CN109609617B

CN109609617B - Primer group and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease

Info

Publication number: CN109609617B
Application number: CN201811596140.4A
Authority: CN
Inventors: 杨任民; 程楠; 韩泳竹; 杨学习; 林圣�; 杨旭; 徐志珍
Original assignee: Affiliated Hospital Institute Of Neurology Anhui University Of Chinese Medicine; Hefei Dahui Gene Technology Co ltd
Current assignee: Affiliated Hospital Institute Of Neurology Anhui University Of Chinese Medicine; Hefei Dahui Gene Technology Co ltd
Priority date: 2018-12-25
Filing date: 2018-12-25
Publication date: 2020-06-05
Anticipated expiration: 2038-12-25
Also published as: CN109609617A

Abstract

The invention discloses a primer group and a kit for detecting gene mutation of hepatolenticular degeneration disease ATP7B, and belongs to the technical field of disease detection. The primer group designed by the invention aims at the whole gene of ATP7B, and not only can detect known high-incidence mutation, but also can discover new mutation sites.

Description

Primer group and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease

Technical Field

The invention belongs to the technical field of disease detection, and particularly relates to a primer group and a kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease.

Background

Hepatolenticular degeneration (HLD), also known as Wilson's Disease (WD), is a disorder of copper metabolism with autosomal recessive inheritance, a common inherited disease of the nervous system. The data show that the incidence of the disease is 15-30/100 ten thousand in different people worldwide, the prevalence rate is 1/3 ten thousand, and the carrier frequency is about 1/90. WD is mainly copper metabolism disorder caused by ATP7B gene mutation, and is characterized by a large amount of copper deposited in tissues such as brain, liver, kidney, cornea and the like and free radical generation, causing damage to multiple organs, complex and diverse clinical manifestations, high clinical heterogeneity, and mainly manifested as acute and chronic neurological/psychiatric symptoms, renal dysfunction, corneal K-F ring and the like. It can be classified into brain type, liver type, mixed type and other types according to its clinical symptoms. WD is primarily diagnosed by its clinical manifestations and biochemical tests, including detection of serum ceruloplasmin, 24-hour urine copper and gene mutation analysis. WD is one of the few genetic diseases that can be treated, and most patients have good prognosis if they are diagnosed in early disease stage or prophase of symptoms and control copper intake and carry out copper-removing treatment in time; otherwise, the disease condition will gradually worsen and even endanger life.

The pathogenic gene of hepatolenticular degeneration disease is ATP7B gene, ATP7B gene is located at 13q14.3, the full length is 80Kb, 21 exons and 20 introns are contained, 1465 amino acids are coded, and the coding sequence codes P-type copper transport ATPase. The ATPase has 6 copper ion binding regions, 8 transmembrane functional regions, 1 transduction region, 1 ion channel and phosphorylation region, 1 nucleic acid binding domain and 1 ATP binding region. More than 800 gene mutations are reported in the ATP7B gene and distributed in the whole gene at present, the gene mutation modes comprise insertion mutation, deletion mutation, frameshift mutation, splicing mutation and the like, particularly missense mutation in point mutation is taken as the main point mutation, most of the mutation appears on an exon, and a few of the mutation appears in a boundary flanking region of the exon and an intron. In addition, studies have reported that DNA sequences other than exons (e.g., introns, promoters, and other regulatory regions) may have unknown changes that affect the expression of the ATP7B gene.

At present, the detection method of the ATP7B gene mutation comprises the following steps: RFLP/STR/SNP-family linkage analysis, PCR-SSCP analysis, PCR digestion and fluorescence PCR technology, Denaturing High Performance Liquid Chromatography (DHPLC) analysis, DNA sequencing technology, DNA microarray technology and the like.

In recent decades, sequencing technologies have been developed at a high speed, Sanger sequencing and chemical degradation methods have been widely used in the fields related to medicine and life science as representatives of the first generation of sequencing methods, and although sequencing reading is long, accurate and reliable, it is difficult to realize micro-quantification and high-throughput quantification due to the dependence on electrophoretic separation technology, which results in high sequencing cost and low sequencing efficiency. In recent years, Next Generation Sequencing (NGS) represented by chip sequencing, sequencing by synthesis and pyrosequencing can make up for the deficiency of one generation sequencing, and realize rapid and high-throughput large-scale sequencing. TorrentPGM at Ion^TMThe sequencing technology represented by the individual genome sequencer and the high-throughput Ion Torrent Proton sequencer does not belong to biochemical technologies of fluorescence detection and nucleic acid marking, and is simpler, higher in cost performance and strong in expansibility compared with other second-generation sequencing technologies. The core of Ion Torrent sequencing principle is to convert chemical signals into digital signals by using a semiconductor technology, the technology adopts a semiconductor chip which is distributed with small holes, each small hole is a sequencing reaction pool, sequencing is carried out while synthesis, when each nucleotide is added to a synthesized DNA chain by DNA polymerase, hydrogen ions are released, so that the pH value in the reaction pool is changed, an Ion receptor below the reaction pool can sense the signals at the moment, the chemical signals are directly converted into the digital signals, and the DNA sequences are read.

There are patent reports about the detection of ATP7B gene mutation, such as the kit for detecting hepatic lenticular degeneration ATP7B multi-site mutation invented by Huangjia et al, a Beijing friendship Hospital affiliated to the university of capital medical science, but it only detects the high-incidence mutation site on individual exon, but does not cover the detection of ATP7B whole gene.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a primer group and a kit for detecting the ATP7B gene mutation of the hepatolenticular degeneration disease, wherein the primer group designed by the invention is specific to the whole gene ATP7B, and not only can detect known high-frequency mutation, but also can discover new mutation sites.

In order to achieve the purpose, the invention adopts the technical scheme that: a primer group for detecting the gene mutation of hepatolenticular degeneration ATP7B comprises a primer group I and a primer group II, wherein the primer group I comprises upstream and downstream primer sequences shown as SEQ ID NO. 1-304, and the primer group II comprises upstream and downstream primer sequences shown as SEQ ID NO. 305-606.

In addition, the invention also provides a kit for detecting the gene mutation of hepatolenticular degeneration disease ATP7B, which comprises the primer group.

As an improvement of the technical scheme, the upstream and downstream primers in the primer group I are mixed and diluted in equal amount, and the concentrations of the upstream and downstream primers in the primer group I are both 400 nM; and (3) mixing and diluting the upstream and downstream primers in the primer group II in an equivalent manner, wherein the concentrations of the upstream and downstream primers in the primer group II are both 400 nM.

As an improvement of the technical scheme, the kit further comprises at least one of PCR reaction liquid, DNA ligase, primer digestion liquid, connection buffer liquid, a P1 joint, a Barcode X specific joint, library amplification reaction liquid, library amplification primer liquid, AMPure XP magnetic beads and nuclease-free water.

In addition, the invention also provides a group of mutation information of hepatolenticular degeneration disease-causing gene ATP 7B: through searching relevant information such as documents and the like, information such as base change of ATP7B of the hepatolenticular degeneration disease and position on a chromosome is determined by screening an OMIM (online Mendelian inheritance) database, a clinvar database and the like by using an official network of NCBI (national center for Biotechnology information).

In addition, the invention also provides a method for detecting the gene mutation of the hepatolenticular degeneration disease ATP7B, which comprises two parts of library construction and high-throughput sequencing; library construction comprises the following steps: target gene amplification, partial primer digestion, adaptor connection, ligation product purification, library amplification, library purification and library quantification; high throughput sequencing comprises the following steps: template amplification, template enrichment and sequencing on a machine.

In addition, the invention also provides an Analysis method, which adopts a server and software matched with the sequencer to carry out sequence comparison and Analysis, and runs Variant Caller and Coverage Analysis plug-ins to obtain the sequencing result of the sample.

The invention has the beneficial effects that: the invention provides a primer group and a kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease, wherein the kit comprises a primer group, the primer group comprises a primer group I and a primer group II, the primer group I comprises upstream and downstream primer sequences shown as SEQ ID NO. 1-304, and the primer group II comprises upstream and downstream primer sequences shown as SEQ ID NO. 305-606; the primer group designed by the invention aims at the whole gene of ATP7B, and not only can detect known high-incidence mutation, but also can discover new mutation sites.

Drawings

FIG. 1 is a sequence sequencing length distribution diagram.

Detailed Description

To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the following detailed description and accompanying drawings.

Primer set designed aiming at ATP7B gene

A primer for amplifying the ATP7B gene is designed on line by using Ion AmpliSeq Designer, the primer is synthesized by Endori Weijie base (Shanghai) trade company Limited, the primer components are divided into 2 groups according to the characteristics of the sequence, Tm value and the like of the primer, and the primer designed by the invention is shown in Table 1.

TABLE 1

ATP7B gene mutation detection method

Reagent

Nucleic acid extraction or purification reagents (Darrii biotechnologies of Guangzhou city Co., Ltd.), the Qubit dsDNA HSAssay Kit, Ion Ampliseq Library Kit 2.0, Ion Xpress Barcode adapters1-96, absolute ethanol, AMPure XP beads, a general Kit for sequencing reaction (semiconductor method) (Darrii biotechnologies of Guangzhou city Co., Ltd., record number: Yueju mechanical equipment 20160061), isopropanol, sodium hydroxide and the like.

Configuration of primer set

The primers of each group were mixed in equal amounts and diluted to 400nM to prepare primer group I and primer group II.

Sample DNA extraction and quantification

The sample DNA was obtained by conducting an experimental operation according to the instructions accompanying the nucleic acid extraction or purification reagent, and then the DNA concentration was measured by a Qubit3.0 fluorescence quantitative instrument (life technology).

Library construction

1) Amplification of a target gene: preparing a reaction system in a PCR tube according to the table 2, and carrying out PCR amplification according to the table 3; carrying out 2 reactions on each sample by using a primer group I and a primer group II respectively;

TABLE 2

TABLE 3

2) Partial primer digestion: and (3) taking out the PCR tube after the amplification is finished, standing to room temperature, centrifuging at low speed for 3-5 seconds to ensure that no obvious liquid drops exist on the tube wall and the cover, and mixing 2 primer group PCR reaction tubes of the same sample into one tube, wherein the volume of the tube is 20 mu L. Adding 2 mu L of FuPa Reagent into a PCR tube, mixing uniformly by vortex oscillation, centrifuging at low speed for 3-5 seconds, and placing on a PCR instrument for reaction according to the reaction conditions in the table 4;

TABLE 4

3) Connecting a joint: the linker was diluted as in Table 5, the configuration of the ligation reaction system is shown in Table 6, and the procedure of the ligation reaction is shown in Table 7;

TABLE 5

TABLE 6

TABLE 7

4) Purifying a connection product: and adding 45 mu.L of AMPure XP beads into the ligation product for purification to obtain air-dried magnetic beads adsorbing DNA.

5) Library amplification: preparing an amplification reaction solution according to the table 8, adding the amplification reaction solution into the AMPure XP beads dried in the step 4, and transferring the amplification reaction solution into a PCR tube; the procedure for library amplification is shown in table 9;

TABLE 8

TABLE 9

6) Library purification and quantification: adding 36.4 mu L of AMPure XP beads into a PCR tube, blowing, beating and uniformly mixing, transferring into a new 1.5mL EP tube, and standing for 5 minutes at room temperature; placing the EP tube on a magnetic frame, transferring the supernatant into a new EP tube after the solution is clarified, and removing the EP tube on the magnetic frame; adding 57.2 mu L of AMPure XP beads into an EP tube for purification, and finally obtaining 22 mu L of library; measuring the concentration of the library by using a Qubit3.0 fluorescence quantifier;

7) high-throughput sequencing: mixing the libraries into OT mix in equal amount, if each 3ng, mixing, measuring the library concentration of the mixed OTmix by a Qubit3.0 fluorescence quantitative instrument according to the formula

Diluting to 200pM, sequencing the library by using a sequencing reaction universal kit, and carrying out experimental operation according to an instruction matched with the kit;

8) and (3) data analysis: sequence comparison and Analysis are carried out by adopting a server and software matched with a sequencer, VariantCaller and Coverage Analysis plug-in units are operated to obtain the sequencing result of the samples, and each sample generates an Excel table containing all detection site information; when the mutation frequency is 0, the mutant is a wild type, the mutation frequency is a heterozygous mutant at about 50%, and the mutation frequency is a homozygous mutant at about 100%.

Sequencing quality analysis of clinical samples

The 20 samples of whole blood collected clinically were tested as described above, and as shown in FIG. 1, sequencing quality analysis was performed using MultiQC V1.0 after sequencing was completed, where Total _ Reads represents the Total number of Reads detected, Mean ReadsLength represents the average length of the sequenced fragments, Mapping Reads represents the number of Reads aligned with Hg19, ReadsMappled to Target Region represents the number of Reads aligned with the Target gene, Mean Depth of Target Region represents the average Depth of sequencing of the Target gene Region, Fraction of Target Coverage ≧ 100X (%) represents the Fraction of the Target fragment sequencing Depth up to 100X, sensitivity (%) represents the capture specificity ratio, i.e., the ratio of the Target to the Target Region, and Coverage of Target Region (%) represents the result of the Target sequence as shown in the Table 10.

Watch 10

From the analysis of the sequencing results of the above 20 samples, the average sequencing reads number of each sample is 1387406.25, the average sequencing fragment length of each sample is 199.85bp at most and 150.1bp at most, the sequencing average length of 20 samples is 183.58bp, the sequencing average depth is 1859 ×, the percentage average value of the sequencing depth of the target region 100 × is 95% or more, the sequencing uniformity of the target region is 86.22% on average, the sequencing coverage of the target region is 99.44%, and the capture specificity ratio is 59.26%; this indicates that the quality of the clinical sample sequencing is better.

ATP7B mutation Point analysis of clinical samples

1) Determination of mutation points: the identified mutational hot spots were looked up as shown in table 11: NM number NM-000053;

TABLE 11

2) And (3) detecting a clinical sample: 93 clinically collected hepatogram patients were sequenced as described above and relevant inserts were run and the results are shown in Table 12.

TABLE 12

The 93 samples detect 28 mutation types together, the average sequencing depth is 4421 x and is far beyond the requirement of 100x on the sequencing depth on the market, the heterozygous mutation frequency is between 37.7 and 55.1 percent, and the homozygous mutation frequency is between 90.5 and 100 percent, which completely meets the requirement of result judgment of the invention. Therefore, the detection method has the advantages of good accuracy, high flux and good feasibility of being applied to clinical research.

Finally, it should be noted that the above embodiments are intended to illustrate the technical solutions of the present invention and not to limit the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> Hefeida Gene science and technology Co., Ltd

AFFILIATED HOSPITAL, INSTITUTE OF NEUROLOGY, ANHUI UNIVERSITY OF CHINESE MEDICINE

<120> primer set and kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease

<130>2018.12

<160>606

<170>PatentIn version 3.3

<210>1

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>1

gccaaagaca ccgatatttg ct 22

<210>2

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>2

caagtgtcct tggagaacaa aactg 25

<210>3

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>3

aaacaagtgt tactttcaca agcagaaaat 30

<210>4

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>4

acattttctt ccttgcctta gagca 25

<210>5

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>5

taagggagcc actttgctct tg 22

<210>6

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>6

actgtgaaat atgtgccatc ggtt 24

<210>7

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>7

ggcttataga tgaagccatc tccct 25

<210>8

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>8

ttcctggaag cattgtccct g 21

<210>9

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>9

cctgaagtca tcagatgtac tgct 24

<210>10

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>10

tctagaatgg ctcagatgct gttg 24

<210>11

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>11

cgcaacaagc ctgaaaattc caaaa 25

<210>12

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>12

gctgatattc tttcttctgc ttgatcgatt 30

<210>13

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>13

ccctactgtt aaaatcctat cctcctct 28

<210>14

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>14

gttgttttct gactaggctg atcattatct 30

<210>15

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>15

gaaataaagc gtgaagacaa gatagagaaa aa 32

<210>16

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>16

gttaagtctg atgagcttcc ctttgt 26

<210>17

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>17

tgacctcctg aatcaagtgc attc 24

<210>18

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>18

acccttttct cccacacaaa atagtttta 29

<210>19

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>19

aaaaagactt agacttccac acagtaatag tg 32

<210>20

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>20

aggataactg caatgtggtg ct 22

<210>21

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>21

ccatttcctc caagccacac aa 22

<210>22

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>22

tcttcttcaa gttgaggaga gttcttttt 29

<210>23

<211>20

<212>DNA

<213> artificially synthesized sequence

<400>23

acacagccaa agcactggtt 20

<210>24

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>24

gtctatctcc ttcagttctg ttttgatctt ag 32

<210>25

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>25

cacaggagag aaaaggaaca gactatg 27

<210>26

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>26

catgggcttt gtcttggact ct 22

<210>27

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>27

cagggctatg tgtgcattaa cc 22

<210>28

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>28

cacgagattg tgaatgggtt ttctaag 27

<210>29

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>29

aggcaagttc cactgtgcta ag 22

<210>30

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>30

agctttctag gaagcctcac tttg 24

<210>31

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>31

gtttctgcct agaattatag gtatgacaca 30

<210>32

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>32

gaagtggaat ttctaggaca aaagcag 27

<210>33

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>33

ggaaggtgca gttttccttt cctag 25

<210>34

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>34

ttgctaatta tggacctgtt tagcgt 26

<210>35

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>35

tgacgtggaa agacttccat gatg 24

<210>36

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>36

ccagggtggg ttcggtttta ttt 23

<210>37

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>37

gcctcatgac agtgaacagg tt 22

<210>38

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>38

cctcctccag ggtctgatat acag 24

<210>39

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>39

aaaaagaacc taaccaccac ttacct 26

<210>40

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>40

ctattgactg agtgaacaaa tgaatgaact 30

<210>41

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>41

agatgccttc tcctcctgtt ca 22

<210>42

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>42

gtcacatgcc ttggcttctt ttt 23

<210>43

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>43

cctctctgcc tgtctgaaac ata 23

<210>44

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>44

gcttaggttt cctgaaaaat ttaatcccag 30

<210>45

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>45

gtgaaggcct ctcatccatc tt 22

<210>46

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>46

gtgcatgcat gtaacttatc agca 24

<210>47

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>47

tcataaacca gctactgcaa atttcttcta 30

<210>48

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>48

catccaggct atagagtgca gtg 23

<210>49

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>49

cacagtcctt ctctagcaga tgatc 25

<210>50

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>50

ctgaggagag atcaagtttg taatcaca 28

<210>51

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>51

ctcctcgttc catcgtaaat ttgttttt 28

<210>52

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>52

gggacatggt ctcttgctga tg 22

<210>53

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>53

gggaattaca aagcagaaaa atctatttct 30

<210>54

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>54

tcactctgag ttacacaaat gatcatgg 28

<210>55

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>55

gtccagacct tcagacaaca ca 22

<210>56

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>56

gcctatatct gaagttttga gatatgacgt 30

<210>57

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>57

aaaatacagc caagcatctc cact 24

<210>58

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>58

ctctccatca gaatgatttg ctgga 25

<210>59

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>59

ttcaccgtat attgtataaa ccggcaa 27

<210>60

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>60

tggaaatttc caagagactc ctttaaagtt 30

<210>61

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>61

aagactttgt tgatgccaac ctaaga 26

<210>62

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>62

acggatgctt tggaaagacc at 22

<210>63

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>63

tggttaaaaa cctgatagca aaatgcag 28

<210>64

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>64

ccttttagca gcatttctga gca 23

<210>65

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>65

ctcacagacc aaactcagca tca 23

<210>66

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>66

tgtactcctg ctctttctcc ctt 23

<210>67

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>67

ctgaaaataa aaagcaacaa aacccaaact 30

<210>68

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>68

gaacctggga aatgagttcc agt 23

<210>69

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>69

agcatcagca gctacacaag tt 22

<210>70

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>70

ggagccactg cgaagatttc aattata 27

<210>71

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>71

gcagttcacc ttcagcagac ta 22

<210>72

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>72

gcacatggcc aaaaggaaac tg 22

<210>73

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>73

tagctataga agcaggaggg cttt 24

<210>74

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>74

aaaaagactg catgtgtttt agtgct 26

<210>75

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>75

tagctttgtt ttcccttgga ccaa 24

<210>76

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>76

cacggagaga cagagtgatc atttt 25

<210>77

<211>19

<212>DNA

<213> artificially synthesized sequence

<400>77

acctggccaa cacacagtc 19

<210>78

<211>19

<212>DNA

<213> artificially synthesized sequence

<400>78

gcagtggagt ggtgtgact 19

<210>79

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>79

gctttatcct gctgcttctt acca 24

<210>80

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>80

tgaagaatca ctagaaagca atcacagat 29

<210>81

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>81

ataaataaag cagacagaga agggtgg 27

<210>82

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>82

ctgttttcca gaagattgtc tttttgtctt 30

<210>83

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>83

tttaactttt ccttggtgac atgagatca 29

<210>84

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>84

tcctgggtct tcattcttgt ttctg 25

<210>85

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>85

cggtttccaa tcagcacaga gaa 23

<210>86

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>86

caaagacgga cattgcctta tgtttaatac 30

<210>87

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>87

catagaatct aagagacgtg tggaaca 27

<210>88

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>88

cgtttcccaa agtgagcaca tg 22

<210>89

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>89

gctctggaag ctctcatgga aa 22

<210>90

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>90

tttcgttcttcctgtttcca ttctgtat 28

<210>91

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>91

acaacacaag ggcaaactct atca 24

<210>92

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>92

actgagcagg taatgtttgt gagtg 25

<210>93

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>93

gtggtttgac ccacctctac tt 22

<210>94

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>94

cagtttcctc ttcctctctt tccac 25

<210>95

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>95

gggagtgtta accaaagcag attattca 28

<210>96

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>96

gtgtttgtgc ctgtctcctg ttaata 26

<210>97

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>97

gaggaccctt ctaagcggtt tt 22

<210>98

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>98

gcagtaaatg tagaaaggtg acatcattg 29

<210>99

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>99

ctttactctc agttccactt ggctt 25

<210>100

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>100

ctctggtgaa agactctgag tagga 25

<210>101

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>101

cccagtactc ccatttcatg tttg 24

<210>102

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>102

accatgtcct tctctcctag ct 22

<210>103

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>103

aggctgttct ttgcttcaca gat 23

<210>104

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>104

gggaattgta ggctataggt ggtgata 27

<210>105

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>105

catgggtaat ggtgccagtc tt 22

<210>106

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>106

gggagttgtt gaaccctgag att 23

<210>107

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>107

cctccacttg cccaggaaaa a 21

<210>108

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>108

tccaatcaca gatcgctgca a 21

<210>109

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>109

cctaagtgca aaagctactg ggaat 25

<210>110

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>110

tcagcatcag aaacaaaaag ctgaatt 27

<210>111

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>111

aaaaagaatc atcttctttc aaacccaca 29

<210>112

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>112

gcaactgtat agtcttacag gtcatcattg 30

<210>113

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>113

cagaggcagg ttgagagttc aata 24

<210>114

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>114

gtaatgcctc tttgagggaa acct 24

<210>115

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>115

tttgctcaaa cgtcaacttc tcaatg 26

<210>116

<211>19

<212>DNA

<213> artificially synthesized sequence

<400>116

taagcaagct gggcatcgt 19

<210>117

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>117

aggaaagctt aaaaatgcta ttctaaggtg 30

<210>118

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>118

tgcatattgg tggatacctt tccag 25

<210>119

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>119

cacacacagc ctcttcacat cta 23

<210>120

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>120

agtcctttta cagcaagcac atttg 25

<210>121

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>121

cacagcctct ttagcttcca tct 23

<210>122

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>122

tttgttttta tctgcaatat cagggaggat 30

<210>123

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>123

actttccgac aatactcaac attcagg 27

<210>124

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>124

gcttttgcat gaggcttgct c 21

<210>125

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>125

tgttcaattt aagatgggaa atttgaggga 30

<210>126

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>126

gcacaatgag cggaacaatg tttt 24

<210>127

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>127

gacatgaact gctggagtca gt 22

<210>128

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>128

cactgcctac ttgtgacagt acag 24

<210>129

<211>33

<212>DNA

<213> artificially synthesized sequence

<400>129

cctgtatttt cctttctttt tctgaggttt aat 33

<210>130

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>130

gtattagtca ggctggcttc gaa 23

<210>131

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>131

aaagttgttt gtcagggctc ctaa 24

<210>132

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>132

gcaaggataa tcctgctctc tcttttt 27

<210>133

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>133

acaaacataa aaagctattt acattacttg gg 32

<210>134

<211>33

<212>DNA

<213> artificially synthesized sequence

<400>134

gcaggtttct attaaagatc tcctttacat tct 33

<210>135

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>135

ctgcagcacc aacaactgtt tt 22

<210>136

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>136

cagggaagca aaacaaagag aataattgat 30

<210>137

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>137

atccatacca ccaacgtcaa agtt 24

<210>138

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>138

acaccacttt ggctcagatt gt 22

<210>139

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>139

tccaagacat cctcggaaat ctaga 25

<210>140

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>140

ctgggaagaa tgaccttaaa ggga 24

<210>141

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>141

agggactcat cagccatggt at 22

<210>142

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>142

cacagaactt gtcttcatga ggtagtag 28

<210>143

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>143

acccacgttc tctgccattt ta 22

<210>144

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>144

gatagaaatt ggtaccaaga agtggagt 28

<210>145

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>145

gtctgagaaa cagcaagaaa gcaa 24

<210>146

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>146

gcattttcac atcttgttaa cacatgatct 30

<210>147

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>147

ggcagaaaac tgcttaaagg tgtc 24

<210>148

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>148

gctcactgat gccatagcat aga 23

<210>149

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>149

aaatgccaac tagggagctg aaa 23

<210>150

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>150

tcacagtcac tgcaacacac aa 22

<210>151

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>151

gatagcctag tttctctact gagaagaca 29

<210>152

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>152

gcatggagag aagggcattg aag 23

<210>153

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>153

ctgagagagc acgcagtgag aag 23

<210>154

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>154

gctttccatg catgctcttc tg 22

<210>155

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>155

acagagaggc ctctgaagag aaa 23

<210>156

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>156

cttgcccgat gtaccttgct tata 24

<210>157

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>157

cacaaaagcc atcttactta cttgagaag 29

<210>158

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>158

agtagccaca caagccttga at 22

<210>159

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>159

caatgctctc tctccagaca ctaac 25

<210>160

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>160

cctggaaacc tccattccca tatttt 26

<210>161

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>161

atggacagtt aagacacaca cagaaa 26

<210>162

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>162

gagggtctga cctttagttc ttgg 24

<210>163

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>163

aagctctatt tgtgatccac tgcat 25

<210>164

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>164

ccggcagaat agagctttct ttaaattttt 30

<210>165

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>165

gttaatgtgg ctcctactgg tgaa 24

<210>166

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>166

gtgcttgata ttaaaaggct tgcaca 26

<210>167

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>167

gggtgaaaga gacttgttat gaataacaaa 30

<210>168

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>168

gatttgagta gagacctgaa tgattcaga 29

<210>169

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>169

ccctagagac agaggtgcta gaac 24

<210>170

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>170

taacagccgt gagaagctca ttc 23

<210>171

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>171

gtttcatcta cataagacca cctttgct 28

<210>172

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>172

cctcatgaat ttacatccta gttggaga 28

<210>173

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>173

caaagggatg gtcagaggaa gaa 23

<210>174

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>174

gaagaccaga gttcattctg cct 23

<210>175

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>175

cccagcacac agtaagctca ata 23

<210>176

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>176

cggattagtg gacagacaga gaga 24

<210>177

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>177

ggaaagctgg gatgatgaca gt 22

<210>178

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>178

cagatgcatg agtgttcatg aggt 24

<210>179

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>179

catgaataaa ctatgatgcg tccaaact 28

<210>180

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>180

gacagtcttt taaaaatgga aacagcaca 29

<210>181

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>181

ggagtggtta gagtctgcat ga 22

<210>182

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>182

actactggaa ggagaagtgt tcagat 26

<210>183

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>183

gtaactaact tcatcgtttt gagccattag 30

<210>184

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>184

ctgagcagga gagacagatc acag 24

<210>185

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>185

cagcctgggt tacatcccaa tt 22

<210>186

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>186

tgaattaggc cttcctagta agatacaca 29

<210>187

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>187

tcctacttct gaatttcttg agggtatgt 29

<210>188

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>188

cattagctct caagccttcc tgt 23

<210>189

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>189

acacaccacc tacaaatctt gct 23

<210>190

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>190

ctctaacacc acgcttgtga ct 22

<210>191

<211>20

<212>DNA

<213> artificially synthesized sequence

<400>191

ctcctccact agccaaggga 20

<210>192

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>192

gtgagaattt caaaccagtg gatcttaac 29

<210>193

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>193

ggacaatgaa gggtgttaaa aatggc 26

<210>194

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>194

cagaaaagag ctgctccttc agt 23

<210>195

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>195

ccttacaaga gttcctgaag ggaag 25

<210>196

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>196

gtatttcgag cctatgtgtg tgtttg 26

<210>197

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>197

gtaggcctga acgtagaagt acc 23

<210>198

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>198

tgggttttaa aggtctcaca tgct 24

<210>199

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>199

ctccaaagtc taaactagga agaagtcg 28

<210>200

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>200

tctatctctg caaggttttg gtgtc 25

<210>201

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>201

cacatacacg caagtgtgca tt 22

<210>202

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>202

gcctggctag atagggtctt g 21

<210>203

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>203

aagctcatca tcactggtta ttacagac 28

<210>204

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>204

gcgtgtgtct ttatcgtaga atgatttac 29

<210>205

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>205

cctaaacatt ccaatattag gacagggat 29

<210>206

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>206

ccatgccact cttgagtgtt ctat 24

<210>207

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>207

gctcggctct aaagcaaaca g 21

<210>208

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>208

cgtgagatcc cagtacagtg tc 22

<210>209

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>209

ggcaggaaag ctgcaataaa gt 22

<210>210

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>210

ctgatatatc tgtgttgctg catttgc 27

<210>211

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>211

gtgggtccca aaggaagcaa c 21

<210>212

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>212

ccgaggcgta gactagtgtt c 21

<210>213

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>213

gccatctgag ggagcatcta ga 22

<210>214

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>214

cccgattcca aactatggtg ttc 23

<210>215

<211>20

<212>DNA

<213> artificially synthesized sequence

<400>215

gctatgctgt ctgcctccaa 20

<210>216

<211>19

<212>DNA

<213> artificially synthesized sequence

<400>216

gtggtctcgc tcttgtccc 19

<210>217

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>217

accaattcct tcagccaagc aa 22

<210>218

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>218

tgacaatgtt ttcagacttt atttgcatgg 30

<210>219

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>219

gagtttgaag aaaccacagc tgatg 25

<210>220

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>220

aaagggataa tcctaattaa tccaacacac tt 32

<210>221

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>221

cacctaaggt gtcaggagtt tgag 24

<210>222

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>222

ttcctcttca ttgtgtgtgt gtgt 24

<210>223

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>223

tccatgactg ctgcctcaaa a 21

<210>224

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>224

aaaaagatgc ctgccaccta c 21

<210>225

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>225

tggacaaact gggaagggag ta 22

<210>226

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>226

gctcagtcat tttaaaataa actgcaggta 30

<210>227

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>227

cggaggcata agtgatgcca tt 22

<210>228

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>228

gattggctgt ctcttgtacc tgtt 24

<210>229

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>229

gctggctcca agggtaatga tg 22

<210>230

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>230

agtcacatca ttccactgct cattac 26

<210>231

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>231

caatggtact tctctgctct cctttt 26

<210>232

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>232

tacacaacat ggtacggcac aa 22

<210>233

<211>33

<212>DNA

<213> artificially synthesized sequence

<400>233

cctagaagac tagttaaatg cagaaattca cat 33

<210>234

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>234

tgttttcaaa gtgctctcgg tttttg 26

<210>235

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>235

acaccttttc caataatcct cttgct 26

<210>236

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>236

gggtttctac ttcctttgtg tgttttg 27

<210>237

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>237

ggcacgtaga cagatgggaa ataa 24

<210>238

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>238

ccactgagag tattcagggt gtt 23

<210>239

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>239

gcctcccaag gcatcatttt t 21

<210>240

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>240

gaccacattc cttatttcat tggtgtc 27

<210>241

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>241

aaaaagcctc gttcaaataa atgaaagga 29

<210>242

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>242

ccagcctctt gttcactatg catta 25

<210>243

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>243

cactctctgg tttacaggaa caacaa 26

<210>244

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>244

cttcagaata cccagcaact gtgt 24

<210>245

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>245

ccatctgtag tttgcaccat ggaat 25

<210>246

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>246

gggtagctca gtggaaggat ttaata 26

<210>247

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>247

ggacatccag ttaaatttga ttctcagaca 30

<210>248

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>248

catctgcctg tttttgtgtg atgtt 25

<210>249

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>249

gcaaagactc acagctgagt ga 22

<210>250

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>250

agaggatgat aggtgagtgg agatg 25

<210>251

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>251

ctaattcttt cccatctcac aatcactctt 30

<210>252

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>252

actatgctca gccaccatca tg 22

<210>253

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>253

tcactatcct ccatcttgga caaca 25

<210>254

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>254

ggcccttttc ttaccaagag aactatt 27

<210>255

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>255

ccctcatgaa tggaatccac tca 23

<210>256

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>256

gcaaactttc cttgcatgtt aaatttgtta 30

<210>257

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>257

actgccatca ttccagaact tctt 24

<210>258

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>258

ttaaccaagt accttcctcc tttttcc 27

<210>259

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>259

gctgagcagt gctgacttat aatttaaac 29

<210>260

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>260

cagtttttcc tgtgtgtatt cataaagagt 30

<210>261

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>261

caggctgggt agcatagaag c 21

<210>262

<211>33

<212>DNA

<213> artificially synthesized sequence

<400>262

acttagtcac catttctgat ttctttcttt ctt 33

<210>263

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>263

gagtcggtga atgagtgttg agtag 25

<210>264

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>264

ctcccaaagc attgagatta caatgag 27

<210>265

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>265

ctcaagatgg attaaaactt aaacgtaaga cc 32

<210>266

<211>31

<212>DNA

<213> artificially synthesized sequence

<400>266

attgcttttg gtgttttagt cattaagttg t 31

<210>267

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>267

caagcttggc caaagaagtc aa 22

<210>268

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>268

ctatcaaagg ttccacagac aacct 25

<210>269

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>269

gtcagtaagt catggtcttt ctgct 25

<210>270

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>270

ggtgccaaac agttagcaaa gttttta 27

<210>271

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>271

ttcgacaggc acacaccatt at 22

<210>272

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>272

tgaacggcca tctcaaaata tttccaata 29

<210>273

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>273

cttcatccct aggatgcagc a 21

<210>274

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>274

cccattcact gtgatattgg ctc 23

<210>275

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>275

cctctctctc aatgattttc ttccagttc 29

<210>276

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>276

gaaaaagtaa atagcaaagc tgactgagt 29

<210>277

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>277

ccaccactaa tcccacagat gtc 23

<210>278

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>278

catcctgaga gatgaaagta gtatctgttt 30

<210>279

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>279

tgaggcacag agtgttctga ga 22

<210>280

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>280

ggaaaatcct tcaatggctg cat 23

<210>281

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>281

gccatccaga ccaccttcat ag 22

<210>282

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>282

ccttctttcc ctcagaatcc tcca 24

<210>283

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>283

agaggttaaa tgtgcttaac accct 25

<210>284

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>284

gactacatca tcctgtgtag aaaccag 27

<210>285

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>285

tcctgtgcat aaaatgcaga cct 23

<210>286

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>286

caggtgtttg gtaggctaca tca 23

<210>287

<211>33

<212>DNA

<213> artificially synthesized sequence

<400>287

ttactttcga ctcttttgta ataacactta gct 33

<210>288

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>288

aaaaagaaaa agttaactgt aaagtagcct ca 32

<210>289

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>289

gtgctctatt tttatatgac tggcagtaca 30

<210>290

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>290

ctcctgtgtt ttcttctagt gtttttgtt 29

<210>291

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>291

cagaacaaaa ccaagaaaat ccaaaagcta 30

<210>292

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>292

ccagagaggt tacactccca cta 23

<210>293

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>293

ctcagcaact ctacttctaa gaatttaccc 30

<210>294

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>294

tgtgagctgt tgctagtaat gtactaaag 29

<210>295

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>295

ggtactgaga gggagtgtca ca 22

<210>296

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>296

cctaatcttc ctcaaattct gtactagct 29

<210>297

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>297

gtaccttatt aggcaaaaac ctcttcct 28

<210>298

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>298

gcaaggcttt gtcttctgta actg 24

<210>299

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>299

ggccaaggtt ccacatggat at 22

<210>300

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>300

gcttcatctt ggtgaatcag tagttatttt 30

<210>301

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>301

catcaacctt aaataggata ccagtcagt 29

<210>302

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>302

agtcagtttc aacagtgaaa tggtgataat 30

<210>303

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>303

ccctggcttc acccactagt at 22

<210>304

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>304

agtcaggcat catttttgac ctgt 24

<210>305

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>305

aaatgaatga caaagaatgc caagca 26

<210>306

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>306

tttcacaggt tctctgttgc tca 23

<210>307

<211>31

<212>DNA

<213> artificially synthesized sequence

<400>307

gaaaattaac aacgatattc agggcttgaa a 31

<210>308

<211>33

<212>DNA

<213> artificially synthesized sequence

<400>308

gcttcaaaga acttatttct gccttaattt cat 33

<210>309

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>309

ggctggtaca agaagggtca ta 22

<210>310

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>310

gggaccatgt aaatgacatg ggattt 26

<210>311

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>311

aaaaagtcta ggatcaggtg gataca 26

<210>312

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>312

gatggatttc gtttattgat atgcatgtgt 30

<210>313

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>313

gggaacaaaa ctcactttcc gact 24

<210>314

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>314

caactttgaa tcatccgtgt gaagag 26

<210>315

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>315

gtatcgtctc caaggagcac tt 22

<210>316

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>316

cccatcatgc atttatagag tagtgctaat 30

<210>317

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>317

gaacacaacg tttatggtcc taaaagttt 29

<210>318

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>318

agaacaaatc taccaggtga tctattcatt 30

<210>319

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>319

aaaacagttc ttaaccactg tttgtagaaa 30

<210>320

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>320

gactgtctta atacagttct gcaacttttt 30

<210>321

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>321

ccctggcaag taatggacaa tg 22

<210>322

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>322

gggttcagta gagaattcat gtgact 26

<210>323

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>323

tcaatcctcc ctgctgcagt ata 23

<210>324

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>324

agaaacaact gcttaagcct ccttac 26

<210>325

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>325

tctattgaga agccaacact ccatg 25

<210>326

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>326

tgctttcttc ctgcatagtc tgttc 25

<210>327

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>327

cattcctctc cagctcacca tt 22

<210>328

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>328

tgaaatcatg actttggaaa acctgtttc 29

<210>329

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>329

gcctctcacc ttctacagtc ca 22

<210>330

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>330

aagtggtctc tgctcctgaa tg 22

<210>331

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>331

ccaatggaaa agcaaggact tgtc 24

<210>332

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>332

ccctgcctgg cctatataat cattttt 27

<210>333

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>333

aggtcaggct tcttatagct gga 23

<210>334

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>334

cttggaaact cttgaggttt tgatactg 28

<210>335

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>335

cactgcactc tatagcctgg at 22

<210>336

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>336

gtgcctggca gctctatttt t 21

<210>337

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>337

caagtaggaa tgaccacacc caaa 24

<210>338

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>338

tgactgcagt tgcttggaac ta 22

<210>339

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>339

gggagaccac atctctacaa ataaagag 28

<210>340

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>340

gctttttcag aagaatttcc aactctga 28

<210>341

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>341

ggctgcacag gaaagacttc tt 22

<210>342

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>342

ctcaacatct ttggaacctc cttatagtg 29

<210>343

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>343

acagattggt gctggcctta aaa 23

<210>344

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>344

gtgacagagc gtttaatctt ttaatcagc 29

<210>345

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>345

gtgaatgggc agcagtgaat tg22

<210>346

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>346

tgtgagtgcg agttctttct tcc 23

<210>347

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>347

taggtcaatg aagaagaccc tgtaca 26

<210>348

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>348

gcaggagtca agctgattaa ttacac 26

<210>349

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>349

caaagtgagg cttcctagaa agct 24

<210>350

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>350

tcattcctct tctaaagatg tcatgaagc 29

<210>351

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>351

ggctttttag cccatctgca att 23

<210>352

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>352

gaggacactt ctaaagcatt tctctcta 28

<210>353

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>353

actcagacac aagggagact ga 22

<210>354

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>354

cttagtccca tctgggagta caga 24

<210>355

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>355

ccatgagcac aacatgtaat cacttg 26

<210>356

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>356

cagtttgtgc agtcagttct tactg 25

<210>357

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>357

gcctggtcaa agagccattt ct 22

<210>358

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>358

gaaaccttca ttcactctgg tcctt 25

<210>359

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>359

tgctgcaagt gagtgtggaa tt 22

<210>360

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>360

cgtgtgcttt agaagtgata gcaac 25

<210>361

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>361

agtcctcttg gaaaggtgaa tgc 23

<210>362

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>362

ccttttgcca acactaggca ttg 23

<210>363

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>363

cctctatggg agcccatgta aat 23

<210>364

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>364

ataggcacag cacagaagaa gcatt 25

<210>365

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>365

agtcctccaa ctgtcttctc cat 23

<210>366

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>366

ccagtgactg tgtagatctg agaag 25

<210>367

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>367

gaactcacag aatcatattt gtgatctgga 30

<210>368

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>368

ggacttaata ctgtagccta ggaaggt 27

<210>369

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>369

aatagatgaa caagtgctag ccagaaa 27

<210>370

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>370

taagtgactc ctgggcagtt ct 22

<210>371

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>371

agctcagtcc acacttgtta ctg 23

<210>372

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>372

caaggaaatc cttgaagacc tagaagaaat 30

<210>373

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>373

acagaatgaa acacgtggag agaa 24

<210>374

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>374

cattgcaagt gtggtatctt ggtg 24

<210>375

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>375

ttggaggagg gacatctggt ta 22

<210>376

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>376

cttctgttgt gcatacactt aaatacgg 28

<210>377

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>377

acatgcattt acggatgtac acaaaag 27

<210>378

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>378

catcccttac tctgttctca ttcaca 26

<210>379

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>379

gaaacaacta gctcagcagg actt 24

<210>380

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>380

gtcacattct tgttgagctg ctaga 25

<210>381

<211>20

<212>DNA

<213> artificially synthesized sequence

<400>381

gcagatagaa gggcaggtgc 20

<210>382

<211>33

<212>DNA

<213> artificially synthesized sequence

<400>382

aactacagga tgcatttaaa taatgagatc cat 33

<210>383

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>383

acctcctgat tttcctccta tccttc 26

<210>384

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>384

cactttgctc ttctgccatt tgag 24

<210>385

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>385

ccaagatgga gccagtggaa ag 22

<210>386

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>386

cacagcctct tttgaataga tgcag 25

<210>387

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>387

caacatatga atttggcagg gacattaa 28

<210>388

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>388

ctgcacctgg atgagattat tcttatcaaa 30

<210>389

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>389

cattaatagt acatgctaca tgggtggaa 29

<210>390

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>390

ccaccttcca gcctttaaaa cc 22

<210>391

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>391

acttgagccc agatgtttca gaa 23

<210>392

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>392

ttggtggaac taacaggatt tgct 24

<210>393

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>393

actttttctg cctgctttgt aaatacc 27

<210>394

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>394

ggtattgctg gcttttgtct ctg 23

<210>395

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>395

gggttcccat gtgcttaata aaacc 25

<210>396

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>396

gggagtgtat gaaatttaga tgggatcat 29

<210>397

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>397

gtatcccaag gtctctgttc caag 24

<210>398

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>398

gtgtttgata tgagttgcct ttttcct 27

<210>399

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>399

tcacaagtgc aggaatcctt cac 23

<210>400

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>400

tgttttagac cttggaataa agcagtg 27

<210>401

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>401

agtgttaaca aagctctttg agactatcaa 30

<210>402

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>402

ctcaccctca gtcatccttt atttgtt 27

<210>403

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>403

cctcctccct cacttactca ttcatttat 29

<210>404

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>404

aaggtcctca gcattgaagc aa 22

<210>405

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>405

ccctgatcag gaagagttgt caatt 25

<210>406

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>406

tcagtgcttt gacagtgctt agt 23

<210>407

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>407

agagtagtac ttactttcct tcaaggactt 30

<210>408

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>408

cccgtgtaag atggcaaagt taatctataa 30

<210>409

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>409

ggttttccag accacacaga gaag 24

<210>410

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>410

tggttgtttt tggcagataa agactg 26

<210>411

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>411

agcatctgca aaagggcaat aaag 24

<210>412

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>412

ggccagtcct gctgtctttt ag 22

<210>413

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>413

tgcacagctt cctaacgtga tc 22

<210>414

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>414

gtcctttcct ttcttgaact cagagt 26

<210>415

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>415

gctgaggcag aagagtttcc ttag 24

<210>416

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>416

taggatgcaa ctccatcttc ctgata 26

<210>417

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>417

ggctctcagg cttttctctc aa 22

<210>418

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>418

cctgaaatgt ccttatgtga ttagagttct 30

<210>419

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>419

tcatgacagc ttataactag gcctttc 27

<210>420

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>420

gagttcaaga gctgtggagt gt 22

<210>421

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>421

tctccacatc ccagctatcc aa 22

<210>422

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>422

actgtggtaa atatccttgc atcttttctt 30

<210>423

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>423

gtgacaggag gagcagtccc aaa 23

<210>424

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>424

gggaactaga gaaaagccca ttct 24

<210>425

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>425

ccgcctgtat ctgaatacag ca 22

<210>426

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>426

ttttagaatc ctgcctttca gagtgaaa 28

<210>427

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>427

ccaactctgc attttcaggg atct 24

<210>428

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>428

cagatcgctc atgctgtttg tg 22

<210>429

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>429

cagtatctta aaggaacatg cagtacct 28

<210>430

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>430

tctcaggaca catgtcattt actagga 27

<210>431

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>431

ctctcagcac tgaacacgga ta 22

<210>432

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>432

actgtaagtt gggtcttcta cccttatt 28

<210>433

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>433

agcactagac tgggctagga at 22

<210>434

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>434

aaaaagtggt tgaagaacac tatcttagga 30

<210>435

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>435

ccagtcctct ggacctttat acatg 25

<210>436

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>436

tcttgaatga atggattctc gacatgattt 30

<210>437

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>437

gcaccaattg gtgtctgtga aa 22

<210>438

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>438

cggtttagtg gatattttgt cccatttatc 30

<210>439

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>439

gcctggctag gactcaatcc ta 22

<210>440

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>440

ggttggtgtc ggaattgaat tgaattg 27

<210>441

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>441

cattaccttt gacatctgag cctctt 26

<210>442

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>442

aaagtttcca gtggatggga aagt 24

<210>443

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>443

cagctaagaa accaccacat gga 23

<210>444

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>444

tcagggtcat ctctatctct tgatctc 27

<210>445

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>445

ggtgatacag ctgtgaatgg ca 22

<210>446

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>446

aacttgcacg tcacttactt cct 23

<210>447

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>447

ccggcatcac tgattagatc attg 24

<210>448

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>448

cgttgtaatt tcctgagaga tggtga 26

<210>449

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>449

actacagaga gagggagaag aaatacac 28

<210>450

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>450

tacctctgac ctcttctttc cactt 25

<210>451

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>451

cactttatgg tttctcaacc taggcta 27

<210>452

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>452

gcagcatatc aagacatcgt ttatacaaaa 30

<210>453

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>453

ggcaaatata cgtaaaattc atcacactct 30

<210>454

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>454

ccttctttaa aaacgtgact ttcgct 26

<210>455

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>455

gctattgaag gaaactaaaa catttcacct 30

<210>456

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>456

aaatcaggtt ataggaggga gagaagag 28

<210>457

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>457

tgtataggta atactggctc atgagctaat 30

<210>458

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>458

gcacagttcc tagcactcag taaat 25

<210>459

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>459

ctcctacgct atacatttgt ttatccctt 29

<210>460

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>460

gtcttctgga atcctctgat aatagcg 27

<210>461

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>461

ctttgtaaaa attgttcagg aacagtctct 30

<210>462

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>462

ccttttcagt actccattta ttttggttgc 30

<210>463

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>463

tagtcatcat accctacaaa ccacct 26

<210>464

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>464

gattgtttca ctaactgtct aattcagtgc 30

<210>465

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>465

ggagctccct gcattcaatt taga 24

<210>466

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>466

ggagaggaat agtagcttct gaagaataca 30

<210>467

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>467

agactgaaaa atagatctgc tttttgtgc 29

<210>468

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>468

ataaagtgag cgtcgagttg ct 22

<210>469

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>469

cacgttagga aggtggtttt gatc 24

<210>470

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>470

ccctcattca cacatctgca gt 22

<210>471

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>471

acatgtttga aaacaaatga ctatgaagac 30

<210>472

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>472

cagaaagttt acagtctgtc ctcagaag 28

<210>473

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>473

gcaggtagtc tctgggatct aga 23

<210>474

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>474

cgcataactg ccctctttga ct 22

<210>475

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>475

gcgggagtaa taataatggc cat 23

<210>476

<211>20

<212>DNA

<213> artificially synthesized sequence

<400>476

gtagtgcctg gaccagagtg 20

<210>477

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>477

ttttcacttc tcagaaactt tcatgcaatt 30

<210>478

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>478

gtctagttcc actctgtagc tgttc 25

<210>479

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>479

cgcaaagaaa ttcaaacgct agca 24

<210>480

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>480

ggattcgact tcttcctagt ttagacttt 29

<210>481

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>481

caggatccag aacaaaacca gtg 23

<210>482

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>482

agtggttttt ggtgtctctg attctt 26

<210>483

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>483

aacccagagc caatatcaca gtg 23

<210>484

<211>31

<212>DNA

<213> artificially synthesized sequence

<400>484

atgatttggc tttctgttat tggtgtatag a 31

<210>485

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>485

gtaggctgag ggacagggaa ct 22

<210>486

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>486

ccaaggtcac acaggtattc agtaa 25

<210>487

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>487

agtaccattc aggacacaga aatgg 25

<210>488

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>488

ggttttgatt tgcatgtctg taataacca 29

<210>489

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>489

ctttagcaag ttgaagtcct tatctctct 29

<210>490

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>490

agctacgaaa gcaaggcatt ga 22

<210>491

<211>19

<212>DNA

<213> artificially synthesized sequence

<400>491

ccggtgccac agtgttctc 19

<210>492

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>492

attttccagg tgcggagttc a 21

<210>493

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>493

ctatcgaaag cagacctgtc caaa 24

<210>494

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>494

tagttggtct agacatccat acatcctc 28

<210>495

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>495

agattgtatc atcacttgtg atggcag 27

<210>496

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>496

catctgtaaa gttgcagaca gtctgt 26

<210>497

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>497

aattctaaac atggtgttca gaggaagt 28

<210>498

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>498

cttcactgtc cttgtctttc agct 24

<210>499

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>499

gggatgtaaa gcccaggata gaatc 25

<210>500

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>500

tcaagactgt gtgttggcca g 21

<210>501

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>501

agaggactac tgtccacagg aat 23

<210>502

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>502

agttgggcat taatctctcc aaatctt 27

<210>503

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>503

taaaaagcta ttcacgcctg ggt 23

<210>504

<211>20

<212>DNA

<213> artificially synthesized sequence

<400>504

accatctttg acctcccagc 20

<210>505

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>505

agcttggagg actgttgaag g 21

<210>506

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>506

gtgtgccctc tatgtgtata ttttggaa 28

<210>507

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>507

agaaagaaag aaatcagaaa tggtgactaa gt 32

<210>508

<211>21

<212>DNA

<213> artificially synthesized sequence

<400>508

gatcatgctg ctgatggtcc a 21

<210>509

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>509

cttcctgaaa gacaaggacc atatctc 27

<210>510

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>510

gcgcaaacat agtgctttag cttg 24

<210>511

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>511

atctttatca caaacatttt acatgcagtt at 32

<210>512

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>512

ctgcctgctc agacttctat gt 22

<210>513

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>513

gagtccatga gaacagtgat cactg 25

<210>514

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>514

ggacataaga tctgagcctc aaagaa 26

<210>515

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>515

tctatactcc tgcagctcac cat 23

<210>516

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>516

ccctcgagat agctcagttc atc 23

<210>517

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>517

ccattatgcc tgccttcaaa ttct 24

<210>518

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>518

ccttgtaatg tgaaccctct gaaaca 26

<210>519

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>519

ccttcttctg gatacctcct agga 24

<210>520

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>520

tcatgtattt ttggtgagct ggtgta 26

<210>521

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>521

ctagaccagc ctggaaaaca tgat 24

<210>522

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>522

cttgagatgg tgtttcgcca tg 22

<210>523

<211>19

<212>DNA

<213> artificially synthesized sequence

<400>523

gagtctggct ggcatctgg 19

<210>524

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>524

cgagggagtt gtgatccttt gaag 24

<210>525

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>525

agacagcatc tctctttaaa cacaca 26

<210>526

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>526

gaaaatccgt gagaattttc atgcgt 26

<210>527

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>527

ccattcactg atatcctccc tcagattatt 30

<210>528

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>528

tgtgtccaca acatagagtc caaac 25

<210>529

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>529

cggcttcagg gactaaagag tag 23

<210>530

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>530

gcatcagcca cttttctcct gttaata 27

<210>531

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>531

ctaagctagc acctgatgcg aa 22

<210>532

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>532

gcaaagtaaa tgctacctgt tattgttgtt 30

<210>533

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>533

gccaaaactc aaacccggtt tttaaa 26

<210>534

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>534

ctgtatcaat agttgcattg tcatcacat 29

<210>535

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>535

ccctcaaaca tccagttacc act 23

<210>536

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>536

agtgattgtt gccagtgttt tgg 23

<210>537

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>537

gaccaaccaa atcagagtat ccca 24

<210>538

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>538

acttccctgt acattaggat cacct 25

<210>539

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>539

gcccatggac acattctcac tc 22

<210>540

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>540

catttttatc ctatgtggca tcctttctg 29

<210>541

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>541

atctgctaac agtcactcta gagct 25

<210>542

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>542

cctgcatttt gtatagaagt tccaatttca 30

<210>543

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>543

aatgaacttg ctacctggtt atcagg 26

<210>544

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>544

tgttctacta accctcttgg aaacca 26

<210>545

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>545

ggatttccag ctctctaata cctttgtaa 29

<210>546

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>546

atgtccagct caatattcat gacatatgt 29

<210>547

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>547

ccactaataa cctgattgca cggtt 25

<210>548

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>548

tgtggtcact gagataaagt ttgtgt 26

<210>549

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>549

cccttccctc cttatcttca gca 23

<210>550

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>550

atgcagagtg tgggaagatg ac 22

<210>551

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>551

cttcgtgctt cctctgatta aaacc 25

<210>552

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>552

ggagccacca ggcttttata ttttt 25

<210>553

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>553

aggttctgtt gtttagcagt aaaatctttt 30

<210>554

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>554

tcgatgccac acctgtgata ac 22

<210>555

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>555

tgaaaagcaa aatctagaca cttggagatt 30

<210>556

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>556

cattgaaggc atgatctccc aact 24

<210>557

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>557

catgaaagcc aatttccttg tcattaaaaa 30

<210>558

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>558

cattaggtat ctgggattcc ttcactc 27

<210>559

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>559

gttaccacgt tcatctgacc act 23

<210>560

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>560

ccctttttga tttctgatac ctcacttg 28

<210>561

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>561

gccagccaag tcatcctgat tt 22

<210>562

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>562

cttaggtaag tggtggttag gttcttttt 29

<210>563

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>563

cccaatttga tggcaaacct gt 22

<210>564

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>564

ccagcaatga agaagagttt tgctttt 27

<210>565

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>565

ggcagccact gaataattct acatttcata 30

<210>566

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>566

ggatattgaa gacagaaact ccttttgagt 30

<210>567

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>567

cacaaaggga agctcatcag acttaa 26

<210>568

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>568

cttcccttca ggaactcttg taagg 25

<210>569

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>569

cacaagcagg gttctccctt ac 22

<210>570

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>570

caagtgcatt cagaagttat ctgttgaat 29

<210>571

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>571

aagcaccacc agtcaatact cag 23

<210>572

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>572

gtagccaggc ttcaggacaa aa 22

<210>573

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>573

accagaaaat ttcaacatgg gagact 26

<210>574

<211>23

<212>DNA

<213> artificially synthesized sequence

<400>574

cccttcttcc ttaacctttg cct 23

<210>575

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>575

cctccttagt gaaatgtcgt tctca 25

<210>576

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>576

cctgggaagt ctgcatttgg ag 22

<210>577

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>577

acctgttttc ttaacacaac acagtaca 28

<210>578

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>578

acatttgtgt tgttaagctg ctcaaaa 27

<210>579

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>579

ttgtgtgacc atcatagagt cacttac 27

<210>580

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>580

tcgacagtag tgcagtgtcc ta 22

<210>581

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>581

ttatttcttc aacaataaat caacatagcc ag 32

<210>582

<211>32

<212>DNA

<213> artificially synthesized sequence

<400>582

aaagaaaata tttgataaag ctgtccagtg tg 32

<210>583

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>583

catttcaggc agatcaaaga ttaacatgt 29

<210>584

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>584

tgtttggatt gttggccttt ttcttttt 28

<210>585

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>585

cacactggca cagtcttcct ac 22

<210>586

<211>25

<212>DNA

<213> artificially synthesized sequence

<400>586

catgctttgt tttgcacatg aacaa 25

<210>587

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>587

gcatgtgttt gttatctgtt gctaca 26

<210>588

<211>26

<212>DNA

<213> artificially synthesized sequence

<400>588

tgcactttga aatgtgttct agagga 26

<210>589

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>589

gcttgtatag gcatggatta tctctgg 27

<210>590

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>590

caaactagat ggttgagggt tatgtct 27

<210>591

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>591

ccctttctag acaggcaggt tt 22

<210>592

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>592

gggaattaga taaactaggg ctttcacaa 29

<210>593

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>593

gagagtgcca gggcttttaa aataaaa 27

<210>594

<211>30

<212>DNA

<213> artificially synthesized sequence

<400>594

tccttcaaag tgaaagaatt cttgaggata 30

<210>595

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>595

tccctcatgc ttagggcaat tc 22

<210>596

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>596

gagtgtggat attttgctgt agttttcc 28

<210>597

<211>28

<212>DNA

<213> artificially synthesized sequence

<400>597

taagaattct ctggatgcca caaattca 28

<210>598

<211>22

<212>DNA

<213> artificially synthesized sequence

<400>598

ggacaggctt gccttagaca aa 22

<210>599

<211>27

<212>DNA

<213> artificially synthesized sequence

<400>599

cgaagacaca ttcttcttct aatgtgg 27

<210>600

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>600

ttgctcagat aatgctggaa ttcatactt 29

<210>601

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>601

gttaagatcc actggtttga aattctcac 29

<210>602

<211>20

<212>DNA

<213> artificially synthesized sequence

<400>602

ttgagactgc tgaagctgca 20

<210>603

<211>24

<212>DNA

<213> artificially synthesized sequence

<400>603

aaaaactcca ccgagctaaa gtag 24

<210>604

<211>29

<212>DNA

<213> artificially synthesized sequence

<400>604

ccagtcaaac ttatgtttgg tcttttcac 29

<210>605

<211>31

<212>DNA

<213> artificially synthesized sequence

<400>605

gaattggata aagagtcaag actcattgat g 31

<210>606

<211>31

<212>DNA

<213> artificially synthesized sequence

<400>606

ttactgtgtg gaagtctaag tctttttgta g 31

Claims

1. The primer group for detecting the gene mutation of the hepatolenticular degeneration disease ATP7B is characterized by comprising a primer group I and a primer group II, wherein the primer group I comprises upstream and downstream primer sequences shown as SEQ ID NO. 1-304, and the primer group II comprises upstream and downstream primer sequences shown as SEQ ID NO. 305-606.

2. A kit for detecting ATP7B gene mutation of hepatolenticular degeneration disease, which comprises the primer group of claim 1, wherein the upstream and downstream primers in the primer group I are mixed and diluted in equal amount, and the concentration of the upstream and downstream primers in the primer group I is 400 nM; and (3) mixing and diluting the upstream and downstream primers in the primer group II in an equivalent manner, wherein the concentrations of the upstream and downstream primers in the primer group II are both 400 nM.

3. The kit of claim 2, further comprising at least one of a PCR reaction solution, DNA ligase, primer digest solution, ligation buffer, P1 linker, Barcode X specific linker, library amplification reaction solution, library amplification primer solution, AMPureXP magnetic beads, and nuclease-free water.