 2014-08-25 | A kind of telomerase immortalized bovine thyroid cell line and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104293736A true CN104293736A (en) | 2015-01-21 |
| CN104293736B CN104293736B (en) | 2018-02-06 |
Family
ID=52313693
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410421962.4A Active CN104293736B (en) | 2014-08-25 | 2014-08-25 | A kind of telomerase immortalized bovine thyroid cell line and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104293736B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107460171A (en) * | 2017-08-22 | 2017-12-12 | 浙江省肿瘤医院 | Human thyroid undifferentiated cancer cell system and its application |
| CN109628404A (en) * | 2018-12-18 | 2019-04-16 | 浙江大学 | The construction method and purposes of Preadipocyte immortalized cell line under pigskin |
| CN110951780A (en) * | 2019-11-27 | 2020-04-03 | 厦门大学附属第一医院 | Construction and identification of ectopic interstitial cells of immortalized endometriosis |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101255407B (en) * | 2008-02-04 | 2010-11-17 | 首都医科大学 | Immortalized rat marrow stroma cell system and preparation method thereof |
| CN101613674A (en) * | 2008-11-13 | 2009-12-30 | 西北农林科技大学 | Porcine vein endothelial cell line and establishment method thereof |
| CN101974488B (en) * | 2010-06-21 | 2012-11-21 | 西北农林科技大学 | Immortalized porcine pancreatic stem cell line and construction and differentiation methods thereof |
-
2014
- 2014-08-25 CN CN201410421962.4A patent/CN104293736B/en active Active
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107460171A (en) * | 2017-08-22 | 2017-12-12 | 浙江省肿瘤医院 | Human thyroid undifferentiated cancer cell system and its application |
| CN107460171B (en) * | 2017-08-22 | 2020-06-12 | 浙江省肿瘤医院 | Human thyroid undifferentiated cancer cell line and application thereof |
| CN109628404A (en) * | 2018-12-18 | 2019-04-16 | 浙江大学 | The construction method and purposes of Preadipocyte immortalized cell line under pigskin |
| CN109628404B (en) * | 2018-12-18 | 2020-04-28 | 浙江大学 | Construction method and application of porcine subcutaneous adipocyte precursor immortalized cell line |
| CN110951780A (en) * | 2019-11-27 | 2020-04-03 | 厦门大学附属第一医院 | Construction and identification of ectopic interstitial cells of immortalized endometriosis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104293736B (en) | 2018-02-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Mass mortality caused by Cyprinid Herpesvirus 2 (CyHV-2) in Prussian carp (Carassius gibelio) in China | |
| CN102988974B (en) | Method for preparing porcine pseudorabies live vaccine by using passage CEF (chicken embryo fibroblast) | |
| CN112410290B (en) | Lateolabrax japonicus myocardial fibroblast line and application thereof | |
| CN109439634A (en) | Pseudorabies virus genetic engineering attenuated vaccine strain and its application | |
| Blomqvist et al. | Removal of virus from boar semen spiked with porcine circovirus type 2 | |
| CN105907721A (en) | Pig intestinal endothelial cell line for stably expressing CaS9 protein | |
| Xu et al. | Development of a primary culture system for haematopoietic tissue cells from Cherax quadricarinatus and an exploration of transfection methods | |
| CN104152403B (en) | A kind of method that establishing goose embryonic epithelium cell line and the goose embryonic epithelium cell line of foundation | |
| CN104293736A (en) | Telomerase immortal cattle thyroid cell line and purpose thereof | |
| CN104974977A (en) | Epinephelus lanceolatus kidney tissue cell line and construction method thereof | |
| Wang et al. | Establishment of Immortalized Yak Ruminal Epithelial Cell Lines by Lentivirus‐Mediated SV40T and hTERT Gene Transduction | |
| CN105121634B (en) | The cell line and its production method of virus production ability with raising | |
| CN104726409B (en) | A kind of preparation method and application of the duck embryos hepatic cell line of immortalization | |
| CN109207577B (en) | Application of MARCO in screening of porcine reproductive and respiratory syndrome resistant pigs | |
| CN105039241A (en) | Pelodiscus sinensis heart cell continuous cell line and establishing method and ultra-low-temperature cryopreservation method thereof | |
| Jing et al. | Establishment from the snout and kidney of goldfish, Carassius auratus, of two new cell lines and their susceptibility to infectious pancreatic necrosis virus | |
| CN104450630A (en) | Method for culturing goose parvovirus by using goose embryo fibroblast line | |
| CN110295137B (en) | Channa argus kidney cell line and construction method and application thereof | |
| CN104762318B (en) | In-situ immobilization plasmid, test kit and the method for No. 22 intron inversion type sudden changes of human blood coagulation factor VII I gene | |
| CN102391990A (en) | Breeding method for transgenic pigs expressing sIFITM3 genes | |
| Wang et al. | Isolation and characterization of a Cyprinid herpesvirus strain YZ01 from apparently healthy goldfish after rising water temperature | |
| CN105543162B (en) | Crucian brain tissue cell line and application thereof | |
| RU2506310C1 (en) | STRAIN OF DIPLOID CELLS OF SYNOVIAL MEMBRANE OF YOUNG PIG Sus scrofa, USED FOR VIROLOGY RESEARCH | |
| Abdelsalam et al. | Evaluation of establishment and maintenance of primary cell cultures from several strains of common carp (Cyprinus carpio L.) | |
| CN118667749A (en) | Gene II type GCRV sensitive gobiofish swim bladder cell line, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |