KR20100013801A - Differential diagnostic method, kit, chip for the dystrophin gene deletion, duplication, point mutation and dmd/bmd screening test therethrough - Google Patents

Abstract

PURPOSE: A kit, a chip and a method for determining gene deletion, duplication, point mutation of dystrophin are provided to shorten test time and reduce analysis cost. CONSTITUTION: A method for determining deletion, duplication, point mutation of human dystrophin comprises: a step of producing a chip on which a probe is spotted; a step of isolating genomic DNA from a sample; a step of amplifying DNA to obtain a target DNA amplified product; a step of analyzing point mutation using an automated sequencing; a step of performing hybridization reaction between multiplex-PCR reaction product and probe which is fixed on the chip surface; and a step of scanning the chip with laser to measure fluorescence intensity according to the hybridized reaction result and analyzing exon deletion, duplication mutation.

Description

Differentiological diagnostic method, kit, chip for the dystrophin gene deletion, duplication, point mutation and DMD / BMD screening test therethrough}

The present invention relates to a differential diagnosis composition of dystrophin genetic mutations capable of gene deletion, duplication, and point mutation batch analysis, and more specifically, to determine the fluorescence signal intensity of a sample compared to the control group for each of the 78 exstropins by log value relative ratio. Discriminant diagnostic methods, kits, and chips characterized by accurate quantitative analysis of gene deletions, duplicate mutations by implementing quantitative gene dosage analysis.

Muscular dystrophy or muscular dystrophy is a progressive placebo, and muscle necrosis and regeneration process makes the muscle fibers uneven and diverse.The muscle necrosis areas are replaced by fat and fibrous tissue, resulting in muscles such as arms and legs. It is an X chromosome-associated muscle disease that hardens and eventually becomes completely immobile. In the late stages, death can occur due to complications such as respiratory failure and heart failure. Understanding the pathophysiology of muscular dystrophy after the 1987 dystrophin gene deletion and its resulting protein deficiency demonstrated Duchenne's muscular dystrophy (BMD) and Becker's muscular dystrophy (BMD). This resulted in a breakthrough (Hoffman EP et al. Cell (1987) 51: 919-928).

The dystrophin gene is one of the largest human genes with a genomic DNA size of 2.4 Mbp (mega base pairs) located at Xp21.2 locus and a cDNA size of 14,000 bp. Dystrophin protein consists of four domains: N-terminus, rod domain, cysteine-rich region, C-terminus, and is present in the cytoplasmic membranes of skeletal muscle, smooth muscle, and myocardium. In the brain, postsynaptic membrane of neurons Hoffman EP et al. Cell (1987) 51: 919-928, Ervasti JM et al. Cell (1992) 66: 1121-1131).

Dystrophin is a myocyte membrane protein that serves primarily as a support for the cytoskeleton, which is responsible for the stress of muscle contraction. In patients with myopathy, the inflow of material into myocytes causes the expanded cells to withstand pressure and burst (Arahata K et al. Nature (1988) 333: 861-863). Dystrophin binds to glycoproteins to form a dystrophin-glycoprotein complex, a deficiency of the proteins that make up it, which has been reported as a cause of several myopathy (Campbell KP et al. Nature (1989) 338: 259-262, Ervasti JM et al. Cell (1991) 66: 1121-1131).

Subtypes of muscular dystrophy have been reported continuously through immunohistochemical staining. Although histological findings are similar, the genetic causes are very diverse, and muscle dysplasia can be classified into various forms according to the clinical characteristics such as genetic patterns, invasion sites, and progression speed. In Korea, there have been many reports of muscle dysplasia, including Duchenne / Becker type muscular dystrophy, osopharyngeal muscle dystrophy, facial scapular brachial dystrophy, limb-girdle type muscular dystrophy, and distal muscle dysplasia (Kim SY et al. J Korean) Neurol Assoc (1993) 11: 68-77).

In addition to the Duchenne / Becker type, various subtypes of muscular dysplasia show various genetic features of autosomal, sex chromosomal recessive or dominant, and are difficult to diagnose based on clinical findings such as neurological examination and electromyography. In recent years, molecular genetic diagnosis of Duchenne / Becker type muscular dystrophy is the first to be performed.In case of negative results, the amount of causative protein in muscle is measured in situ or muscle tissue immunohistochemical staining is performed through muscle biopsy. .

Duchenne / Becker-type muscular dystrophy is an X chromosome-related disorder that accounts for about 90% of hereditary neuromuscular disorders. Duchenne-type muscular dystrophy has a relatively high incidence of 1 in about 3,300-3,500 boys. DMD and BMD caused by deletion, duplication, and point mutation of the dystrophin gene are caused by mutations in the same gene, but the Duchenne type causes slow initial motor development. Indeed, they are unable to walk independently for up to 18 months, and often fall around 4-5 years of age, have difficulty walking on the crow's feet or climbing stairs. The majority show pseudohypertrophy of the gastrocnemius muscle (calf muscle) and proximal initiation in the proximal lower extremities and rapid progression, making it impossible to walk independently around 10 years of age. In the case of the Becker type, the clinical manifestations and age of onset vary between 6 and 19 years, and the progression of the disease is slower and more diverse than the Duschen type (Moser H Hum Genet (1984) 66: 17-40, Emery AEH Nature (1977) 266: 472-473, Leibowitz D et al. Dev Med Neurol (1981) 23: 577-590). In most cases, DMD changes the reading frame of DNA transcription as a result of mutation and no protein is produced. In BMD, small or abnormal protein is produced by small mutation that does not change reading frame. In many cases, they do not match in all cases (Winnard AV et al. Hum Mol Genet (1993) 2: 737-744). Deletion and insertion mutations shift the reading frame, an amino acid-encoded unit, during transcription, leading to premature transcription, resulting in truncated inactive protein or abnormal protein synthesis. Duplicate shows a variation in gene dosage due to copy number variation in which the gene exists in multi-copy, unlike the general case in which a total of two copies exist in two chromosomes.

In most cases of DMD / BMD, dilated cardiomyopathy and congestive heart failure occur before and after puberty, causing death in 20% of DMD and 50% of BMD, respectively (Finsterer J et. al. Cardiology (2003) 99: 1-19). Serum creatinine kinase (CK) levels in DMD / BMD peaked around 3 years of age, and are known to decrease gradually. DMD / BMD reports about 100 times higher than normal upper limit and 50 times higher than normal upper limit for BMD. (Zatz M et al. Muscular dystrophy Methods and protocols 1st ed. (2001) 31-49).

About 65-85% of dystrophin gene mutations involve one or more exon deletions that make up the Dystrophin gene, and about 30% in point mutations and around 6% of exons duplication. Deletion occurs mainly at the center of the dystrophin gene (~ 80%) and occurs approximately 20% of the time at the 5 'end. Intron 44, exon 45 and intron 45 regions over 200 kb are major deletion breakpoints and differ in the distribution of deletions by race. Forest S et al. Nature (1987) 329: 638-640, Darras BT et al. Am J Hum Genet (1988) 43: 620-629). Very large gene sizes, especially large introns with an average size of 35 kb, are considered one of the causes of high deletion frequency. Dystrophin gene mutation screening tests for clinical diagnostics include Southern blotting, multiplex polymerase chain reaction (PCR), quantitative fluorescent (PCR), and MLPA to identify a wide range of deletions and duplications. (multiplex ligation-dependent probe amplification), denaturing high performance liquid chromatography (DHPLC) to detect point mutations, direct sequencing for approximately 14,000 bp total exon, and protein truncation test (PTT) to detect nonsense mutations Methods have been applied. However, none of these methodologies could simultaneously analyze all aspects of mutation, including deletion, duplication, insertion, and point mutation of the dystrophin gene.

Among conventional muscle dystrophic assays, PCR methodology, including multiplex ligation-dependent probe amplification (MLPA), developed in 2002, interprets the results according to the base pairs of amplified reaction products. The maximum number of target sites that can be included is limited compared to chip analysis, which is a high-throughput analysis method. In addition, as the number of target sites included in the reaction increases, that is, as the complexity increases, the amplification efficiency of small-size reaction products increases, which may lead to errors in the interpretation of the result of gene deletion and duplication. Since the gene copy number is not a quantitative value, quantitative interpretation based on the reaction product intensity only at the end of the reaction is difficult. An object of the present invention is to provide a high-throughput quantitative analysis system capable of solving the above-mentioned drawbacks of the existing analytical methods, which rely on the presence of amplification products and visual reading through agarose gel electrophoresis image intensity. In the conventional test method, immunohistochemical staining method uses the C-terminus, N-terminus, rod domain, and all three antibodies of dystrophin protein, and Western blotting should be performed at the same time to subtype muscular dysplasia. Although it can be specifically identified, there are various problems for diagnosis purposes other than the research purpose due to the high test cost and delayed analysis time.

In addition, by comparing the amplification product fluorescence signal of the clinical sample with the amplification product fluorescence signal for each exon of the dystrophin gene in the normal control group, the log value fluorescence ratio to quantify the evaluation of dystrophin gene dosage and to provide a redundant variation analysis method with improved accuracy. do. In particular, it is to provide an effective diagnostic method for discriminating female carriers in which the gene dosage is reduced by about half compared to normal because there is a deletion in one of two X chromosomes.

In order to achieve the object of the present invention, there is provided a high-throughput quantitative composition that differentiates dystrophin gene deletions, duplications, point mutations.

In detail, the fluorescence signal intensity analysis of each 78 exons of the dystrophin gene was repeated by implementing a quantitative gene dosage analysis that distinguishes the fluorescence signal intensity of the clinical sample from the normal control by the log value relative ratio. duplication) Accurate quantitative analysis of mutations, and direct sequencing using parts of the same reaction products, provide differential diagnosis, kits, and chips for murine dystrophy mutants.

In more detail, in the assay method, a chip in which a probe modified with an amino modifier or a thiol modifier at the 5'- or 3'-end is spotted is manufactured. ;

Isolating genomic DNA from the sample;

The target DNA amplification product was prepared to include fluorescent dyes by amplifying a probe target site for determining deletion and overlapping mutations in all 78 exons of the dystrophin gene through a multiplex-PCR reaction. step;

Analyzing a portion of the multiplex-PCR reaction product for the presence of point mutations using an automatic sequencing method;

Performing and washing a hybridization reaction between the multiplex-PCR reaction product and a probe immobilized on a chip surface;

Differentially analyzing the deletion and overlapping mutations of the exons encoding dystrophin mRNA by scanning the chip with a laser of a wavelength specific to the fluorescent dye and measuring the fluorescence intensity according to the hybridization reaction result; And

Dystrophin gene deletion, duplication, point mutation differential diagnosis method, kit and chip including all the above analysis step is provided.

And, in order to achieve the object of the present invention preferably, dystrophin gene deletion, duplication, dot containing one or more probes (probe) selected from the group consisting of oligonucleotides having a nucleotide sequence of SEQ ID NO: 1 to 156 Provides a chip for diagnosis of mutations.

In addition, to implement preferably the assay method of the present invention, there is provided a kit capable of amplifying one or more probe target sites selected from the group consisting of probes having the nucleotide sequences of SEQ ID NOs: 1 to 156.

Genetic deletions and duplications that cause disease can be determined by automated high-throughput quantitative analysis through the chip for myopathic genetic variation of the present invention. Specifically, accurate quantitative analysis of gene duplications can be achieved by implementing quantitative gene dosage analysis that determines the fluorescence signal intensity of the sample relative to the control group as a log value relative ratio. At the same time, batch mutation analysis through direct sequencing using a part of the same reaction product further strengthens the reliability of the differential genetic analysis.

A preferred embodiment of the present invention is non-invasive compared to muscle biopsy, shorter test time compared to Southern blotting using radioisotopes, and immunohistochemistry. Muscular dysentery screening test is possible, which is cheaper than staining method.

In addition, the characteristics of the automated chip platform and the same settings of the chip scanning and fluorescence signal intensity analysis software match, enabling the same analysis results for each experimenter or institution.

Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the drawings and tables. The configurations shown in the figures, tables and examples described herein are intended to most preferably illustrate the invention, and the scope of the invention is not limited by these examples, which may be substituted for them at the time of the present application. It should be understood that there may be various equivalents and variations.

Also, within the scope of the present invention, various modifications may be made by those skilled in the art to which the present invention pertains, and such modifications are within the scope of the present invention.

< Example  1> Dystrophin  Multiplex for Gene Deletion, Duplicate, and Point Mutation Analysis PCR  Included in the reaction primer ( primer A) design and synthesis

High-throughput chip for dystrophin gene deletion, duplication, point mutation differential diagnosis to assess its adequacy and effectiveness as a Duschen / Becker dystrophic genetic disease screening test The primers included in the multiplex polymerase chain reaction (PCR) reaction carried out prior to this were designed as follows. Muscular dystrophy retrieved from GenBank, a DNA database from the National Center for Biotechnology Information (NCBI), The DNA Data Bank of Japan (DDBJ) from Japan, and the European Molecular Biology Laboratory (EMBL) sequence database from the European Union. ) Were produced by analyzing about 20 subtype sequences of related dystrophin gene mRNA sequences. 78 exons of Duchenne / Becker type dystrophin gene (Dp427m variant, NCBI accession no.NM_004006.1, GI no.:5032282, Gene ID: 1756) were subdivided into 12 subsets by size Amplification via multiplex-PCR. Preferably, PCR primers were designed in the exon sequence, and primers were designed from intron sequences located at both 5 'and 3' ends of the exon. Primer Premier site for multiplex-PCR (Primer premier version 5, Premier Biosoft International, Palo Alto, CA, USA), DNAsis MAX (2.7, MiraiBio Group, South San Francisco, CA, USA) program was designed to design dystrophin corresponding exon-specific primers. The basic requirements for primer selection are as follows; Primer length (19-24 base pair), melting temperature [Tm (℃), 58-62 ℃], GC content at 3 'end should not be high, and hairpin should not be complementary for more than 4 consecutive bases in primer sequence Secondary structure formation was prevented, and the formation of primer dimers was prevented by preventing three or more identical bases from being consecutively located at the 3 ′ end. In addition, single specific polymorphisms (SNPs) were not included in the target site to ensure high specificity. In addition, the primer sequence is not cross-reactive with dystrophinta exon and other human genome sequences constituting the target chip of the present invention utilizing various nucleotide sequence search tools such as the US NCBI sequencing database. It was verified by. Primers used in the present invention were synthesized through US IDT (Integrated DNA Technologies, Inc., San Jose, CA, USA).

 According to a preferred embodiment of the present invention, primers for the deletion, duplication, and point mutation differential analysis of the dystrophin gene may be prepared by using a primer labeled with fluorescent dye at the 5 'end or 3' end of the DNA sequence, or the fluorescent dye may be labeled. Both methods of labeling amplification products were identified by using non-generic primers and inducing fluorescent dye-labeled deoxyribonucleotide triphosphate to be inserted into amplification products during multiplex PCR reactions. Fluorescent dyes used in the present invention are 6-FAM (6-carboxyfluorescein), Cy5, Cy3, Cy5.5, JOE (6-carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein), Rhodamine Green TAMRA NHS (N-hydroxysuccinimide) Ester, Texas Red. The concentration of the primer was checked with an ND-1000 minute photometer (NanoDrop Technologies, Rockland, Maine, USA) and resuspended in tertiary deionized sterile distilled water to a final range of 50-200 pmole / uL and aliquots Frozen at -70 ℃.

< Example  2> Clinical sample collection and from DNA  detach

Specimens for differential diagnosis of the causes of murine dystrophy are whole blood, serum, amniotic fluid, chorionic villus sampling, tissue, and the like. In order to separate genomic DNA, a commercially available DNA extraction kit (LaboPass ™ Tissue kit, Cosmojintech, Seoul, Korea) was used. Blood was collected using EDTA tubes, refrigerated, and transported. Amniotic fluid and chorionic samples were collected from maternal blood to confirm maternal cell / DNA contamination. About 10 mL of amniotic fluid was collected, and genomic DNA was separated as much as possible.

The Eppendorf tube containing the sample was centrifuged at 12,000 rpm (revolutions per minute) using a Denville 260D high-speed centrifuge (Denville Scientific Inc., Metuchen, NJ, USA) for 1 minute. . The supernatant was removed, the precipitate was dissolved in 500 uL of PBS solution, and centrifuged again under the same conditions. When the volume of the sample was small, 500 uL of 1X PBS solution was added and high-speed centrifugation was carried out under the same conditions. The 1 × PBS solution was formulated with 8 g NaCl, 0.2 g KCl, 1.44 g Na ₂ HPO ₄ , 0.24 g KH ₂ PO ₄ in 1 L of tertiary sterile distilled water to a final pH of 7.4. After adding 200 uL of TL buffer to decompose the precipitate, add 20 uL of proteinase K (100 mg / mL), gently stir (vortex), and then 56 ° C for 10 minutes. Reacted. Then 400 uL TB buffer was added to the reaction and stirred to mix the reaction. The reaction was then loaded onto the top of the spin column and centrifuged at 8,000 rpm for 1 minute. A new collection tube was replaced and 700 uL of BW buffer, which acts to bind the DNA extracted from the sample to the membrane of the column, was added and centrifuged under the same conditions. The collection tube was freshly replaced and 500 uL of NW buffer was added to remove impurities from the membrane and centrifuged at 13,000 rpm for 2 minutes. The top of the spin column was then transferred to a new Eppendorf tube, loaded with 100 uL of de-ionized sterile tertiary distilled water to elute DNA, treated for 5 minutes at room temperature, centrifuged at 8,000 rpm for 2 minutes, and purified pure DNA. Separated.

< Example  3> multiplex PCR through Dystrophin  Genetic variation differential diagnosis chip chip )of target  Gene amplification

Prior to high-throughput chip analysis, 78 dystrophin exons were amplified by multiplex-PCR reactions with genomic DNA isolated from the sample as a template. Twelve subset multiplex combinations were designed to include 7-8 target exons, control genes per multiplex PCR subset. Subsequently, hybridization with probes that are evenly spanned to analyze the entire coding sequence of each exon immobilized with the amplified reaction products on a chip allows the genetic analysis for prenatal diagnosis of muscular dystrophy. Provide postmark data.

Twelve multiplex-PCRs were performed in one reaction at the same time to obtain PCR amplicons for analyzing the presence of deletion, duplication, and point mutations of the entire dystrophin exon. Using 96-well PCR plates, 12 subsets multiplex-PCR could be efficiently performed on 8 clinical samples in a single reaction. The multiplex-PCR is an internal control (endogenous control), a home keeping gene, HPRT (hypoxanthine phosphoribosyltransferase) gene (NCBI accession no. ) Was used. The compositional composition and PCR reaction conditions of the PCR mastermix of the 12 subset multiplex-PCR described in this Example are shown in Table 1 below.

Dystrophin  Multiplex for Gene Mutation Screening PCR Master mix  Composition and PCR  Condition  PCR reaction solution composition  Volume (uL)  PCR reaction conditions  Deionized Tertiary Sterilized Distilled Water  3.5 to 4.2  Initial denaturation  95 ° C, 15 minutes  1 time  7-8 primer premixes  5.8 to 6.5   Denaturation   95 ° C, 30 seconds     25 times  2X Multiplex PCR Premix  15  Annealing  56 ℃ to 59 ℃, 40 seconds  Template DNA (more than 100 ng)  5  Extension  72 ° C., 60 seconds  Final volume  30   Extension  72 ° C., 7 minutes  1 time

The final concentration of the PCR buffer in the multiplex PCR reaction mixture is 50 mM KCl, 4 mM MgCl ₂ , 10 mM Tris-HCl, pH 8.2, 2.5 unit Taq polymerase, 300 uM dNTPs (Boehringer Mannheim, Mannheim, Germany), 0.01% Tween-20, 10 mg / mL bovine serum albumin.

Sense primers of the individual exon genes included in the multiplex-PCR primer premix are synthesized by labeling Cy3 or Cy5 fluorescent dye at the 5'- or 3'-end, or nascent oligos without modification at both ends. Synthesized with nucleotides (Integrated DNA Technologies, Inc., Coralville, IA, USA).

According to a further preferred aspect of the present invention, a multiplex PCR kit comprising primers having no fluorescent dye modifications at both ends is deoxycytosine triphosphate (Cy3- or Cy5- labeled with Cy3 or Cy5 fluorescent dyes) during PCR. dCTP) was added to the nucleotides constituting the amplification product to improve the sensitivity and specificity of the reaction. When Cy3-dCTP was used in a multiplex PCR reaction, the PCR mastermix was prepared with a final concentration of 50 mM KCl, 3.5 mM MgCl ₂ , 10 mM Tris-HCl, pH 8.2, Taq polymerase 2.5 units (h-Taq DNA polymerase, Cat. SG1202, Solgent, Daejeon, Korea), 300 uM dATP, 300 uM dGTP, 300 uM dTTP, 25 uM dCTP, 275 uM Cy3-dCTP (FluoroLink Cy3-dCTP, Amersham Pharmacia Biotech AB, Piscataway, NJ , USA), 0.01% Tween-20, and 10 mg / mL bovine serum albumin.

As a result of DNA analysis of normal and muscular dystrophy patients, the maximum number of PCR cycles to accurately distinguish the duplication variation of dystrophin gene was 25 cycles. When the number of amplification cycles increased to 25 or more, the measurement changed beyond the allowable deviation for accurate gene dosage analysis. Thus, in one preferred embodiment of the present invention, to ensure the accuracy of overlapping mutations, only after performing 25 times of multiplex-PCR, the differential analysis of the deletion, duplication, point mutations, insertion, etc. of the dystrophin gene.

< Example  4> Dystrophin  Multiplex for Point Mutation Analysis of Genes PCR  Sequencing Analysis of Amplified Products

Twelve subsets multiplex-PCR amplification products for amplifying 78 dystrophin exons were confirmed by 2% agarose gel electrophoresis to confirm the product size (bp) and exon amplification. Exon amplicons with confirmed amplification were elution from agarose gels for pure separation from other products in the multiplex-PCR amplification products (Zymoclean ™ Gel DNA Recovery Kit, Cat.No. D4001, Zymo Research Co. Ltd., Orange, CA, USA). A gel slice containing the desired PCR product was added to a 1.5 mL Eppendorf tube, and 3 times the volume of ADB buffer was added, followed by heating at 55 ° C. for 5 minutes to dissolve the gel. The reaction solution was transferred to a Zymo-Spin column and centrifuged at 10,000 rpm for 30 seconds. The eluate was discarded and loaded with 200 uL Wash buffer and centrifuged at 10,000 rpm for 30 seconds and this was repeated once. 15 uL of tertiary sterile distilled water was added and centrifuged at 12,000 rpm for 60 seconds to separate pure amplification products.

The purely isolated amplification product was subjected to sequencing reaction using BigDye® Terminator v3.1 Cycle Sequencing Kit (Part No. 4337455, Applied Biosystems, Foster city, CA, USA), followed by ABI Prism 377 automatic sequencing (Sequencer). ) Confirmed the base sequence. Specifically, 1-3 uL (1-5 ng) of electric pure separation amplification product, 1 uL of sequencing primer (3.2 pmol / uL), 4 uL of Terminator ready reaction mix, and 2 uL of BigDye sequencing buffer were added to the thin wall PCR tube. Tertiary sterile distilled water was added to the final 20 uL and mixed. The mixed reaction solution was subjected to 96 ° C., 1 minute initial denaturation using a PCR instrument (GeneAmp PCR 2700, Applied Biosystems, Foster City, CA, USA), 96 ° C./10 seconds (denature), 50 ° C./5 seconds ( cycle sequencing reaction was performed by 25 cycles of annealing, 60 ° C./4 min (extension). 2 uL of 125 mM EDTA and 2 uL of 3 M sodium acetate were added to the sequencing reaction product and mixed gently. Then, 50 uL of 100% ethanol was added and lightly vortexed. After 15 minutes of incubation at room temperature, centrifugation was performed at 12,000 rpm for 10 minutes. The supernatant was removed and 70 uL of 75% ethanol was added and centrifuged under the same conditions to wash the sequencing reaction product. Ethanol precipitation removed primers, fluorescently labeled dideoxynucleotides (ddNTPs) that remained in the reaction product. 6 μL of Hi-Di formamide: EDTA / blue dextran (5: 1 ratio) loading buffer was added to the ethanol precipitated sequencing reaction DNA pellet, which was denatured and stored on ice at 100 ° C. for 2 minutes. . Thereafter, the sample was loaded into a sample well of a pre-cast 6% Long ranger gel (Takara, Cat. No. F50660, Takara Korea, Seoul, Korea) and subjected to electrophoresis for 2-4 hours depending on the sequencing size. Based on the sequence data obtained through sequencing, point mutations were analyzed by aligning and comparing each exon sequence of the normal control group and the clinical sample.

< Example  5> Dystrophin  Gene mutation differential analysis chip chip Probes that make up probe A) design and synthesis

In order to provide a chip for differential analysis of the cause of mutation of myelopathy genetic disease for the preferred embodiment of the present invention, probes capable of discriminating with high-specificity deletion and duplication of 78 exons of dystrophin gene Designed.

Specifically, the DNA or PNA chip for mutation differential analysis of dystrophin gene according to a preferred embodiment of the present invention is to select a probe site showing a high discrimination ability for deletion and overlapping mutations among the entire coding sequence of the corresponding dystrophin exon. To this end, among probe candidate groups designed to have some exon sequences overlapped with each other on an average 25 bp length basis, probes having high discrimination ability between the normal group and the myopathy patient group are included. The probe screening process can be Primer premier version 5, Premier Biosoft International, Palo Alto, CA, USA, DNASIS MAX Version 2.7, MiraiBio Group, South San Francisco, CA, USA, or OligoArray. 2.0, http://cbr-rbc.nrc-cnrc.gc.ca) program was applied and the details are shown in Table 2. Probes modified to place amine or thiol groups at the 5 'or 3' end of the DNA or PNA probe sequence of interest were synthesized (MWG-Biotech AG, Ebersberg, Germany). When modifying the amino modifier at the 5 'end of the probe, spacers of 6 to 9 carbons or 12 to 15 thymine bases were added to promote the reaction efficiency. No spacer was used when modifying the amino modifier at the 3 'end of the probe. The amine groups of the probe have the properties of primary amine groups and are attached to the aldehyde-activated or carboxyl-activated chip surface. The concentration of the probe was converted to absorbance values at 260 nm, and it was checked for impurities by Maldi-TOF (MALDI-TOF, Matrix Assisted Laser Desorption / Ionization Time-of-Flight), and high performance liquid chromatography (HPLC) After pure purification through liquid chromatography) was prepared so that the final concentration in sterile tertiary distilled water 100-250 pM.

Dystrophin  Gene mutation differential analysis chip chip Make up) Probe ( probe ) Combination Sequence listing number Probe target exon, exon size (exon position in dystrophin Dp470m mRNA sequence)  Probe orientation, probe sequence (5'-3 ')  Length (mer) One exon 1, 31 bp (245-275 bp) Forward, AAATGCTTTGGTGGGAAGAAGTAGA 25 2 Forward, TGCTTTGGTGGGAAGAAGTAGAGGA 25 3 exon 2, 62 bp (276-337 bp) Reverse, TATTTTGCATTTTAGATGAAAGAGAAGATG 30 4 Reverse, CAATTTTCTAAGGTAAGAATGGTTTGTTAC 30 5 exon 3, 93 bp (338-430 bp) Forward, ACCTCTTCAGTGACCTACAGGATGGGA 27 6 Forward, TATTGAGAACCTCTTCAGTGACCTACAG 28 7 exon 4, 78 bp (431-508 bp) Reverse, CCTTGTTGACATTGTTCAGGGCAT 24 8 Reverse, CTTGTTGACATTGTTCAGGGCAT 23 9 exon 5, 93 bp (509-601 bp) Forward, AACTGACTCTTGGTTTGATTTGGAA 25 10 Reverse, AGAGTCAGTTTATGATTTCCATCTACG 27 11 exon 6, 173 bp (602-774 bp) Forward, TGGCTTTGAATGCTCTCATCCATAGTC 27 12 Forward, GCAACAAACCAACAGTGAAAAGATT 25 13 exon 7, 119 bp (775-893 bp) Forward, AGTGTGGTTTGCCAGCAGTCAGCC 24 14 Forward, TGGTTTGCCAGCAGTCAGCCACAC 24 15 exon 8, 182 bp (894-1075 bp) Forward, ACATCACTCTTCCAAGTTTTGCCTC 25 16 Forward, GCCACCTAAAGTGACTAAAGAAGAACA 27 17 exon 9, 129 bp (1076-1204 bp) Forward, CTCTGACCCTACACGGAGCCCATT 24 18 Forward, CACACAGGCTGCTTATGTCACCACC 25 19 exon 10, 189 bp (1205-1393 bp) Forward, AAGACAAGTCATTTGGCAGTTCATT 25 20 Forward, CAAGGAGAGATTTCTAATGATGTGGA 26 21 exon 11, 182 bp (1394-1575 bp) Forward, TCAAGATGGGAATGCCTCAGGGTAG 25 22 Forward, GATTGGAACAGGAAAATTATCAGAAGA 27 23 exon 12, 151 bp (1576-1726 bp) Forward, ACTGAAAGAGTTGAATGACTGGCTAA 26 24 Forward, AGAACAAGGAAAATGGAGGAAGAGCC 26 25 exon 13, 120bp (1727-1846bp) Reverse, CTTCCAAAGCAGCAGTTGCGTGAT 24 26 Forward, GGTGGTAGTTGATGAATCTAGTGGAGA 27 27 exon 14, 102 bp (1847-1948 bp) Reverse, GAACCCAGCGGTCTTCTGTCCATCTA 26 28 Forward, CAAGACATCCTTCTCAAATGGCAACG 26 29 exon 15, 108 bp (1949-2056 bp) Forward, GAACAAGATTCACACAACTGGCTTTAA 27 30 Forward, AAGATCAAAATGAAATGTTATCAAGTCTTC 30 31 exon 16, 180 bp (2057-2236 bp) Forward, TCAGTGACCCAGAAGACGGAAGCAT 25 32 Forward, TGGGCAAACTGTATTCACTCAAACA 25 33 exon 17, 176 bp (2237-2412 bp) Forward, GTAACTACGGTGACCACAAGGGAACAGA 28 34 Forward, TCCCCAAAAGAAGAGGCAGATTACT 25 35 exon 18, 124 bp (2413-2536 bp) Forward, GCAATCTTTCGGAAGGAAGGCAACT 25 36 Reverse, AAGTTGCCTTCCTTCCGAAAGATTG 25 37 exon 19, 88 bp (2537-2624 bp) Forward, GCCCTGGTGGAACAGATGGTGAATG 25 38 Forward, GCCCTGGTGGAACAGATGGTGAA 23 39 exon 20, 242 bp (2625-2866 bp) Forward, GCAGATAGCATCAAACAAGCCTCAGA 26 40 Forward, TACTGCTGAAAACTGGTTGAAAATCC 26 41 exon 21, 181 bp (2867-3047 bp) Forward, CTATGGCACAGGATGAAGTCAACCG 25 42 Forward, ATACTCTATGGCACAGGATGAAGTCAAC 28 43 exon 22, 146 bp (3048-3193 bp) Forward, TGGGTCCAGCAGTCAGAAACCAAAC 25 44 Forward, GCAGTCAGAAACCAAACTCTCCATACC 27 45 exon 23, 213 bp (3194-3406 bp) Reverse, GCTTCTTCCAGCGTCCCTCAAT 22 46 Forward, TCAGCACCACTGTGAAAGAGATGTCG 26 47 exon 24, 114 bp (3407-3520 bp) Forward, AAACCCTGAAGAAATGGATGGCTGA 25 48 Forward, GAAATGGATGGCTGAAGTTGATGTT 25 49 exon 25, 156 bp (3521-3676 bp) Forward, AAACAGTGTCAATGAAGGTGGGCAGA 26 50 Forward, TGGGCAGAAGATAAAGAATGAAGCAGA 27 51 exon 26, 171 bp (3677-3847 bp) Forward, GAGAAAACTGTAAGCCTCCAGAAAGAT 27 52 Forward, TTACAGAAAGCAGTTGAAGAGATGAAG 27 53 exon 27, 183 bp (3848-4030 bp) Forward, GCCCAACAAAAAGAAGCGAAAGTGAA 26 54 Reverse, AGTTTCACTTTCGCTTCTTTTTGTTGG 27 55 exon 28, 135 bp (4031-4165 bp) Forward, GGAGAAAGCAAACAAGTGGCTAAATGA 27 56 Forward, AGAAAGCAAACAAGTGGCTAAATGAAGT 28 57 exon 29, 150 bp (4166-4315 bp) Forward, TATTGGCACAGACCCTAACAGATGGC 26 58 Forward, TGATGCGACATTCAGAGGATAACCCAA 27 59 exon 30, 162 bp (4316-4477 bp) Reverse, GCTGCCAACTGCTTGTCAATGAATGT 26 60 Reverse, CTGGGCTTCCTGAGGCATTTGAG 23 61 exon 31, 111 bp (4478-4588 bp) Forward, AGGGGAAGGAGGCTGCCCAAAGAG 24 62 Forward, AGAGTCCTGTCTCAGATTGATGTTGC 26 63 exon 32, 174 bp (4589-4762 bp) Forward, TTTGAGCAGCGTCTACAAGAAAGTAAG 27 64 Forward, GCATTGGAAACAAAGAGTGTGGAAC 25 65 exon 33, 156 bp (4763-4918 bp) Forward, GAAAAAGCAGACGGAAAATCCCAAAG 26 66 Forward, CAAAGAACTTGATGAAAGAGTAACAGC 27 67 exon 34, 171 bp (4919-5089 bp) Forward, CGTAAGATGCGAAAGGAAATGAATGT 26 68 Forward, ATTTGGATTCTGAAGTTGCCTGGGGA 26 69 exon 35, 180 bp (5090-5269 bp) Forward, AACAGTTTTGGGCAAGAAGGAGACG 25 70 Forward, CTGAAGAGTATCACAGAGGTAGGAGAGG 28 71 exon 36, 129 bp (5270-5398 bp) Reverse, TGATTCATCCAAAAGTGTGTCAGCCT 26 72 Forward, CAGGCTGACACACTTTTGGATGAAT 25 73 exon 37, 171 bp (5399-5569 bp) Forward, GCAGAACTGAATGACATACGCCCAA 25 74 Forward, AAGCAGCAAACTTGATGGCAAACCG 25 75 exon 38, 123 bp (5570-5692 bp) Forward, TGCTTGAACCACTGGAGGCTGAAAT 25 76 Reverse, GTCTTCCTCTTTCAGATTCACCCCCT 26 77 exon 39, 138 bp (5693-5830 bp) Forward, ATCACAGATGAGAGAAAGCGAGAGGAA 27 78 Forward, CAGACAAAACATAATGCTCTCAAGGTA 27 79 exon 40, 153 bp (5831-5983 bp) Forward, AGCCAGCCTACCTGAGCCCAGAGAT 25 80 Forward, GAGGTCTCAAAGAAGAAAAAAGGCT 25 81 exon 41, 183 bp (5894-6166 bp) Forward, GCTGAGGGCTTGTCTGAGGATGGG 24 82 Forward, TGAGGGCTTGTCTGAGGATGGGGC 24 83 exon 42, 195 bp (6167-6361 bp) Forward, ACAAGCCCTATTAGAAGTGGAACAAC 26 84 Forward, TGACCTCTGTGCTAAGGACTTTGAA 25 85 exon 43, 173bp (6362-6534bp) Forward, CAACGCCTGTGGAAAGGGTGAAGC 24 86 Forward, CTTCACCCTTTCCACAGGCGTTGC 24 87 exon 44, 148 bp (6535-6682 bp) Forward, ATCTGTTGAGAAATGGCGGCGTT 23 88 Reverse, AACGCCGCCATTTCTCAACAGAT 23 89 exon 45, 176 bp (6683-6858 bp) Forward, GAACTCCAGGATGGCATTGGGCAG 24 90 Forward, ATTGGGAAGCCTGAATCTGCGGTG 24 91 exon 46, 148 bp (6859-7006 bp) Forward, AAAAGAGCAGCAACTAAAAGAAAAGC 26 92 Forward, ATTTGTTTTATGGTTGGAGGAAGCAG 26 93 exon 47, 150bp (7007-7156bp) Forward, TAAATGAAACTGGAGGACCCGTGCT 25 94 Forward, CCCATAAGCCCAGAAGAGCAAGATA 25 95 exon 48, 186bp (7157-7342bp) Forward, TCATCTGCTGCTGTGGTTATCTCCTA 26 96 Forward, ATAACCAACCAAACCAAGAAGGACCA 26 97 exon 49, 102 bp (7343-7444 bp) Forward, TGGAAGAGATTTTGTCTAAAGGGCAGC 27 98 Forward, TACAAGGAAAAACCAGCCACTCAGCC 26 99 exon 50, 109 bp (7445-7553 bp) Forward, TCCTGGACTGACCACTATTGGAGCCT 26 100 Reverse, AGGCTCCAATAGTGGTCAGTCCAGGA 26 101 exon 51, 233 bp (7554-7786 bp) Reverse, TCAAGCAGAGAAAGCCAGTCGGTAA 25 102 Forward, TTGGACAGAACTTACCGACTGGCTT 25 103 exon 52, 118 bp (7787-7904 bp) Forward, ACAGAGGCGTCCCCAGTTGGAAGAA 25 104 Forward, TGAAAAACAAGACCAGCAATCAAGAGG 27 105 exon 53, 212bp (7905-8116bp) Forward, TAAAGGATTCAACACAATGGCTGGA 25 106 Forward, GCAATCCAAAAGAAAATCACAGAAACCA 28 107 exon 54, 155 bp (8117-8271 bp) Forward, TGGCAGACAAATGTAGATGTGGCAA 25 108 Forward, GCAGATGATACCAGAAAAGTCCACA 25 109 exon 55, 190 bp (8272-8461 bp) Forward, CTACAGGATGCTACCCGTAAGGAAAGG 27 110 Forward, CAAAGCAGCCTCTCGCTCACTCACC 25 111 exon 56, 173 bp (8462-8634 bp) Forward, TCGGAAAAAGTCTCTCAACATTAGGTAG 28 112 Reverse, CCTACCTAATGTTGAGAGACTTTTTCCG 28 113 exon 57, 157 bp (8635-8791 bp) Forward, AAGCCAGTTCTGACCAGTGGAAGCGT 26 114 Forward, CAGGCACCTATTGGAGGCGACTTTC 25 115 exon 58, 121 (8792-8912 bp) Forward, GAGAAACTCTACCAGGAGCCCAG 23 116 Forward, ATTTCTGACAGAGCAGCCTTTGGAAG 26 117 exon 59, 269 bp (8913-9181 bp) Forward, CTCCGCTGACTGGCAGAGAAAAATAGATG 29 118 Forward, TGAGGAGGTCAATACTGAGTGGGAA 25 119 exon 60, 147 bp (9182-9328 bp) Forward, CGTATAACCTCAGCACTCTGGAAGACC 27 120 Forward, CTCTCACCGTATAACCTCAGCACTCT 26 121 exon 61, 79 bp (9408-9468 bp) Forward, ACTTTGGTCCAGCATCTCAGCACTTTC 27 122 Forward, CTTTCTTTCCAGTAAGTCATTTTCAGC 27 123 exon 62, 61 bp (9408-9468 bp) Forward, CTTCTTTTCAGCGTCTGTCCAGGGTC 26 124 Forward, AGAGCCATCTCGCCAAACAAAGTGC 25 125 exon 63, 62 bp (9469-9530 bp) Forward, ACGAGACTCAAACAACTTGCTGGGACC 27 126 Forward, TATGTTTTGTGTTTTAGCCACGAGACT 27 127 exon 64, 75bp (9531-9605bp) Forward, TAATGTCAGATTCTCAGCTTATAGGACTG 29 128 Reverse, GCAGTCTTCGGAGTTTCATGGCAGT 25 129 exon 65, 202 bp (9606-9807 bp) Forward, GTTTGACCACTATTTATGACCGCCTG 26 130 Forward, TATGTGTCTGAACTGGCTGCTGAATGT 27 131 exon 66, 85 bp (9808-9893 bp) Forward, TAAAACTGGCATCATTTCCCTGTGTAA 27 132 Reverse, TTACACAGGGAAATGATGCCAGTTTTA 27 133 exon 67, 157 bp (9894-10051 bp) Forward, CCTTTTCAAGCAAGTGGCAAGTTCAA 26 134 Forward, GCATCCTTTGGGGGCAGTAACATTG 25 135 exon 68, 167 bp (10052-10218 bp) Forward, AAACTGCCAAGCATCAGGCCAAATGT 26 136 Reverse, ACATTTGGCCTGATGCTTGGCAGTTT 26 137 exon 69, 111bp (10219-10330bp) Forward, TTTAATTATGACATCTGCCAAAGCTGCT 28 138 Reverse, AGCAGCTTTGGCAGATGTCATAATTAAA 28 139 exon 70, 136 bp (10331-10467 bp) Forward, AAGGTATTTTGCGAAGCATCCCCGA 25 140 Forward, GAAGCATCCCCGAATGGGCTACCT 24 141 exon 71, 39bp (10468-10506bp) Forward, GCCAGTAGATTCTGCGTGAGTACTTT 26 142 Forward, AAAGTACTCACGCAGAATCTACTGGC 26 143 exon 72, 66 bp (10507-10572 bp) Forward, CACGATGATACTCATTCACGCATTGA 26 144 Forward, GCCTGCCTCGTCCCCTCAGC 20 145 exon 73, 66 bp (10573-10638 bp) Forward, TAGCAGAAATGGAAAACAGCAATGG 25 146 Forward, GCAGAAATGGAAAACAGCAATGGAT 25 147 exon 74, 159 bp (10639-10797 bp) Reverse, TACGAGGCTGGCTCAGGGGGGA 22 148 Forward, ACTCCCCCCTGAGCCAGCCTCGTAG 25 149 exon 75, 244 bp (10798-11041 bp) Forward, CCCTCCTGAAATGATGCCCACCTCT 25 150 Forward, GCTGGAGTCACAGTTACACAGGCTA 25 151 exon 76, 124 bp (11042-11165 bp) Forward, GAGTGGTTGGCAGTCAAACTTCGGA 25 152 Forward, AAGTGAATGGCACAACGGTGTCCTCT 26 153 exon 77, 93 bp (11166-11258 bp) Forward, CCCCAGGACACAAGCACAGGGTTAG 25 154 Forward, GAGCAACTCAACAACTCCTTCCCTA 25 155 exon 78, 32 bp (11259-11290 bp) Forward, AGGAAGAAATACCCCTGGAAAGCGAA 24 156 Forward, TTCGCTTTCCAGGGGTATTTCTTCCT 24

< Example  5> Dystrophin  Gene mutation differential analysis chip chip Production

DNA or PNA chip for mutation differential analysis of dystrophin gene, which is provided as a preferred embodiment of the present invention, includes 156 empirically selected species capable of high-specificity of deletion and duplication of 78 exons of a corresponding dystrophin gene. Probes are integrated. As an endogenous control, the HPRT (hypoxanthine phosphoribosyltransferase) gene probe, a house keeping gene located on the X chromosome, is immobilized as in dystrophin. An 8-well hybridization reaction chamber was designed with a chip layout designed to include eight grids capable of high-throughput differential analysis of deletion and duplication of 78 exstropins on a single chip substrate. ) Is designed to proceed with the analysis of eight individual samples at the same time (see Figure 2). After thawing at 70 ° C., the probe stock was stored at room temperature, and then diluted with deionized sterile tertiary distilled water to a final concentration of 100 μM and used as a working stock. Each probe with 50-fold dilution of working stock was subjected to a 1: 5-10 ratio (v / v) with 3X SSC spotting solution (500 mM NaCl, 3 mM sodium citrate, 1.5 MN, N, N-trimethylglycine, pH 6.8). By mixing, the concentration range of the probe dispensed into the final 96 well plate was 20-30 pmole / uL. The master plate was mounted on a Microssys 5100 microarrayer (Cartesian Technologies, Ann Arbor, MI, USA), from which an aldehyde-, thioisocyanate-activated glass slide (CEL associates Inc., Houston, TX, USA) ), Two probes were spotted in duplicate on the surface of the epoxy-activated plastic chip or gold film. The average diameter of the spots is 80-140 micrometers and the distance between spots was maintained at 350-500 micrometers to minimize cross-talk effects between spots. Chip fabrication was carried out in a class 10,000 room maintaining 75% humidity. The chip spotted with the probe was baked at 120 ° C. for 1 hour, and then washed for 3 minutes in 0.25% SDS (Sodium dodecyl sulfate) solution, and then again washed with sterile tertiary distilled water. The chip was then reacted with a solution containing 0.2% sodium borohydride (NaBH ₄ ) for 15 minutes to block the probe. After washing twice with 3 distilled water, water was removed and placed in a chip slide storage box, and stored in a desiccator (dessicator) until the point of use.

< Example  6> Dystrophin  Gene mutation differential analysis chip chip ) Hybridization ( hybridization ) Response and result analysis

A total of 60-120 uL of 5-10 uL of the 12 subset multiplex-PCR amplification products for amplifying 78 exons of the dystrophin gene and the control gene according to the preferred embodiment of the present invention are respectively the same volume. Of deionized tertiary sterile distilled water was added to a 1.5 mL Eppendorf tube pre-added. The mixture was gently vortexed, thermally denatured at 95 ° C. for 5 minutes, preserved on ice for 5 minutes and spun down with a centrifuge. An 8 well hybridization chamber was placed on the analytical chip surface and the well top was covered with a well cover. Thereafter, 60-120 uL of a hybridization reaction solution (3X SSC, 0.1% SDS, 0.2 mg / mL bovine serum albumin, pH 7), which was preheated to the reaction mixture solution at 58 ° C., in the reaction mixture solution ) Was added and mixed, and then the reaction mixture was injected through the hole of the well cover, and care was taken not to generate bubbles. After fixing the chamber lid, hybridization reaction was performed at 58 ° C. for 30 minutes to induce specific nucleotide complementary binding between the probe on the chip surface and the multiplex PCR reaction product. The well cover of the chip surface where the hybridization reaction was completed was removed, the chip was immersed in the washing buffer 1 (0.1X SSC, 0.05% SDS) solution, washed with stirring at 2,000 rpm for 2 minutes, and repeated. After washing with washing solution 2 (2X SSC, 0.1% SDS) solution at 2,000 rpm for 2 minutes (washing) was repeated. Thereafter, the chips were dried by immersion in deionized tertiary sterile distilled water twice and centrifuged at 1,000 rpm. After the non-specific signal of the chip reaction was removed by the electric washing process, the chips for differential analysis of dystrophin mutation were read using a scan array light (ScanArray Lite, Packard Instrument Co., Meriden, CT, USA) scanner, and analyzed by the analysis software ( QuantArray 2.0) is used to determine the signal-to-noise (S / R) ratio by comparing the mean fluorescence intensity and standard error of the positive control spots with the values around the spots. Scoring was performed (see FIGS. 3, 4, 5).

Figure 1 shows the presence of dystrophin exon deletion and the presence of dystrophin protein through myofibrillar tissue staining of normal and Duchenne muscular dystrophy. Unlike normal people without a dystrophin exon deletion (top left), myopathy patients can identify more than one exon deletion in the dystrophin gene (top right). Normal subjects can confirm the presence of dystrophin protein in myofiber tissue staining (bottom left), but rarely in tissues of muscle dystrophy patients (bottom right).

Figure 2 is a schematic diagram of a dystrophin gene mutation differential analysis chip for identifying the cause of Duchenne / Becker-type muscular dystrophy genetic disease prepared according to the present invention. A chip grid is shown in which a probe for analyzing the deletion and duplication of the entire exon encoding dystrophin mRNA (approximately 14,000 bp) with high discrimination power is shown. An 8-well hybridization reaction chamber in which hybridization reaction is performed is shown schematically.

Figure 3, after fabrication of the chip in which the probe is immobilized according to the present invention, after amplifying the entirety of 78 dystrophin exons by multiplex PCR as a template genomic DNA isolated from the clinical sample, the fluorescently labeled amplification product and the selective on the chip Dystrophin gene mutations that cause muscular dystrophy by analyzing hybridization with probes and analyzing the deletion and duplication of the dystrophin gene and confirming the presence or absence of point mutations by direct sequencing some of the multiplex amplification products An analytical flow chart for differentially diagnosing

Figure 4 shows the chip grid (top) and chip scan image (bottom) showing the results of differential mutation analysis of dystrophin gene from clinical specimens according to the present invention. Exxon 3, 4, 5, 9, 19, 22, 23, 24, 25, 26, 40, 41, 42, 43, 44, 45, 51 And 52 show chip analysis images of Duchenne muscular dystrophy patients with large deletions.

Figure 5 shows a chip grid (top) and chip scan image (bottom) showing the results of differential mutation analysis of dystrophin gene from clinical specimens according to the present invention. Exon 25, 26, 27, 28, 29, 30, 48, 49, 50, 51 and 52 show chip analysis images of Becker-type muscular dystrophy patients with small deletions.

<110> PARK, MinKoo <120> Differential diagnostic method, kit, chip for the dystrophin gene          deletion, duplication, point mutation and DMD / BMD screening test          therethrough <160> 156 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 1 probe <400> 1 aaatgctttg gtgggaagaa gtaga 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon1 probe <400> 2 tgctttggtg ggaagaagta gagga 25 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon2 probe <400> 3 tattttgcat tttagatgaa agagaagatg 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon2 probe <400> 4 caattttcta aggtaagaat ggtttgttac 30 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon3 probe <400> 5 acctcttcag tgacctacag gatggga 27 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon3 probe <400> 6 tattgagaac ctcttcagtg acctacag 28 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon4 probe <400> 7 ccttgttgac attgttcagg gcat 24 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon4 probe <400> 8 cttgttgaca ttgttcaggg cat 23 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon5 probe <400> 9 aactgactct tggtttgatt tggaa 25 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon5 probe <400> 10 agagtcagtt tatgatttcc atctacg 27 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon6 probe <400> 11 tggctttgaa tgctctcatc catagtc 27 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon6 probe <400> 12 gcaacaaacc aacagtgaaa agatt 25 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon7 probe <400> 13 agtgtggttt gccagcagtc agcc 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon7 probe <400> 14 tggtttgcca gcagtcagcc acac 24 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 8 probe <400> 15 acatcactct tccaagtttt gcctc 25 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 8 probe <400> 16 gccacctaaa gtgactaaag aagaaca 27 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 9 probe <400> 17 ctctgaccct acacggagcc catt 24 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 9 probe <400> 18 cacacaggct gcttatgtca ccacc 25 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 10 probe <400> 19 aagacaagtc atttggcagt tcatt 25 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 10 probe <400> 20 caaggagaga tttctaatga tgtgga 26 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 11 probe <400> 21 tcaagatggg aatgcctcag ggtag 25 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 11 probe <400> 22 gattggaaca ggaaaattat cagaaga 27 <210> 23 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 12 probe <400> 23 actgaaagag ttgaatgact ggctaa 26 <210> 24 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 12 probe <400> 24 agaacaagga aaatggagga agagcc 26 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 13 probe <400> 25 cttccaaagc agcagttgcg tgat 24 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 13 probe <400> 26 ggtggtagtt gatgaatcta gtggaga 27 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 14 probe <400> 27 gaacccagcg gtcttctgtc catcta 26 <210> 28 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 14 probe <400> 28 caagacatcc ttctcaaatg gcaacg 26 <210> 29 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 15 probe <400> 29 gaacaagatt cacacaactg gctttaa 27 <210> 30 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 15 probe <400> 30 aagatcaaaa tgaaatgtta tcaagtcttc 30 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 16 probe <400> 31 tcagtgaccc agaagacgga agcat 25 <210> 32 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 16 probe <400> 32 tgggcaaact gtattcactc aaaca 25 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 17 probe <400> 33 gtaactacgg tgaccacaag ggaacaga 28 <210> 34 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 17 probe <400> 34 tccccaaaag aagaggcaga ttact 25 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 18 probe <400> 35 gcaatctttc ggaaggaagg caact 25 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 18 probe <400> 36 aagttgcctt ccttccgaaa gattg 25 <210> 37 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 19 probe <400> 37 gccctggtgg aacagatggt gaatg 25 <210> 38 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 19 probe <400> 38 gccctggtgg aacagatggt gaa 23 <210> 39 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 20 probe <400> 39 gcagatagca tcaaacaagc ctcaga 26 <210> 40 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 20 probe <400> 40 tactgctgaa aactggttga aaatcc 26 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 21 probe <400> 41 ctatggcaca ggatgaagtc aaccg 25 <210> 42 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 21 probe <400> 42 atactctatg gcacaggatg aagtcaac 28 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 22 probe <400> 43 tgggtccagc agtcagaaac caaac 25 <210> 44 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 22 probe <400> 44 gcagtcagaa accaaactct ccatacc 27 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 23 probe <400> 45 gcttcttcca gcgtccctca at 22 <210> 46 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 23 probe <400> 46 tcagcaccac tgtgaaagag atgtcg 26 <210> 47 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 24 probe <400> 47 aaaccctgaa gaaatggatg gctga 25 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 24 probe <400> 48 gaaatggatg gctgaagttg atgtt 25 <210> 49 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 25 probe <400> 49 aaacagtgtc aatgaaggtg ggcaga 26 <210> 50 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 25 probe <400> 50 tgggcagaag ataaagaatg aagcaga 27 <210> 51 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 26 probe <400> 51 gagaaaactg taagcctcca gaaagat 27 <210> 52 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 26 probe <400> 52 ttacagaaag cagttgaaga gatgaag 27 <210> 53 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 27 probe <400> 53 gcccaacaaa aagaagcgaa agtgaa 26 <210> 54 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 27 probe <400> 54 agtttcactt tcgcttcttt ttgttgg 27 <210> 55 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 28 probe <400> 55 ggagaaagca aacaagtggc taaatga 27 <210> 56 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 28 probe <400> 56 agaaagcaaa caagtggcta aatgaagt 28 <210> 57 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 29 probe <400> 57 tattggcaca gaccctaaca gatggc 26 <210> 58 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 29 probe <400> 58 tgatgcgaca ttcagaggat aacccaa 27 <210> 59 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 30 probe <400> 59 gctgccaact gcttgtcaat gaatgt 26 <210> 60 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 30 probe <400> 60 ctgggcttcc tgaggcattt gag 23 <210> 61 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 31 probe <400> 61 aggggaagga ggctgcccaa agag 24 <210> 62 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 31 probe <400> 62 agagtcctgt ctcagattga tgttgc 26 <210> 63 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 32 probe <400> 63 tttgagcagc gtctacaaga aagtaag 27 <210> 64 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 32 probe <400> 64 gcattggaaa caaagagtgt ggaac 25 <210> 65 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 33 probe <400> 65 gaaaaagcag acggaaaatc ccaaag 26 <210> 66 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 33 probe <400> 66 caaagaactt gatgaaagag taacagc 27 <210> 67 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 34 probe <400> 67 cgtaagatgc gaaaggaaat gaatgt 26 <210> 68 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 34 probe <400> 68 atttggattc tgaagttgcc tgggga 26 <210> 69 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 35 probe <400> 69 aacagttttg ggcaagaagg agacg 25 <210> 70 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 35 probe <400> 70 ctgaagagta tcacagaggt aggagagg 28 <210> 71 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 36 probe <400> 71 tgattcatcc aaaagtgtgt cagcct 26 <210> 72 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 36 probe <400> 72 caggctgaca cacttttgga tgaat 25 <210> 73 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 37 probe <400> 73 gcagaactga atgacatacg cccaa 25 <210> 74 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 37 probe <400> 74 aagcagcaaa cttgatggca aaccg 25 <210> 75 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 38 probe <400> 75 tgcttgaacc actggaggct gaaat 25 <210> 76 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 38 probe <400> 76 gtcttcctct ttcagattca ccccct 26 <210> 77 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 39 probe <400> 77 atcacagatg agagaaagcg agaggaa 27 <210> 78 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 39 probe <400> 78 cagacaaaac ataatgctct caaggta 27 <210> 79 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 40 probe <400> 79 agccagccta cctgagccca gagat 25 <210> 80 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 40 probe <400> 80 gaggtctcaa agaagaaaaa aggct 25 <210> 81 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 41 probe <400> 81 gctgagggct tgtctgagga tggg 24 <210> 82 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 41 probe <400> 82 tgagggcttg tctgaggatg gggc 24 <210> 83 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 42 probe <400> 83 acaagcccta ttagaagtgg aacaac 26 <210> 84 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 42 probe <400> 84 tgacctctgt gctaaggact ttgaa 25 <210> 85 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 43 probe <400> 85 caacgcctgt ggaaagggtg aagc 24 <210> 86 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 43 probe <400> 86 cttcaccctt tccacaggcg ttgc 24 <210> 87 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 44 probe <400> 87 atctgttgag aaatggcggc gtt 23 <210> 88 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 44 probe <400> 88 aacgccgcca tttctcaaca gat 23 <210> 89 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 45 probe <400> 89 gaactccagg atggcattgg gcag 24 <210> 90 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 45 probe <400> 90 attgggaagc ctgaatctgc ggtg 24 <210> 91 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 46 probe <400> 91 aaaagagcag caactaaaag aaaagc 26 <210> 92 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 46 probe <400> 92 atttgtttta tggttggagg aagcag 26 <210> 93 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 47 probe <400> 93 taaatgaaac tggaggaccc gtgct 25 <210> 94 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 47 probe <400> 94 cccataagcc cagaagagca agata 25 <210> 95 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 48 probe <400> 95 tcatctgctg ctgtggttat ctccta 26 <210> 96 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 48 probe <400> 96 ataaccaacc aaaccaagaa ggacca 26 <210> 97 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 49 probe <400> 97 tggaagagat tttgtctaaa gggcagc 27 <210> 98 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 49 probe <400> 98 tacaaggaaa aaccagccac tcagcc 26 <210> 99 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 50 probe <400> 99 tcctggactg accactattg gagcct 26 <210> 100 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 50 probe <400> 100 aggctccaat agtggtcagt ccagga 26 <210> 101 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 51 probe <400> 101 tcaagcagag aaagccagtc ggtaa 25 <210> 102 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 51 probe <400> 102 ttggacagaa cttaccgact ggctt 25 <210> 103 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 52 probe <400> 103 acagaggcgt ccccagttgg aagaa 25 <210> 104 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 52 probe <400> 104 tgaaaaacaa gaccagcaat caagagg 27 <210> 105 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 53 probe <400> 105 taaaggattc aacacaatgg ctgga 25 <210> 106 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 53 probe <400> 106 gcaatccaaa agaaaatcac agaaacca 28 <210> 107 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 54 probe <400> 107 tggcagacaa atgtagatgt ggcaa 25 <210> 108 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 54 probe <400> 108 gcagatgata ccagaaaagt ccaca 25 <210> 109 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 55 probe <400> 109 ctacaggatg ctacccgtaa ggaaagg 27 <210> 110 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 55 probe <400> 110 caaagcagcc tctcgctcac tcacc 25 <210> 111 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 56 probe <400> 111 tcggaaaaag tctctcaaca ttaggtag 28 <210> 112 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 56 probe <400> 112 cctacctaat gttgagagac tttttccg 28 <210> 113 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 57 probe <400> 113 aagccagttc tgaccagtgg aagcgt 26 <210> 114 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 57 probe <400> 114 caggcaccta ttggaggcga ctttc 25 <210> 115 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 58 probe <400> 115 gagaaactct accaggagcc cag 23 <210> 116 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 58 probe <400> 116 atttctgaca gagcagcctt tggaag 26 <210> 117 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 59 probe <400> 117 ctccgctgac tggcagagaa aaatagatg 29 <210> 118 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 59 probe <400> 118 tgaggaggtc aatactgagt gggaa 25 <210> 119 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 60 probe <400> 119 cgtataacct cagcactctg gaagacc 27 <210> 120 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 60 probe <400> 120 ctctcaccgt ataacctcag cactct 26 <210> 121 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 61 probe <400> 121 actttggtcc agcatctcag cactttc 27 <210> 122 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 61 probe <400> 122 ctttctttcc agtaagtcat tttcagc 27 <210> 123 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 62 probe <400> 123 cttcttttca gcgtctgtcc agggtc 26 <210> 124 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 62 probe <400> 124 agagccatct cgccaaacaa agtgc 25 <210> 125 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 63 probe <400> 125 acgagactca aacaacttgc tgggacc 27 <210> 126 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 63 probe <400> 126 tatgttttgt gttttagcca cgagact 27 <210> 127 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 64 probe <400> 127 taatgtcaga ttctcagctt ataggactg 29 <210> 128 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 64 probe <400> 128 gcagtcttcg gagtttcatg gcagt 25 <210> 129 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 65 probe <400> 129 gtttgaccac tatttatgac cgcctg 26 <210> 130 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 65 probe <400> 130 tatgtgtctg aactggctgc tgaatgt 27 <210> 131 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 66 probe <400> 131 taaaactggc atcatttccc tgtgtaa 27 <210> 132 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 66 probe <400> 132 ttacacaggg aaatgatgcc agtttta 27 <210> 133 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 67 probe <133> 133 ccttttcaag caagtggcaa gttcaa 26 <210> 134 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 67 probe <400> 134 gcatcctttg ggggcagtaa cattg 25 <210> 135 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 68 probe <400> 135 aaactgccaa gcatcaggcc aaatgt 26 <210> 136 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 68 probe <400> 136 acatttggcc tgatgcttgg cagttt 26 <210> 137 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 69 probe <400> 137 tttaattatg acatctgcca aagctgct 28 <210> 138 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 69 probe <400> 138 agcagctttg gcagatgtca taattaaa 28 <139> <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 70 probe <400> 139 aaggtatttt gcgaagcatc cccga 25 <210> 140 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 70 probe <400> 140 gaagcatccc cgaatgggct acct 24 <210> 141 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 71 probe <400> 141 gccagtagat tctgcgtgag tacttt 26 <210> 142 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 71 probe <400> 142 aaagtactca cgcagaatct actggc 26 <210> 143 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 72 probe <400> 143 cacgatgata ctcattcacg cattga 26 <210> 144 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 72 probe <400> 144 gcctgcctcg tcccctcagc 20 <210> 145 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 73 probe <400> 145 tagcagaaat ggaaaacagc aatgg 25 <210> 146 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 73 probe <400> 146 gcagaaatgg aaaacagcaa tggat 25 <210> 147 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 74 probe <400> 147 tacgaggctg gctcaggggg ga 22 <210> 148 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 74 probe <400> 148 actcccccct gagccagcct cgtag 25 <210> 149 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 75 probe <400> 149 ccctcctgaa atgatgccca cctct 25 <210> 150 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 75 probe <400> 150 gctggagtca cagttacaca ggcta 25 <210> 151 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 76 probe <400> 151 gagtggttgg cagtcaaact tcgga 25 <210> 152 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 76 probe <400> 152 aagtgaatgg cacaacggtg tcctct 26 <210> 153 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 77 probe <400> 153 ccccaggaca caagcacagg gttag 25 <210> 154 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 77 probe <400> 154 gagcaactca acaactcctt cccta 25 <210> 155 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 78 probe <400> 155 aggaagaaat acccctggaa agcgaa 26 <210> 156 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> dystrophin exon 78 probe <400> 156 ttcgctttcc aggggtattt cttcct 26  

Claims (11)

A method for differential diagnosis of deletion, duplication, and point mutation of the human dystrophin gene simultaneously in a high-throughput manner. The method of claim 1, further comprising: manufacturing a chip in which a probe modified with an amino modifier or a thiol modifier at the 5′- or 3′-end is spotted; Isolating genomic DNA from the sample; The target DNA amplification product was prepared to include fluorescent dyes by amplifying a probe target site for determining deletion and overlapping mutations in all 78 exons of the dystrophin gene through a multiplex-PCR reaction. step; Analyzing a portion of the multiplex-PCR reaction product for the presence of point mutations using an automatic sequencing method; Performing and washing a hybridization reaction between the multiplex-PCR reaction product and a probe immobilized on a chip surface; Differentially analyzing the deletion and overlapping mutations of the exons encoding dystrophin mRNA by scanning the chip with a laser of a wavelength specific to the fluorescent dye and measuring the fluorescence intensity according to the hybridization reaction result; And Dystrophin gene deletion, duplication, point mutation differential diagnosis method comprising all of the above analysis step. According to claim 1, Dystrophin gene deletion, duplication, point mutation differential diagnosis comprising one or more DNA probes (probe) selected from the group consisting of DNA oligonucleotide (deoxyribonucleic acid oligonucleotide) having a nucleotide sequence of SEQ ID NO: 1 to 156 DNA chip. The method of claim 1, wherein the DNA deletion, duplication, point mutation differential diagnosis PNA chip comprising at least one PNA probe selected from the group consisting of PNA oligonucleotide (Pptide nucleic acid oligonucleotide) having a nucleotide sequence of SEQ ID NO: 1 to 156 . The method of claim 1, wherein the one or more probes selected from the group consisting of probes having the nucleotide sequences of SEQ ID NOs: 1 to 156 to differentiate deletions, duplications, and point mutations of exons encoding dystrophin mRNA Multiplex-PCR kit capable of amplifying the target site. The kit according to claim 1, wherein the kit comprises a primer labeled with a fluorescent dye at the 5 'or 3' end of a forward or anti-sense primer. The base of the amplification product according to claims 1 to 5 using deoxycytidine triphosphate (dCTP) or deoxyuridine triphosphate (dUTP) labeled with fluorescent dye during PCR amplification. Kit having a reaction principle that the fluorescent dye in the sequence is labeled. The method of claim 1, wherein the fluorescent pigments are biotin, Rhodamine, Cy3, Cy5, Cy5.5, 6-FAM (6-carboxyfluorescein), JOE (6-carboxy-4 ', 5). A kit comprising fluorescent dyes selected from the group '-dichloro-2', 7'-dimethoxyfluorescein), Rhodamine Green, TAMRA NHS (N-hydroxysuccinimide) Ester, and Texas Red. The process according to claim 1, wherein the aldehyde is composed of aldehyde, thioisocyanate, or carboxyl-activated glass slide, or an epoxy-activated plastic ( Dystrophin gene mutation differential diagnosis chip consisting of chips made of plastic or gold film. The method according to claim 1, wherein the deletion, duplication, and point mutation analysis results of whole dystrophin exons using a dystrophin gene mutation differential diagnosis chip are integrated with serum creatine kinase levels, family history, and biopsy results. To screen for Duchenne / Becker-type muscular dystrophy. 6. The prenatal diagnosis kit according to claim 1, wherein the Duschen / Becker type muscle dysplasia comprises a dystrophin gene mutation differential diagnosis chip. 7.

Images