CN109609617B - Primer group and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease - Google Patents
Primer group and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease Download PDFInfo
- Publication number
- CN109609617B CN109609617B CN201811596140.4A CN201811596140A CN109609617B CN 109609617 B CN109609617 B CN 109609617B CN 201811596140 A CN201811596140 A CN 201811596140A CN 109609617 B CN109609617 B CN 109609617B
- Authority
- CN
- China
- Prior art keywords
- dna
- artificially synthesized
- synthesized sequence
- sequence
- artificially
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer group and a kit for detecting gene mutation of hepatolenticular degeneration disease ATP7B, and belongs to the technical field of disease detection. The primer group designed by the invention aims at the whole gene of ATP7B, and not only can detect known high-incidence mutation, but also can discover new mutation sites.
Description
Technical Field
The invention belongs to the technical field of disease detection, and particularly relates to a primer group and a kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease.
Background
Hepatolenticular degeneration (HLD), also known as Wilson's Disease (WD), is a disorder of copper metabolism with autosomal recessive inheritance, a common inherited disease of the nervous system. The data show that the incidence of the disease is 15-30/100 ten thousand in different people worldwide, the prevalence rate is 1/3 ten thousand, and the carrier frequency is about 1/90. WD is mainly copper metabolism disorder caused by ATP7B gene mutation, and is characterized by a large amount of copper deposited in tissues such as brain, liver, kidney, cornea and the like and free radical generation, causing damage to multiple organs, complex and diverse clinical manifestations, high clinical heterogeneity, and mainly manifested as acute and chronic neurological/psychiatric symptoms, renal dysfunction, corneal K-F ring and the like. It can be classified into brain type, liver type, mixed type and other types according to its clinical symptoms. WD is primarily diagnosed by its clinical manifestations and biochemical tests, including detection of serum ceruloplasmin, 24-hour urine copper and gene mutation analysis. WD is one of the few genetic diseases that can be treated, and most patients have good prognosis if they are diagnosed in early disease stage or prophase of symptoms and control copper intake and carry out copper-removing treatment in time; otherwise, the disease condition will gradually worsen and even endanger life.
The pathogenic gene of hepatolenticular degeneration disease is ATP7B gene, ATP7B gene is located at 13q14.3, the full length is 80Kb, 21 exons and 20 introns are contained, 1465 amino acids are coded, and the coding sequence codes P-type copper transport ATPase. The ATPase has 6 copper ion binding regions, 8 transmembrane functional regions, 1 transduction region, 1 ion channel and phosphorylation region, 1 nucleic acid binding domain and 1 ATP binding region. More than 800 gene mutations are reported in the ATP7B gene and distributed in the whole gene at present, the gene mutation modes comprise insertion mutation, deletion mutation, frameshift mutation, splicing mutation and the like, particularly missense mutation in point mutation is taken as the main point mutation, most of the mutation appears on an exon, and a few of the mutation appears in a boundary flanking region of the exon and an intron. In addition, studies have reported that DNA sequences other than exons (e.g., introns, promoters, and other regulatory regions) may have unknown changes that affect the expression of the ATP7B gene.
At present, the detection method of the ATP7B gene mutation comprises the following steps: RFLP/STR/SNP-family linkage analysis, PCR-SSCP analysis, PCR digestion and fluorescence PCR technology, Denaturing High Performance Liquid Chromatography (DHPLC) analysis, DNA sequencing technology, DNA microarray technology and the like.
In recent decades, sequencing technologies have been developed at a high speed, Sanger sequencing and chemical degradation methods have been widely used in the fields related to medicine and life science as representatives of the first generation of sequencing methods, and although sequencing reading is long, accurate and reliable, it is difficult to realize micro-quantification and high-throughput quantification due to the dependence on electrophoretic separation technology, which results in high sequencing cost and low sequencing efficiency. In recent years, Next Generation Sequencing (NGS) represented by chip sequencing, sequencing by synthesis and pyrosequencing can make up for the deficiency of one generation sequencing, and realize rapid and high-throughput large-scale sequencing. TorrentPGM at IonTMThe sequencing technology represented by the individual genome sequencer and the high-throughput Ion Torrent Proton sequencer does not belong to biochemical technologies of fluorescence detection and nucleic acid marking, and is simpler, higher in cost performance and strong in expansibility compared with other second-generation sequencing technologies. The core of Ion Torrent sequencing principle is to convert chemical signals into digital signals by using a semiconductor technology, the technology adopts a semiconductor chip which is distributed with small holes, each small hole is a sequencing reaction pool, sequencing is carried out while synthesis, when each nucleotide is added to a synthesized DNA chain by DNA polymerase, hydrogen ions are released, so that the pH value in the reaction pool is changed, an Ion receptor below the reaction pool can sense the signals at the moment, the chemical signals are directly converted into the digital signals, and the DNA sequences are read.
There are patent reports about the detection of ATP7B gene mutation, such as the kit for detecting hepatic lenticular degeneration ATP7B multi-site mutation invented by Huangjia et al, a Beijing friendship Hospital affiliated to the university of capital medical science, but it only detects the high-incidence mutation site on individual exon, but does not cover the detection of ATP7B whole gene.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a primer group and a kit for detecting the ATP7B gene mutation of the hepatolenticular degeneration disease, wherein the primer group designed by the invention is specific to the whole gene ATP7B, and not only can detect known high-frequency mutation, but also can discover new mutation sites.
In order to achieve the purpose, the invention adopts the technical scheme that: a primer group for detecting the gene mutation of hepatolenticular degeneration ATP7B comprises a primer group I and a primer group II, wherein the primer group I comprises upstream and downstream primer sequences shown as SEQ ID NO. 1-304, and the primer group II comprises upstream and downstream primer sequences shown as SEQ ID NO. 305-606.
In addition, the invention also provides a kit for detecting the gene mutation of hepatolenticular degeneration disease ATP7B, which comprises the primer group.
As an improvement of the technical scheme, the upstream and downstream primers in the primer group I are mixed and diluted in equal amount, and the concentrations of the upstream and downstream primers in the primer group I are both 400 nM; and (3) mixing and diluting the upstream and downstream primers in the primer group II in an equivalent manner, wherein the concentrations of the upstream and downstream primers in the primer group II are both 400 nM.
As an improvement of the technical scheme, the kit further comprises at least one of PCR reaction liquid, DNA ligase, primer digestion liquid, connection buffer liquid, a P1 joint, a Barcode X specific joint, library amplification reaction liquid, library amplification primer liquid, AMPure XP magnetic beads and nuclease-free water.
In addition, the invention also provides a group of mutation information of hepatolenticular degeneration disease-causing gene ATP 7B: through searching relevant information such as documents and the like, information such as base change of ATP7B of the hepatolenticular degeneration disease and position on a chromosome is determined by screening an OMIM (online Mendelian inheritance) database, a clinvar database and the like by using an official network of NCBI (national center for Biotechnology information).
In addition, the invention also provides a method for detecting the gene mutation of the hepatolenticular degeneration disease ATP7B, which comprises two parts of library construction and high-throughput sequencing; library construction comprises the following steps: target gene amplification, partial primer digestion, adaptor connection, ligation product purification, library amplification, library purification and library quantification; high throughput sequencing comprises the following steps: template amplification, template enrichment and sequencing on a machine.
In addition, the invention also provides an Analysis method, which adopts a server and software matched with the sequencer to carry out sequence comparison and Analysis, and runs Variant Caller and Coverage Analysis plug-ins to obtain the sequencing result of the sample.
The invention has the beneficial effects that: the invention provides a primer group and a kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease, wherein the kit comprises a primer group, the primer group comprises a primer group I and a primer group II, the primer group I comprises upstream and downstream primer sequences shown as SEQ ID NO. 1-304, and the primer group II comprises upstream and downstream primer sequences shown as SEQ ID NO. 305-606; the primer group designed by the invention aims at the whole gene of ATP7B, and not only can detect known high-incidence mutation, but also can discover new mutation sites.
Drawings
FIG. 1 is a sequence sequencing length distribution diagram.
Detailed Description
To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the following detailed description and accompanying drawings.
Primer set designed aiming at ATP7B gene
A primer for amplifying the ATP7B gene is designed on line by using Ion AmpliSeq Designer, the primer is synthesized by Endori Weijie base (Shanghai) trade company Limited, the primer components are divided into 2 groups according to the characteristics of the sequence, Tm value and the like of the primer, and the primer designed by the invention is shown in Table 1.
TABLE 1
ATP7B gene mutation detection method
Reagent
Nucleic acid extraction or purification reagents (Darrii biotechnologies of Guangzhou city Co., Ltd.), the Qubit dsDNA HSAssay Kit, Ion Ampliseq Library Kit 2.0, Ion Xpress Barcode adapters1-96, absolute ethanol, AMPure XP beads, a general Kit for sequencing reaction (semiconductor method) (Darrii biotechnologies of Guangzhou city Co., Ltd., record number: Yueju mechanical equipment 20160061), isopropanol, sodium hydroxide and the like.
Configuration of primer set
The primers of each group were mixed in equal amounts and diluted to 400nM to prepare primer group I and primer group II.
Sample DNA extraction and quantification
The sample DNA was obtained by conducting an experimental operation according to the instructions accompanying the nucleic acid extraction or purification reagent, and then the DNA concentration was measured by a Qubit3.0 fluorescence quantitative instrument (life technology).
Library construction
1) Amplification of a target gene: preparing a reaction system in a PCR tube according to the table 2, and carrying out PCR amplification according to the table 3; carrying out 2 reactions on each sample by using a primer group I and a primer group II respectively;
TABLE 2
TABLE 3
2) Partial primer digestion: and (3) taking out the PCR tube after the amplification is finished, standing to room temperature, centrifuging at low speed for 3-5 seconds to ensure that no obvious liquid drops exist on the tube wall and the cover, and mixing 2 primer group PCR reaction tubes of the same sample into one tube, wherein the volume of the tube is 20 mu L. Adding 2 mu L of FuPa Reagent into a PCR tube, mixing uniformly by vortex oscillation, centrifuging at low speed for 3-5 seconds, and placing on a PCR instrument for reaction according to the reaction conditions in the table 4;
TABLE 4
3) Connecting a joint: the linker was diluted as in Table 5, the configuration of the ligation reaction system is shown in Table 6, and the procedure of the ligation reaction is shown in Table 7;
TABLE 5
TABLE 6
TABLE 7
4) Purifying a connection product: and adding 45 mu.L of AMPure XP beads into the ligation product for purification to obtain air-dried magnetic beads adsorbing DNA.
5) Library amplification: preparing an amplification reaction solution according to the table 8, adding the amplification reaction solution into the AMPure XP beads dried in the step 4, and transferring the amplification reaction solution into a PCR tube; the procedure for library amplification is shown in table 9;
TABLE 8
TABLE 9
6) Library purification and quantification: adding 36.4 mu L of AMPure XP beads into a PCR tube, blowing, beating and uniformly mixing, transferring into a new 1.5mL EP tube, and standing for 5 minutes at room temperature; placing the EP tube on a magnetic frame, transferring the supernatant into a new EP tube after the solution is clarified, and removing the EP tube on the magnetic frame; adding 57.2 mu L of AMPure XP beads into an EP tube for purification, and finally obtaining 22 mu L of library; measuring the concentration of the library by using a Qubit3.0 fluorescence quantifier;
7) high-throughput sequencing: mixing the libraries into OT mix in equal amount, if each 3ng, mixing, measuring the library concentration of the mixed OTmix by a Qubit3.0 fluorescence quantitative instrument according to the formulaDiluting to 200pM, sequencing the library by using a sequencing reaction universal kit, and carrying out experimental operation according to an instruction matched with the kit;
8) and (3) data analysis: sequence comparison and Analysis are carried out by adopting a server and software matched with a sequencer, VariantCaller and Coverage Analysis plug-in units are operated to obtain the sequencing result of the samples, and each sample generates an Excel table containing all detection site information; when the mutation frequency is 0, the mutant is a wild type, the mutation frequency is a heterozygous mutant at about 50%, and the mutation frequency is a homozygous mutant at about 100%.
Sequencing quality analysis of clinical samples
The 20 samples of whole blood collected clinically were tested as described above, and as shown in FIG. 1, sequencing quality analysis was performed using MultiQC V1.0 after sequencing was completed, where Total _ Reads represents the Total number of Reads detected, Mean ReadsLength represents the average length of the sequenced fragments, Mapping Reads represents the number of Reads aligned with Hg19, ReadsMappled to Target Region represents the number of Reads aligned with the Target gene, Mean Depth of Target Region represents the average Depth of sequencing of the Target gene Region, Fraction of Target Coverage ≧ 100X (%) represents the Fraction of the Target fragment sequencing Depth up to 100X, sensitivity (%) represents the capture specificity ratio, i.e., the ratio of the Target to the Target Region, and Coverage of Target Region (%) represents the result of the Target sequence as shown in the Table 10.
Watch 10
From the analysis of the sequencing results of the above 20 samples, the average sequencing reads number of each sample is 1387406.25, the average sequencing fragment length of each sample is 199.85bp at most and 150.1bp at most, the sequencing average length of 20 samples is 183.58bp, the sequencing average depth is 1859 ×, the percentage average value of the sequencing depth of the target region 100 × is 95% or more, the sequencing uniformity of the target region is 86.22% on average, the sequencing coverage of the target region is 99.44%, and the capture specificity ratio is 59.26%; this indicates that the quality of the clinical sample sequencing is better.
ATP7B mutation Point analysis of clinical samples
1) Determination of mutation points: the identified mutational hot spots were looked up as shown in table 11: NM number NM-000053;
TABLE 11
2) And (3) detecting a clinical sample: 93 clinically collected hepatogram patients were sequenced as described above and relevant inserts were run and the results are shown in Table 12.
TABLE 12
The 93 samples detect 28 mutation types together, the average sequencing depth is 4421 x and is far beyond the requirement of 100x on the sequencing depth on the market, the heterozygous mutation frequency is between 37.7 and 55.1 percent, and the homozygous mutation frequency is between 90.5 and 100 percent, which completely meets the requirement of result judgment of the invention. Therefore, the detection method has the advantages of good accuracy, high flux and good feasibility of being applied to clinical research.
Finally, it should be noted that the above embodiments are intended to illustrate the technical solutions of the present invention and not to limit the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
SEQUENCE LISTING
<110> Hefeida Gene science and technology Co., Ltd
AFFILIATED HOSPITAL, INSTITUTE OF NEUROLOGY, ANHUI UNIVERSITY OF CHINESE MEDICINE
<120> primer set and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease
<130>2018.12
<160>606
<170>PatentIn version 3.3
<210>1
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>1
gccaaagaca ccgatatttg ct 22
<210>2
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>2
caagtgtcct tggagaacaa aactg 25
<210>3
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>3
aaacaagtgt tactttcaca agcagaaaat 30
<210>4
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>4
acattttctt ccttgcctta gagca 25
<210>5
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>5
taagggagcc actttgctct tg 22
<210>6
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>6
actgtgaaat atgtgccatc ggtt 24
<210>7
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>7
ggcttataga tgaagccatc tccct 25
<210>8
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>8
ttcctggaag cattgtccct g 21
<210>9
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>9
cctgaagtca tcagatgtac tgct 24
<210>10
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>10
tctagaatgg ctcagatgct gttg 24
<210>11
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>11
cgcaacaagc ctgaaaattc caaaa 25
<210>12
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>12
gctgatattc tttcttctgc ttgatcgatt 30
<210>13
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>13
ccctactgtt aaaatcctat cctcctct 28
<210>14
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>14
gttgttttct gactaggctg atcattatct 30
<210>15
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>15
gaaataaagc gtgaagacaa gatagagaaa aa 32
<210>16
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>16
gttaagtctg atgagcttcc ctttgt 26
<210>17
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>17
tgacctcctg aatcaagtgc attc 24
<210>18
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>18
acccttttct cccacacaaa atagtttta 29
<210>19
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>19
aaaaagactt agacttccac acagtaatag tg 32
<210>20
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>20
aggataactg caatgtggtg ct 22
<210>21
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>21
ccatttcctc caagccacac aa 22
<210>22
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>22
tcttcttcaa gttgaggaga gttcttttt 29
<210>23
<211>20
<212>DNA
<213> artificially synthesized sequence
<400>23
acacagccaa agcactggtt 20
<210>24
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>24
gtctatctcc ttcagttctg ttttgatctt ag 32
<210>25
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>25
cacaggagag aaaaggaaca gactatg 27
<210>26
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>26
catgggcttt gtcttggact ct 22
<210>27
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>27
cagggctatg tgtgcattaa cc 22
<210>28
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>28
cacgagattg tgaatgggtt ttctaag 27
<210>29
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>29
aggcaagttc cactgtgcta ag 22
<210>30
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>30
agctttctag gaagcctcac tttg 24
<210>31
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>31
gtttctgcct agaattatag gtatgacaca 30
<210>32
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>32
gaagtggaat ttctaggaca aaagcag 27
<210>33
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>33
ggaaggtgca gttttccttt cctag 25
<210>34
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>34
ttgctaatta tggacctgtt tagcgt 26
<210>35
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>35
tgacgtggaa agacttccat gatg 24
<210>36
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>36
ccagggtggg ttcggtttta ttt 23
<210>37
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>37
gcctcatgac agtgaacagg tt 22
<210>38
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>38
cctcctccag ggtctgatat acag 24
<210>39
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>39
aaaaagaacc taaccaccac ttacct 26
<210>40
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>40
ctattgactg agtgaacaaa tgaatgaact 30
<210>41
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>41
agatgccttc tcctcctgtt ca 22
<210>42
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>42
gtcacatgcc ttggcttctt ttt 23
<210>43
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>43
cctctctgcc tgtctgaaac ata 23
<210>44
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>44
gcttaggttt cctgaaaaat ttaatcccag 30
<210>45
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>45
gtgaaggcct ctcatccatc tt 22
<210>46
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>46
gtgcatgcat gtaacttatc agca 24
<210>47
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>47
tcataaacca gctactgcaa atttcttcta 30
<210>48
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>48
catccaggct atagagtgca gtg 23
<210>49
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>49
cacagtcctt ctctagcaga tgatc 25
<210>50
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>50
ctgaggagag atcaagtttg taatcaca 28
<210>51
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>51
ctcctcgttc catcgtaaat ttgttttt 28
<210>52
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>52
gggacatggt ctcttgctga tg 22
<210>53
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>53
gggaattaca aagcagaaaa atctatttct 30
<210>54
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>54
tcactctgag ttacacaaat gatcatgg 28
<210>55
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>55
gtccagacct tcagacaaca ca 22
<210>56
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>56
gcctatatct gaagttttga gatatgacgt 30
<210>57
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>57
aaaatacagc caagcatctc cact 24
<210>58
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>58
ctctccatca gaatgatttg ctgga 25
<210>59
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>59
ttcaccgtat attgtataaa ccggcaa 27
<210>60
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>60
tggaaatttc caagagactc ctttaaagtt 30
<210>61
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>61
aagactttgt tgatgccaac ctaaga 26
<210>62
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>62
acggatgctt tggaaagacc at 22
<210>63
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>63
tggttaaaaa cctgatagca aaatgcag 28
<210>64
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>64
ccttttagca gcatttctga gca 23
<210>65
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>65
ctcacagacc aaactcagca tca 23
<210>66
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>66
tgtactcctg ctctttctcc ctt 23
<210>67
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>67
ctgaaaataa aaagcaacaa aacccaaact 30
<210>68
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>68
gaacctggga aatgagttcc agt 23
<210>69
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>69
agcatcagca gctacacaag tt 22
<210>70
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>70
ggagccactg cgaagatttc aattata 27
<210>71
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>71
gcagttcacc ttcagcagac ta 22
<210>72
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>72
gcacatggcc aaaaggaaac tg 22
<210>73
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>73
tagctataga agcaggaggg cttt 24
<210>74
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>74
aaaaagactg catgtgtttt agtgct 26
<210>75
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>75
tagctttgtt ttcccttgga ccaa 24
<210>76
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>76
cacggagaga cagagtgatc atttt 25
<210>77
<211>19
<212>DNA
<213> artificially synthesized sequence
<400>77
acctggccaa cacacagtc 19
<210>78
<211>19
<212>DNA
<213> artificially synthesized sequence
<400>78
gcagtggagt ggtgtgact 19
<210>79
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>79
gctttatcct gctgcttctt acca 24
<210>80
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>80
tgaagaatca ctagaaagca atcacagat 29
<210>81
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>81
ataaataaag cagacagaga agggtgg 27
<210>82
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>82
ctgttttcca gaagattgtc tttttgtctt 30
<210>83
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>83
tttaactttt ccttggtgac atgagatca 29
<210>84
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>84
tcctgggtct tcattcttgt ttctg 25
<210>85
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>85
cggtttccaa tcagcacaga gaa 23
<210>86
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>86
caaagacgga cattgcctta tgtttaatac 30
<210>87
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>87
catagaatct aagagacgtg tggaaca 27
<210>88
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>88
cgtttcccaa agtgagcaca tg 22
<210>89
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>89
gctctggaag ctctcatgga aa 22
<210>90
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>90
tttcgttcttcctgtttcca ttctgtat 28
<210>91
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>91
acaacacaag ggcaaactct atca 24
<210>92
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>92
actgagcagg taatgtttgt gagtg 25
<210>93
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>93
gtggtttgac ccacctctac tt 22
<210>94
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>94
cagtttcctc ttcctctctt tccac 25
<210>95
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>95
gggagtgtta accaaagcag attattca 28
<210>96
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>96
gtgtttgtgc ctgtctcctg ttaata 26
<210>97
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>97
gaggaccctt ctaagcggtt tt 22
<210>98
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>98
gcagtaaatg tagaaaggtg acatcattg 29
<210>99
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>99
ctttactctc agttccactt ggctt 25
<210>100
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>100
ctctggtgaa agactctgag tagga 25
<210>101
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>101
cccagtactc ccatttcatg tttg 24
<210>102
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>102
accatgtcct tctctcctag ct 22
<210>103
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>103
aggctgttct ttgcttcaca gat 23
<210>104
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>104
gggaattgta ggctataggt ggtgata 27
<210>105
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>105
catgggtaat ggtgccagtc tt 22
<210>106
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>106
gggagttgtt gaaccctgag att 23
<210>107
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>107
cctccacttg cccaggaaaa a 21
<210>108
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>108
tccaatcaca gatcgctgca a 21
<210>109
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>109
cctaagtgca aaagctactg ggaat 25
<210>110
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>110
tcagcatcag aaacaaaaag ctgaatt 27
<210>111
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>111
aaaaagaatc atcttctttc aaacccaca 29
<210>112
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>112
gcaactgtat agtcttacag gtcatcattg 30
<210>113
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>113
cagaggcagg ttgagagttc aata 24
<210>114
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>114
gtaatgcctc tttgagggaa acct 24
<210>115
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>115
tttgctcaaa cgtcaacttc tcaatg 26
<210>116
<211>19
<212>DNA
<213> artificially synthesized sequence
<400>116
taagcaagct gggcatcgt 19
<210>117
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>117
aggaaagctt aaaaatgcta ttctaaggtg 30
<210>118
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>118
tgcatattgg tggatacctt tccag 25
<210>119
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>119
cacacacagc ctcttcacat cta 23
<210>120
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>120
agtcctttta cagcaagcac atttg 25
<210>121
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>121
cacagcctct ttagcttcca tct 23
<210>122
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>122
tttgttttta tctgcaatat cagggaggat 30
<210>123
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>123
actttccgac aatactcaac attcagg 27
<210>124
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>124
gcttttgcat gaggcttgct c 21
<210>125
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>125
tgttcaattt aagatgggaa atttgaggga 30
<210>126
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>126
gcacaatgag cggaacaatg tttt 24
<210>127
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>127
gacatgaact gctggagtca gt 22
<210>128
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>128
cactgcctac ttgtgacagt acag 24
<210>129
<211>33
<212>DNA
<213> artificially synthesized sequence
<400>129
cctgtatttt cctttctttt tctgaggttt aat 33
<210>130
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>130
gtattagtca ggctggcttc gaa 23
<210>131
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>131
aaagttgttt gtcagggctc ctaa 24
<210>132
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>132
gcaaggataa tcctgctctc tcttttt 27
<210>133
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>133
acaaacataa aaagctattt acattacttg gg 32
<210>134
<211>33
<212>DNA
<213> artificially synthesized sequence
<400>134
gcaggtttct attaaagatc tcctttacat tct 33
<210>135
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>135
ctgcagcacc aacaactgtt tt 22
<210>136
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>136
cagggaagca aaacaaagag aataattgat 30
<210>137
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>137
atccatacca ccaacgtcaa agtt 24
<210>138
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>138
acaccacttt ggctcagatt gt 22
<210>139
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>139
tccaagacat cctcggaaat ctaga 25
<210>140
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>140
ctgggaagaa tgaccttaaa ggga 24
<210>141
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>141
agggactcat cagccatggt at 22
<210>142
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>142
cacagaactt gtcttcatga ggtagtag 28
<210>143
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>143
acccacgttc tctgccattt ta 22
<210>144
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>144
gatagaaatt ggtaccaaga agtggagt 28
<210>145
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>145
gtctgagaaa cagcaagaaa gcaa 24
<210>146
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>146
gcattttcac atcttgttaa cacatgatct 30
<210>147
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>147
ggcagaaaac tgcttaaagg tgtc 24
<210>148
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>148
gctcactgat gccatagcat aga 23
<210>149
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>149
aaatgccaac tagggagctg aaa 23
<210>150
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>150
tcacagtcac tgcaacacac aa 22
<210>151
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>151
gatagcctag tttctctact gagaagaca 29
<210>152
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>152
gcatggagag aagggcattg aag 23
<210>153
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>153
ctgagagagc acgcagtgag aag 23
<210>154
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>154
gctttccatg catgctcttc tg 22
<210>155
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>155
acagagaggc ctctgaagag aaa 23
<210>156
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>156
cttgcccgat gtaccttgct tata 24
<210>157
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>157
cacaaaagcc atcttactta cttgagaag 29
<210>158
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>158
agtagccaca caagccttga at 22
<210>159
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>159
caatgctctc tctccagaca ctaac 25
<210>160
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>160
cctggaaacc tccattccca tatttt 26
<210>161
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>161
atggacagtt aagacacaca cagaaa 26
<210>162
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>162
gagggtctga cctttagttc ttgg 24
<210>163
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>163
aagctctatt tgtgatccac tgcat 25
<210>164
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>164
ccggcagaat agagctttct ttaaattttt 30
<210>165
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>165
gttaatgtgg ctcctactgg tgaa 24
<210>166
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>166
gtgcttgata ttaaaaggct tgcaca 26
<210>167
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>167
gggtgaaaga gacttgttat gaataacaaa 30
<210>168
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>168
gatttgagta gagacctgaa tgattcaga 29
<210>169
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>169
ccctagagac agaggtgcta gaac 24
<210>170
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>170
taacagccgt gagaagctca ttc 23
<210>171
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>171
gtttcatcta cataagacca cctttgct 28
<210>172
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>172
cctcatgaat ttacatccta gttggaga 28
<210>173
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>173
caaagggatg gtcagaggaa gaa 23
<210>174
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>174
gaagaccaga gttcattctg cct 23
<210>175
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>175
cccagcacac agtaagctca ata 23
<210>176
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>176
cggattagtg gacagacaga gaga 24
<210>177
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>177
ggaaagctgg gatgatgaca gt 22
<210>178
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>178
cagatgcatg agtgttcatg aggt 24
<210>179
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>179
catgaataaa ctatgatgcg tccaaact 28
<210>180
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>180
gacagtcttt taaaaatgga aacagcaca 29
<210>181
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>181
ggagtggtta gagtctgcat ga 22
<210>182
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>182
actactggaa ggagaagtgt tcagat 26
<210>183
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>183
gtaactaact tcatcgtttt gagccattag 30
<210>184
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>184
ctgagcagga gagacagatc acag 24
<210>185
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>185
cagcctgggt tacatcccaa tt 22
<210>186
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>186
tgaattaggc cttcctagta agatacaca 29
<210>187
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>187
tcctacttct gaatttcttg agggtatgt 29
<210>188
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>188
cattagctct caagccttcc tgt 23
<210>189
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>189
acacaccacc tacaaatctt gct 23
<210>190
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>190
ctctaacacc acgcttgtga ct 22
<210>191
<211>20
<212>DNA
<213> artificially synthesized sequence
<400>191
ctcctccact agccaaggga 20
<210>192
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>192
gtgagaattt caaaccagtg gatcttaac 29
<210>193
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>193
ggacaatgaa gggtgttaaa aatggc 26
<210>194
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>194
cagaaaagag ctgctccttc agt 23
<210>195
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>195
ccttacaaga gttcctgaag ggaag 25
<210>196
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>196
gtatttcgag cctatgtgtg tgtttg 26
<210>197
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>197
gtaggcctga acgtagaagt acc 23
<210>198
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>198
tgggttttaa aggtctcaca tgct 24
<210>199
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>199
ctccaaagtc taaactagga agaagtcg 28
<210>200
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>200
tctatctctg caaggttttg gtgtc 25
<210>201
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>201
cacatacacg caagtgtgca tt 22
<210>202
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>202
gcctggctag atagggtctt g 21
<210>203
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>203
aagctcatca tcactggtta ttacagac 28
<210>204
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>204
gcgtgtgtct ttatcgtaga atgatttac 29
<210>205
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>205
cctaaacatt ccaatattag gacagggat 29
<210>206
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>206
ccatgccact cttgagtgtt ctat 24
<210>207
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>207
gctcggctct aaagcaaaca g 21
<210>208
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>208
cgtgagatcc cagtacagtg tc 22
<210>209
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>209
ggcaggaaag ctgcaataaa gt 22
<210>210
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>210
ctgatatatc tgtgttgctg catttgc 27
<210>211
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>211
gtgggtccca aaggaagcaa c 21
<210>212
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>212
ccgaggcgta gactagtgtt c 21
<210>213
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>213
gccatctgag ggagcatcta ga 22
<210>214
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>214
cccgattcca aactatggtg ttc 23
<210>215
<211>20
<212>DNA
<213> artificially synthesized sequence
<400>215
gctatgctgt ctgcctccaa 20
<210>216
<211>19
<212>DNA
<213> artificially synthesized sequence
<400>216
gtggtctcgc tcttgtccc 19
<210>217
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>217
accaattcct tcagccaagc aa 22
<210>218
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>218
tgacaatgtt ttcagacttt atttgcatgg 30
<210>219
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>219
gagtttgaag aaaccacagc tgatg 25
<210>220
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>220
aaagggataa tcctaattaa tccaacacac tt 32
<210>221
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>221
cacctaaggt gtcaggagtt tgag 24
<210>222
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>222
ttcctcttca ttgtgtgtgt gtgt 24
<210>223
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>223
tccatgactg ctgcctcaaa a 21
<210>224
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>224
aaaaagatgc ctgccaccta c 21
<210>225
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>225
tggacaaact gggaagggag ta 22
<210>226
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>226
gctcagtcat tttaaaataa actgcaggta 30
<210>227
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>227
cggaggcata agtgatgcca tt 22
<210>228
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>228
gattggctgt ctcttgtacc tgtt 24
<210>229
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>229
gctggctcca agggtaatga tg 22
<210>230
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>230
agtcacatca ttccactgct cattac 26
<210>231
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>231
caatggtact tctctgctct cctttt 26
<210>232
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>232
tacacaacat ggtacggcac aa 22
<210>233
<211>33
<212>DNA
<213> artificially synthesized sequence
<400>233
cctagaagac tagttaaatg cagaaattca cat 33
<210>234
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>234
tgttttcaaa gtgctctcgg tttttg 26
<210>235
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>235
acaccttttc caataatcct cttgct 26
<210>236
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>236
gggtttctac ttcctttgtg tgttttg 27
<210>237
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>237
ggcacgtaga cagatgggaa ataa 24
<210>238
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>238
ccactgagag tattcagggt gtt 23
<210>239
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>239
gcctcccaag gcatcatttt t 21
<210>240
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>240
gaccacattc cttatttcat tggtgtc 27
<210>241
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>241
aaaaagcctc gttcaaataa atgaaagga 29
<210>242
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>242
ccagcctctt gttcactatg catta 25
<210>243
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>243
cactctctgg tttacaggaa caacaa 26
<210>244
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>244
cttcagaata cccagcaact gtgt 24
<210>245
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>245
ccatctgtag tttgcaccat ggaat 25
<210>246
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>246
gggtagctca gtggaaggat ttaata 26
<210>247
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>247
ggacatccag ttaaatttga ttctcagaca 30
<210>248
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>248
catctgcctg tttttgtgtg atgtt 25
<210>249
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>249
gcaaagactc acagctgagt ga 22
<210>250
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>250
agaggatgat aggtgagtgg agatg 25
<210>251
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>251
ctaattcttt cccatctcac aatcactctt 30
<210>252
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>252
actatgctca gccaccatca tg 22
<210>253
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>253
tcactatcct ccatcttgga caaca 25
<210>254
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>254
ggcccttttc ttaccaagag aactatt 27
<210>255
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>255
ccctcatgaa tggaatccac tca 23
<210>256
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>256
gcaaactttc cttgcatgtt aaatttgtta 30
<210>257
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>257
actgccatca ttccagaact tctt 24
<210>258
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>258
ttaaccaagt accttcctcc tttttcc 27
<210>259
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>259
gctgagcagt gctgacttat aatttaaac 29
<210>260
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>260
cagtttttcc tgtgtgtatt cataaagagt 30
<210>261
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>261
caggctgggt agcatagaag c 21
<210>262
<211>33
<212>DNA
<213> artificially synthesized sequence
<400>262
acttagtcac catttctgat ttctttcttt ctt 33
<210>263
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>263
gagtcggtga atgagtgttg agtag 25
<210>264
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>264
ctcccaaagc attgagatta caatgag 27
<210>265
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>265
ctcaagatgg attaaaactt aaacgtaaga cc 32
<210>266
<211>31
<212>DNA
<213> artificially synthesized sequence
<400>266
attgcttttg gtgttttagt cattaagttg t 31
<210>267
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>267
caagcttggc caaagaagtc aa 22
<210>268
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>268
ctatcaaagg ttccacagac aacct 25
<210>269
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>269
gtcagtaagt catggtcttt ctgct 25
<210>270
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>270
ggtgccaaac agttagcaaa gttttta 27
<210>271
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>271
ttcgacaggc acacaccatt at 22
<210>272
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>272
tgaacggcca tctcaaaata tttccaata 29
<210>273
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>273
cttcatccct aggatgcagc a 21
<210>274
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>274
cccattcact gtgatattgg ctc 23
<210>275
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>275
cctctctctc aatgattttc ttccagttc 29
<210>276
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>276
gaaaaagtaa atagcaaagc tgactgagt 29
<210>277
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>277
ccaccactaa tcccacagat gtc 23
<210>278
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>278
catcctgaga gatgaaagta gtatctgttt 30
<210>279
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>279
tgaggcacag agtgttctga ga 22
<210>280
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>280
ggaaaatcct tcaatggctg cat 23
<210>281
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>281
gccatccaga ccaccttcat ag 22
<210>282
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>282
ccttctttcc ctcagaatcc tcca 24
<210>283
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>283
agaggttaaa tgtgcttaac accct 25
<210>284
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>284
gactacatca tcctgtgtag aaaccag 27
<210>285
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>285
tcctgtgcat aaaatgcaga cct 23
<210>286
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>286
caggtgtttg gtaggctaca tca 23
<210>287
<211>33
<212>DNA
<213> artificially synthesized sequence
<400>287
ttactttcga ctcttttgta ataacactta gct 33
<210>288
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>288
aaaaagaaaa agttaactgt aaagtagcct ca 32
<210>289
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>289
gtgctctatt tttatatgac tggcagtaca 30
<210>290
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>290
ctcctgtgtt ttcttctagt gtttttgtt 29
<210>291
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>291
cagaacaaaa ccaagaaaat ccaaaagcta 30
<210>292
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>292
ccagagaggt tacactccca cta 23
<210>293
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>293
ctcagcaact ctacttctaa gaatttaccc 30
<210>294
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>294
tgtgagctgt tgctagtaat gtactaaag 29
<210>295
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>295
ggtactgaga gggagtgtca ca 22
<210>296
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>296
cctaatcttc ctcaaattct gtactagct 29
<210>297
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>297
gtaccttatt aggcaaaaac ctcttcct 28
<210>298
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>298
gcaaggcttt gtcttctgta actg 24
<210>299
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>299
ggccaaggtt ccacatggat at 22
<210>300
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>300
gcttcatctt ggtgaatcag tagttatttt 30
<210>301
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>301
catcaacctt aaataggata ccagtcagt 29
<210>302
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>302
agtcagtttc aacagtgaaa tggtgataat 30
<210>303
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>303
ccctggcttc acccactagt at 22
<210>304
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>304
agtcaggcat catttttgac ctgt 24
<210>305
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>305
aaatgaatga caaagaatgc caagca 26
<210>306
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>306
tttcacaggt tctctgttgc tca 23
<210>307
<211>31
<212>DNA
<213> artificially synthesized sequence
<400>307
gaaaattaac aacgatattc agggcttgaa a 31
<210>308
<211>33
<212>DNA
<213> artificially synthesized sequence
<400>308
gcttcaaaga acttatttct gccttaattt cat 33
<210>309
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>309
ggctggtaca agaagggtca ta 22
<210>310
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>310
gggaccatgt aaatgacatg ggattt 26
<210>311
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>311
aaaaagtcta ggatcaggtg gataca 26
<210>312
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>312
gatggatttc gtttattgat atgcatgtgt 30
<210>313
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>313
gggaacaaaa ctcactttcc gact 24
<210>314
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>314
caactttgaa tcatccgtgt gaagag 26
<210>315
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>315
gtatcgtctc caaggagcac tt 22
<210>316
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>316
cccatcatgc atttatagag tagtgctaat 30
<210>317
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>317
gaacacaacg tttatggtcc taaaagttt 29
<210>318
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>318
agaacaaatc taccaggtga tctattcatt 30
<210>319
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>319
aaaacagttc ttaaccactg tttgtagaaa 30
<210>320
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>320
gactgtctta atacagttct gcaacttttt 30
<210>321
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>321
ccctggcaag taatggacaa tg 22
<210>322
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>322
gggttcagta gagaattcat gtgact 26
<210>323
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>323
tcaatcctcc ctgctgcagt ata 23
<210>324
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>324
agaaacaact gcttaagcct ccttac 26
<210>325
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>325
tctattgaga agccaacact ccatg 25
<210>326
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>326
tgctttcttc ctgcatagtc tgttc 25
<210>327
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>327
cattcctctc cagctcacca tt 22
<210>328
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>328
tgaaatcatg actttggaaa acctgtttc 29
<210>329
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>329
gcctctcacc ttctacagtc ca 22
<210>330
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>330
aagtggtctc tgctcctgaa tg 22
<210>331
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>331
ccaatggaaa agcaaggact tgtc 24
<210>332
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>332
ccctgcctgg cctatataat cattttt 27
<210>333
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>333
aggtcaggct tcttatagct gga 23
<210>334
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>334
cttggaaact cttgaggttt tgatactg 28
<210>335
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>335
cactgcactc tatagcctgg at 22
<210>336
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>336
gtgcctggca gctctatttt t 21
<210>337
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>337
caagtaggaa tgaccacacc caaa 24
<210>338
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>338
tgactgcagt tgcttggaac ta 22
<210>339
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>339
gggagaccac atctctacaa ataaagag 28
<210>340
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>340
gctttttcag aagaatttcc aactctga 28
<210>341
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>341
ggctgcacag gaaagacttc tt 22
<210>342
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>342
ctcaacatct ttggaacctc cttatagtg 29
<210>343
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>343
acagattggt gctggcctta aaa 23
<210>344
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>344
gtgacagagc gtttaatctt ttaatcagc 29
<210>345
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>345
gtgaatgggc agcagtgaat tg22
<210>346
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>346
tgtgagtgcg agttctttct tcc 23
<210>347
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>347
taggtcaatg aagaagaccc tgtaca 26
<210>348
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>348
gcaggagtca agctgattaa ttacac 26
<210>349
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>349
caaagtgagg cttcctagaa agct 24
<210>350
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>350
tcattcctct tctaaagatg tcatgaagc 29
<210>351
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>351
ggctttttag cccatctgca att 23
<210>352
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>352
gaggacactt ctaaagcatt tctctcta 28
<210>353
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>353
actcagacac aagggagact ga 22
<210>354
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>354
cttagtccca tctgggagta caga 24
<210>355
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>355
ccatgagcac aacatgtaat cacttg 26
<210>356
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>356
cagtttgtgc agtcagttct tactg 25
<210>357
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>357
gcctggtcaa agagccattt ct 22
<210>358
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>358
gaaaccttca ttcactctgg tcctt 25
<210>359
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>359
tgctgcaagt gagtgtggaa tt 22
<210>360
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>360
cgtgtgcttt agaagtgata gcaac 25
<210>361
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>361
agtcctcttg gaaaggtgaa tgc 23
<210>362
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>362
ccttttgcca acactaggca ttg 23
<210>363
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>363
cctctatggg agcccatgta aat 23
<210>364
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>364
ataggcacag cacagaagaa gcatt 25
<210>365
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>365
agtcctccaa ctgtcttctc cat 23
<210>366
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>366
ccagtgactg tgtagatctg agaag 25
<210>367
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>367
gaactcacag aatcatattt gtgatctgga 30
<210>368
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>368
ggacttaata ctgtagccta ggaaggt 27
<210>369
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>369
aatagatgaa caagtgctag ccagaaa 27
<210>370
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>370
taagtgactc ctgggcagtt ct 22
<210>371
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>371
agctcagtcc acacttgtta ctg 23
<210>372
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>372
caaggaaatc cttgaagacc tagaagaaat 30
<210>373
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>373
acagaatgaa acacgtggag agaa 24
<210>374
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>374
cattgcaagt gtggtatctt ggtg 24
<210>375
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>375
ttggaggagg gacatctggt ta 22
<210>376
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>376
cttctgttgt gcatacactt aaatacgg 28
<210>377
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>377
acatgcattt acggatgtac acaaaag 27
<210>378
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>378
catcccttac tctgttctca ttcaca 26
<210>379
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>379
gaaacaacta gctcagcagg actt 24
<210>380
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>380
gtcacattct tgttgagctg ctaga 25
<210>381
<211>20
<212>DNA
<213> artificially synthesized sequence
<400>381
gcagatagaa gggcaggtgc 20
<210>382
<211>33
<212>DNA
<213> artificially synthesized sequence
<400>382
aactacagga tgcatttaaa taatgagatc cat 33
<210>383
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>383
acctcctgat tttcctccta tccttc 26
<210>384
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>384
cactttgctc ttctgccatt tgag 24
<210>385
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>385
ccaagatgga gccagtggaa ag 22
<210>386
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>386
cacagcctct tttgaataga tgcag 25
<210>387
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>387
caacatatga atttggcagg gacattaa 28
<210>388
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>388
ctgcacctgg atgagattat tcttatcaaa 30
<210>389
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>389
cattaatagt acatgctaca tgggtggaa 29
<210>390
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>390
ccaccttcca gcctttaaaa cc 22
<210>391
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>391
acttgagccc agatgtttca gaa 23
<210>392
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>392
ttggtggaac taacaggatt tgct 24
<210>393
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>393
actttttctg cctgctttgt aaatacc 27
<210>394
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>394
ggtattgctg gcttttgtct ctg 23
<210>395
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>395
gggttcccat gtgcttaata aaacc 25
<210>396
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>396
gggagtgtat gaaatttaga tgggatcat 29
<210>397
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>397
gtatcccaag gtctctgttc caag 24
<210>398
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>398
gtgtttgata tgagttgcct ttttcct 27
<210>399
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>399
tcacaagtgc aggaatcctt cac 23
<210>400
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>400
tgttttagac cttggaataa agcagtg 27
<210>401
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>401
agtgttaaca aagctctttg agactatcaa 30
<210>402
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>402
ctcaccctca gtcatccttt atttgtt 27
<210>403
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>403
cctcctccct cacttactca ttcatttat 29
<210>404
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>404
aaggtcctca gcattgaagc aa 22
<210>405
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>405
ccctgatcag gaagagttgt caatt 25
<210>406
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>406
tcagtgcttt gacagtgctt agt 23
<210>407
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>407
agagtagtac ttactttcct tcaaggactt 30
<210>408
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>408
cccgtgtaag atggcaaagt taatctataa 30
<210>409
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>409
ggttttccag accacacaga gaag 24
<210>410
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>410
tggttgtttt tggcagataa agactg 26
<210>411
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>411
agcatctgca aaagggcaat aaag 24
<210>412
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>412
ggccagtcct gctgtctttt ag 22
<210>413
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>413
tgcacagctt cctaacgtga tc 22
<210>414
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>414
gtcctttcct ttcttgaact cagagt 26
<210>415
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>415
gctgaggcag aagagtttcc ttag 24
<210>416
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>416
taggatgcaa ctccatcttc ctgata 26
<210>417
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>417
ggctctcagg cttttctctc aa 22
<210>418
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>418
cctgaaatgt ccttatgtga ttagagttct 30
<210>419
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>419
tcatgacagc ttataactag gcctttc 27
<210>420
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>420
gagttcaaga gctgtggagt gt 22
<210>421
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>421
tctccacatc ccagctatcc aa 22
<210>422
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>422
actgtggtaa atatccttgc atcttttctt 30
<210>423
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>423
gtgacaggag gagcagtccc aaa 23
<210>424
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>424
gggaactaga gaaaagccca ttct 24
<210>425
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>425
ccgcctgtat ctgaatacag ca 22
<210>426
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>426
ttttagaatc ctgcctttca gagtgaaa 28
<210>427
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>427
ccaactctgc attttcaggg atct 24
<210>428
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>428
cagatcgctc atgctgtttg tg 22
<210>429
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>429
cagtatctta aaggaacatg cagtacct 28
<210>430
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>430
tctcaggaca catgtcattt actagga 27
<210>431
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>431
ctctcagcac tgaacacgga ta 22
<210>432
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>432
actgtaagtt gggtcttcta cccttatt 28
<210>433
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>433
agcactagac tgggctagga at 22
<210>434
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>434
aaaaagtggt tgaagaacac tatcttagga 30
<210>435
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>435
ccagtcctct ggacctttat acatg 25
<210>436
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>436
tcttgaatga atggattctc gacatgattt 30
<210>437
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>437
gcaccaattg gtgtctgtga aa 22
<210>438
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>438
cggtttagtg gatattttgt cccatttatc 30
<210>439
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>439
gcctggctag gactcaatcc ta 22
<210>440
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>440
ggttggtgtc ggaattgaat tgaattg 27
<210>441
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>441
cattaccttt gacatctgag cctctt 26
<210>442
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>442
aaagtttcca gtggatggga aagt 24
<210>443
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>443
cagctaagaa accaccacat gga 23
<210>444
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>444
tcagggtcat ctctatctct tgatctc 27
<210>445
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>445
ggtgatacag ctgtgaatgg ca 22
<210>446
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>446
aacttgcacg tcacttactt cct 23
<210>447
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>447
ccggcatcac tgattagatc attg 24
<210>448
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>448
cgttgtaatt tcctgagaga tggtga 26
<210>449
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>449
actacagaga gagggagaag aaatacac 28
<210>450
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>450
tacctctgac ctcttctttc cactt 25
<210>451
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>451
cactttatgg tttctcaacc taggcta 27
<210>452
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>452
gcagcatatc aagacatcgt ttatacaaaa 30
<210>453
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>453
ggcaaatata cgtaaaattc atcacactct 30
<210>454
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>454
ccttctttaa aaacgtgact ttcgct 26
<210>455
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>455
gctattgaag gaaactaaaa catttcacct 30
<210>456
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>456
aaatcaggtt ataggaggga gagaagag 28
<210>457
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>457
tgtataggta atactggctc atgagctaat 30
<210>458
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>458
gcacagttcc tagcactcag taaat 25
<210>459
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>459
ctcctacgct atacatttgt ttatccctt 29
<210>460
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>460
gtcttctgga atcctctgat aatagcg 27
<210>461
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>461
ctttgtaaaa attgttcagg aacagtctct 30
<210>462
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>462
ccttttcagt actccattta ttttggttgc 30
<210>463
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>463
tagtcatcat accctacaaa ccacct 26
<210>464
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>464
gattgtttca ctaactgtct aattcagtgc 30
<210>465
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>465
ggagctccct gcattcaatt taga 24
<210>466
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>466
ggagaggaat agtagcttct gaagaataca 30
<210>467
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>467
agactgaaaa atagatctgc tttttgtgc 29
<210>468
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>468
ataaagtgag cgtcgagttg ct 22
<210>469
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>469
cacgttagga aggtggtttt gatc 24
<210>470
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>470
ccctcattca cacatctgca gt 22
<210>471
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>471
acatgtttga aaacaaatga ctatgaagac 30
<210>472
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>472
cagaaagttt acagtctgtc ctcagaag 28
<210>473
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>473
gcaggtagtc tctgggatct aga 23
<210>474
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>474
cgcataactg ccctctttga ct 22
<210>475
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>475
gcgggagtaa taataatggc cat 23
<210>476
<211>20
<212>DNA
<213> artificially synthesized sequence
<400>476
gtagtgcctg gaccagagtg 20
<210>477
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>477
ttttcacttc tcagaaactt tcatgcaatt 30
<210>478
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>478
gtctagttcc actctgtagc tgttc 25
<210>479
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>479
cgcaaagaaa ttcaaacgct agca 24
<210>480
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>480
ggattcgact tcttcctagt ttagacttt 29
<210>481
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>481
caggatccag aacaaaacca gtg 23
<210>482
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>482
agtggttttt ggtgtctctg attctt 26
<210>483
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>483
aacccagagc caatatcaca gtg 23
<210>484
<211>31
<212>DNA
<213> artificially synthesized sequence
<400>484
atgatttggc tttctgttat tggtgtatag a 31
<210>485
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>485
gtaggctgag ggacagggaa ct 22
<210>486
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>486
ccaaggtcac acaggtattc agtaa 25
<210>487
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>487
agtaccattc aggacacaga aatgg 25
<210>488
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>488
ggttttgatt tgcatgtctg taataacca 29
<210>489
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>489
ctttagcaag ttgaagtcct tatctctct 29
<210>490
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>490
agctacgaaa gcaaggcatt ga 22
<210>491
<211>19
<212>DNA
<213> artificially synthesized sequence
<400>491
ccggtgccac agtgttctc 19
<210>492
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>492
attttccagg tgcggagttc a 21
<210>493
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>493
ctatcgaaag cagacctgtc caaa 24
<210>494
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>494
tagttggtct agacatccat acatcctc 28
<210>495
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>495
agattgtatc atcacttgtg atggcag 27
<210>496
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>496
catctgtaaa gttgcagaca gtctgt 26
<210>497
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>497
aattctaaac atggtgttca gaggaagt 28
<210>498
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>498
cttcactgtc cttgtctttc agct 24
<210>499
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>499
gggatgtaaa gcccaggata gaatc 25
<210>500
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>500
tcaagactgt gtgttggcca g 21
<210>501
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>501
agaggactac tgtccacagg aat 23
<210>502
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>502
agttgggcat taatctctcc aaatctt 27
<210>503
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>503
taaaaagcta ttcacgcctg ggt 23
<210>504
<211>20
<212>DNA
<213> artificially synthesized sequence
<400>504
accatctttg acctcccagc 20
<210>505
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>505
agcttggagg actgttgaag g 21
<210>506
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>506
gtgtgccctc tatgtgtata ttttggaa 28
<210>507
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>507
agaaagaaag aaatcagaaa tggtgactaa gt 32
<210>508
<211>21
<212>DNA
<213> artificially synthesized sequence
<400>508
gatcatgctg ctgatggtcc a 21
<210>509
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>509
cttcctgaaa gacaaggacc atatctc 27
<210>510
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>510
gcgcaaacat agtgctttag cttg 24
<210>511
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>511
atctttatca caaacatttt acatgcagtt at 32
<210>512
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>512
ctgcctgctc agacttctat gt 22
<210>513
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>513
gagtccatga gaacagtgat cactg 25
<210>514
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>514
ggacataaga tctgagcctc aaagaa 26
<210>515
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>515
tctatactcc tgcagctcac cat 23
<210>516
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>516
ccctcgagat agctcagttc atc 23
<210>517
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>517
ccattatgcc tgccttcaaa ttct 24
<210>518
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>518
ccttgtaatg tgaaccctct gaaaca 26
<210>519
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>519
ccttcttctg gatacctcct agga 24
<210>520
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>520
tcatgtattt ttggtgagct ggtgta 26
<210>521
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>521
ctagaccagc ctggaaaaca tgat 24
<210>522
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>522
cttgagatgg tgtttcgcca tg 22
<210>523
<211>19
<212>DNA
<213> artificially synthesized sequence
<400>523
gagtctggct ggcatctgg 19
<210>524
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>524
cgagggagtt gtgatccttt gaag 24
<210>525
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>525
agacagcatc tctctttaaa cacaca 26
<210>526
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>526
gaaaatccgt gagaattttc atgcgt 26
<210>527
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>527
ccattcactg atatcctccc tcagattatt 30
<210>528
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>528
tgtgtccaca acatagagtc caaac 25
<210>529
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>529
cggcttcagg gactaaagag tag 23
<210>530
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>530
gcatcagcca cttttctcct gttaata 27
<210>531
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>531
ctaagctagc acctgatgcg aa 22
<210>532
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>532
gcaaagtaaa tgctacctgt tattgttgtt 30
<210>533
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>533
gccaaaactc aaacccggtt tttaaa 26
<210>534
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>534
ctgtatcaat agttgcattg tcatcacat 29
<210>535
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>535
ccctcaaaca tccagttacc act 23
<210>536
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>536
agtgattgtt gccagtgttt tgg 23
<210>537
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>537
gaccaaccaa atcagagtat ccca 24
<210>538
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>538
acttccctgt acattaggat cacct 25
<210>539
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>539
gcccatggac acattctcac tc 22
<210>540
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>540
catttttatc ctatgtggca tcctttctg 29
<210>541
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>541
atctgctaac agtcactcta gagct 25
<210>542
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>542
cctgcatttt gtatagaagt tccaatttca 30
<210>543
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>543
aatgaacttg ctacctggtt atcagg 26
<210>544
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>544
tgttctacta accctcttgg aaacca 26
<210>545
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>545
ggatttccag ctctctaata cctttgtaa 29
<210>546
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>546
atgtccagct caatattcat gacatatgt 29
<210>547
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>547
ccactaataa cctgattgca cggtt 25
<210>548
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>548
tgtggtcact gagataaagt ttgtgt 26
<210>549
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>549
cccttccctc cttatcttca gca 23
<210>550
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>550
atgcagagtg tgggaagatg ac 22
<210>551
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>551
cttcgtgctt cctctgatta aaacc 25
<210>552
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>552
ggagccacca ggcttttata ttttt 25
<210>553
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>553
aggttctgtt gtttagcagt aaaatctttt 30
<210>554
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>554
tcgatgccac acctgtgata ac 22
<210>555
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>555
tgaaaagcaa aatctagaca cttggagatt 30
<210>556
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>556
cattgaaggc atgatctccc aact 24
<210>557
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>557
catgaaagcc aatttccttg tcattaaaaa 30
<210>558
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>558
cattaggtat ctgggattcc ttcactc 27
<210>559
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>559
gttaccacgt tcatctgacc act 23
<210>560
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>560
ccctttttga tttctgatac ctcacttg 28
<210>561
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>561
gccagccaag tcatcctgat tt 22
<210>562
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>562
cttaggtaag tggtggttag gttcttttt 29
<210>563
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>563
cccaatttga tggcaaacct gt 22
<210>564
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>564
ccagcaatga agaagagttt tgctttt 27
<210>565
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>565
ggcagccact gaataattct acatttcata 30
<210>566
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>566
ggatattgaa gacagaaact ccttttgagt 30
<210>567
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>567
cacaaaggga agctcatcag acttaa 26
<210>568
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>568
cttcccttca ggaactcttg taagg 25
<210>569
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>569
cacaagcagg gttctccctt ac 22
<210>570
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>570
caagtgcatt cagaagttat ctgttgaat 29
<210>571
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>571
aagcaccacc agtcaatact cag 23
<210>572
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>572
gtagccaggc ttcaggacaa aa 22
<210>573
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>573
accagaaaat ttcaacatgg gagact 26
<210>574
<211>23
<212>DNA
<213> artificially synthesized sequence
<400>574
cccttcttcc ttaacctttg cct 23
<210>575
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>575
cctccttagt gaaatgtcgt tctca 25
<210>576
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>576
cctgggaagt ctgcatttgg ag 22
<210>577
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>577
acctgttttc ttaacacaac acagtaca 28
<210>578
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>578
acatttgtgt tgttaagctg ctcaaaa 27
<210>579
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>579
ttgtgtgacc atcatagagt cacttac 27
<210>580
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>580
tcgacagtag tgcagtgtcc ta 22
<210>581
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>581
ttatttcttc aacaataaat caacatagcc ag 32
<210>582
<211>32
<212>DNA
<213> artificially synthesized sequence
<400>582
aaagaaaata tttgataaag ctgtccagtg tg 32
<210>583
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>583
catttcaggc agatcaaaga ttaacatgt 29
<210>584
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>584
tgtttggatt gttggccttt ttcttttt 28
<210>585
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>585
cacactggca cagtcttcct ac 22
<210>586
<211>25
<212>DNA
<213> artificially synthesized sequence
<400>586
catgctttgt tttgcacatg aacaa 25
<210>587
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>587
gcatgtgttt gttatctgtt gctaca 26
<210>588
<211>26
<212>DNA
<213> artificially synthesized sequence
<400>588
tgcactttga aatgtgttct agagga 26
<210>589
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>589
gcttgtatag gcatggatta tctctgg 27
<210>590
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>590
caaactagat ggttgagggt tatgtct 27
<210>591
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>591
ccctttctag acaggcaggt tt 22
<210>592
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>592
gggaattaga taaactaggg ctttcacaa 29
<210>593
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>593
gagagtgcca gggcttttaa aataaaa 27
<210>594
<211>30
<212>DNA
<213> artificially synthesized sequence
<400>594
tccttcaaag tgaaagaatt cttgaggata 30
<210>595
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>595
tccctcatgc ttagggcaat tc 22
<210>596
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>596
gagtgtggat attttgctgt agttttcc 28
<210>597
<211>28
<212>DNA
<213> artificially synthesized sequence
<400>597
taagaattct ctggatgcca caaattca 28
<210>598
<211>22
<212>DNA
<213> artificially synthesized sequence
<400>598
ggacaggctt gccttagaca aa 22
<210>599
<211>27
<212>DNA
<213> artificially synthesized sequence
<400>599
cgaagacaca ttcttcttct aatgtgg 27
<210>600
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>600
ttgctcagat aatgctggaa ttcatactt 29
<210>601
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>601
gttaagatcc actggtttga aattctcac 29
<210>602
<211>20
<212>DNA
<213> artificially synthesized sequence
<400>602
ttgagactgc tgaagctgca 20
<210>603
<211>24
<212>DNA
<213> artificially synthesized sequence
<400>603
aaaaactcca ccgagctaaa gtag 24
<210>604
<211>29
<212>DNA
<213> artificially synthesized sequence
<400>604
ccagtcaaac ttatgtttgg tcttttcac 29
<210>605
<211>31
<212>DNA
<213> artificially synthesized sequence
<400>605
gaattggata aagagtcaag actcattgat g 31
<210>606
<211>31
<212>DNA
<213> artificially synthesized sequence
<400>606
ttactgtgtg gaagtctaag tctttttgta g 31
Claims (3)
1. The primer group for detecting the gene mutation of the hepatolenticular degeneration disease ATP7B is characterized by comprising a primer group I and a primer group II, wherein the primer group I comprises upstream and downstream primer sequences shown as SEQ ID NO. 1-304, and the primer group II comprises upstream and downstream primer sequences shown as SEQ ID NO. 305-606.
2. A kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease, which comprises the primer group of claim 1, wherein the upstream and downstream primers in the primer group I are mixed and diluted in equal amount, and the concentration of the upstream and downstream primers in the primer group I is 400 nM; and (3) mixing and diluting the upstream and downstream primers in the primer group II in an equivalent manner, wherein the concentrations of the upstream and downstream primers in the primer group II are both 400 nM.
3. The kit of claim 2, further comprising at least one of a PCR reaction solution, DNA ligase, primer digest solution, ligation buffer, P1 linker, Barcode X specific linker, library amplification reaction solution, library amplification primer solution, AMPureXP magnetic beads, and nuclease-free water.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811596140.4A CN109609617B (en) | 2018-12-25 | 2018-12-25 | Primer group and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811596140.4A CN109609617B (en) | 2018-12-25 | 2018-12-25 | Primer group and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease |
Publications (2)
Publication Number | Publication Date |
---|---|
CN109609617A CN109609617A (en) | 2019-04-12 |
CN109609617B true CN109609617B (en) | 2020-06-05 |
Family
ID=66010725
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811596140.4A Active CN109609617B (en) | 2018-12-25 | 2018-12-25 | Primer group and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109609617B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112233725A (en) * | 2020-10-14 | 2021-01-15 | 合肥达徽基因科技有限公司 | ATP7B gene mutation second-generation sequencing automated analysis reading method and report system |
EP4367260A1 (en) * | 2021-07-09 | 2024-05-15 | Hubro Therapeutics AS | A primer |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104830966A (en) * | 2015-02-14 | 2015-08-12 | 郑州人民医院 | Method of direct DNA sequencing for screening hepatolenticular degeneration disease gene mutation site through PCR amplification |
CN104928389A (en) * | 2015-06-23 | 2015-09-23 | 安徽中医药大学神经病学研究所附属医院 | Method and kit for detecting human ATP7B gene mutation type |
CN106011302A (en) * | 2016-08-05 | 2016-10-12 | 深圳市人口和计划生育科学研究所 | ATP7B (ATPase Cu2+transporting beta polypeptide) gene mutation detection primer set and kit, ATP7B gene mutation detection method and uses of ATP7B gene mutation detection primer kit |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107955832B (en) * | 2017-09-08 | 2021-05-14 | 广州市达瑞生物技术股份有限公司 | Primer set and method for simultaneously detecting thalassemia, deafness, phenylketonuria and hepatolenticular degeneration disease |
-
2018
- 2018-12-25 CN CN201811596140.4A patent/CN109609617B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104830966A (en) * | 2015-02-14 | 2015-08-12 | 郑州人民医院 | Method of direct DNA sequencing for screening hepatolenticular degeneration disease gene mutation site through PCR amplification |
CN104928389A (en) * | 2015-06-23 | 2015-09-23 | 安徽中医药大学神经病学研究所附属医院 | Method and kit for detecting human ATP7B gene mutation type |
CN106011302A (en) * | 2016-08-05 | 2016-10-12 | 深圳市人口和计划生育科学研究所 | ATP7B (ATPase Cu2+transporting beta polypeptide) gene mutation detection primer set and kit, ATP7B gene mutation detection method and uses of ATP7B gene mutation detection primer kit |
Non-Patent Citations (1)
Title |
---|
中国人WD患者基因突变谱的研究及其基因型与中医证型的关系分析;张海云;《中国优秀硕士学位论文全文数据库(医药卫生科技辑》;20141215;第21-25页 * |
Also Published As
Publication number | Publication date |
---|---|
CN109609617A (en) | 2019-04-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108588236B (en) | SNP rapid detection method for monitoring genetic quality of inbred line, SNP locus and primer thereof | |
US20190203285A1 (en) | Method for predicting organ transplant rejection using next-generation sequencing | |
CN110527736B (en) | SNP marker combination for rice germplasm resource and variety identification and application thereof | |
CN107488711B (en) | Method for detecting genotype of point mutation and kit thereof | |
CN107058538B (en) | Primer composition, kit composed of primer composition and application of kit | |
CN109609659B (en) | SNP loci for monitoring genetic quality of CBA/CaJ inbred line mice, primer combination and application thereof | |
CN106554955B (en) | Method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof | |
CN109609617B (en) | Primer group and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease | |
CN109486937A (en) | A kind of construction method and its kit in the genetic test library of heredity hypertrophic cardiomyopathy | |
CN114438210B (en) | Library construction method based on high-throughput sequencing endometrial cancer molecular typing | |
CN109628573B (en) | Kit for noninvasive prenatal detection of 12 chromosome microdeletion and microduplication syndrome and special probe set thereof | |
KR20100013801A (en) | Differential diagnostic method, kit, chip for the dystrophin gene deletion, duplication, point mutation and dmd/bmd screening test therethrough | |
CN108841823B (en) | circRNA _26852 and application thereof | |
US20230032847A1 (en) | Method for performing multiple analyses on same nucleic acid sample | |
KR101890350B1 (en) | SNP maker for predicting meat quality of pig and use thereof | |
KR101051385B1 (en) | Primer set for obesity gene amplification, reagent for amplifying obesity gene comprising same and use thereof | |
CN106957907B (en) | Genetic test for liver copper accumulation in dogs | |
KR102439855B1 (en) | SNP marker composition for discriminating Korean native chicken or new breed chicken and uses thereof | |
CN113981109A (en) | SNP molecular marker combination for pig genetic relationship identification, application and method | |
CN113930485A (en) | Reagent for detecting gene copy number variation and application thereof | |
CN111378735B (en) | SMA pathogenic gene capturing kit and application | |
KR102438915B1 (en) | Methods for detecting target nucleotide sequences Methods and kits for designing and manufacturing probes | |
CN112858693A (en) | Biomolecule detection method | |
KR20120065081A (en) | Dna markers for detecting increase of porcine muscle fiber type i and meat quality containing snp in 3' utr of ppargc1a gene | |
EP2121969A1 (en) | Method of detecting equine polysaccharide storage myopathy |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |