CN103789436A

CN103789436A - Artificial modified primer-based quantitative mutation detecting system

Info

Publication number: CN103789436A
Application number: CN201410044150.2A
Authority: CN
Inventors: 不公告发明人
Original assignee: Faith Bo Auk Biological Information Technology (beijing) Co Ltd
Current assignee: Guangxi Yuanyuan Medical Laboratory Co., Ltd.
Priority date: 2014-01-30
Filing date: 2014-01-30
Publication date: 2014-05-14
Anticipated expiration: 2034-01-30
Also published as: CN103789436B

Abstract

The invention belongs to the field of the biotechnology, and particularly relates to the detection of gene mutation. The invention provides an artificial modified primer-based quantitative mutation detecting system. The quantitative mutation detecting system mainly comprises three steps of primer designing, PCR (polymerase chain reaction) and product detecting. One or more artificial mutation(s) is/ are introduced into a region of 5 basic groups at 3'end of the primer, and a certain, but not too high, stability is guaranteed during the DNA polymerase combination by adjusting the combining thermodynamic property between the 3'end primer and a template, so that the false positive can be reduced, and the selectivity can be observably improved; the fluorescence is added at the 5'end of the primer, and a PCR product is detected by the fluorescence capillary electrophoresis jointly, so that the selectivity can be further improved, and the semi-quantitative analysis of sample mutation can be realized.

Description

A kind of quantitative sudden change detection system based on manually modified primer

Technical field

The invention belongs to biological technical field.More specifically, the present invention relates to the detection of transgenation.

Background technology

Along with the develop rapidly of sequencing technologies, the mankind and various animals and plants, microbial genome have been sequenced, and the genomics data of magnanimity have proposed new challenge to the gene functional research in the fields such as medical science, biology, agronomy and forestry.

The change that gene in sudden change phalangeal cell occur.It comprises the caused sudden change of single sequence change, or the insertion of multiple bases, lacks and repeat etc.Along with going deep into of gene and disease association research, the sudden change of Disease-causing gene, medicaments insensitive and tolerance gene detects and has been widely used in the research of disease genesis mechanism.Meanwhile, also make animals and plants breeding stride into the molecular breeding epoch to sport basic molecular genetic marker technique.Because sudden change detects the widespread use in fields such as the research of disease genesis mechanism and animals and plants breeding and genetic improvements, make the accurate rapid gene sudden change detection method of highly sensitive, highly selective receive unprecedented concern.

Technique of gene detection is developed so far of a great variety, there is single stranded conformational isomery Polymorphism Analysis technology (Single-strand conformation polymorphism, SSCP), heterogeneous double-stranded conformational polymorphism analysis (Heteroduplex, HTX), denaturing gradient gel electrophoresis (Denaturing Gradient Get Electrophoresis, DGGE), mispairing cracking process (Dismate cleavage, DC), dhplc analysis (Denaturing high-performance liquid chromatograph, DHPLC), allele specific oligonucleotide hybridization (Allele-Specific Oligonucleotide Hybridization, ASOH), PCR (Polymerase Chain Reaction) sequencing, allele specific amplification (Allelegene-specific Amplification, ASA) etc.But the accurate method for quick that can simultaneously possess highly sensitive, highly selective is also few in number.

At present, using maximum gene testers is PCR sequencing, also claims polymerase chain reaction method.PCR sequencing is to give tacit consent at present " gold standard ".But PCR sequencing susceptibility is lower, can produce larger false positive and false negative to inferior quality or the lower pattern detection of content.PCR primer in PCR sequencing is positioned at both sides, mutational site, normal sequence and mutant nucleotide sequence all can be increased.Due to mutant nucleotide sequence, often proportion is minimum, and in pcr amplification reaction, the thymus nucleic acid of the contained large percentage of template (Deoxyribonucleic acid, DNA) has amplification advantage.Therefore, the selectivity of PCR sequencing is lower, is only 10%-30%.Meanwhile, the method can not be carried out quantitative analysis to the contained sudden change of sample.

Therefore, someone has developed one and has been called amplification refractory mutation system method (Amplification Refractory Mutation System, ARMS), and it is the one of allele specific amplification method (ASA).The principle that ARMS method utilizes 3 ' of PCR primer to hold last bit base could effectively increase with its template DNA complementation, design allele-specific pcr amplification primer.Research shows, the selectivity that ARMS method can detect sudden change bring up to 1%, but DNA sample low for quality or that content is low, and such selectivity is still on the low side.In addition, ARMS method relies on conventional gel electrophoresis or probe hybridization to detect PCR product, for cause the sudden change product that amplification efficiency is lower because samples contg is lower, on electrophoretic band, may not show.Meanwhile, the method can not be carried out quantitatively or semi-quantitative analysis the contained sudden change of sample.

Conventional PCR method and ARMS method all can not solve false-positive problem.First, in DNA replication dna, the nucleic acid that polymerase covers probably has 10 bases, and 6 bases are double-stranded (having primer combination), other 4 bases be will be synthetic template sequence.So these 6 double-stranded bases are exactly the effectively key of combination of polymerase, the space conformation that also can be understood as the combination of primer and template is only polysaccharase in conjunction with the key of also extending.In actual experiment, often there is the situation that 3 ' end mispairing still can be extended.Particularly, 3 ' end mispairing can not stop extension completely, especially in mispairing template (as normal sequence) during with the template of mating completely (mutant nucleotide sequence) large percentage, it is exactly that these primers and template have formed the space conformation that polysaccharase can be identified that false positive often has the reason of generation.For example, in some cases, although 3 ' end is mispairing, because the base combination stability of next-door neighbour's 3 ' end is higher, and then 3 ' end mispairing firmly raw raw " drawing " that should be distant together, produced so-called " closing on " effect.Secondly,, although some is mispairing, it for example, in conjunction with still having quite high stability, " G-G " mispairing.For this two classes situation, general PCR method does not consider that some mispairing is still more stable on thermodynamics, can trigger the situation of PCR extension yet; And ARMS method, the impact of 6 double-stranded base zones below of not considering that primer is combined with template on archaeal dna polymerase binding ability, therefore existing method is not all properly settled false positive problem.

Summary of the invention

The problem existing in order to solve above-mentioned technology, the present invention has introduced artificial mutation and has considered the stability of archaeal dna polymerase, based on this brand-new design of primers theory, a kind of fluorescence retardance round pcr method in conjunction with capillary electrophoresis of adding is provided, can highly sensitive and the highly selective detection by quantitative of suddenling change.

The present invention relates to the quantitative sudden change detection system (Mutation Detection System by Artificial Modified Primers, AMP-MDS) based on manually modified primer, its schematic diagram as shown in Figure 1.

Therefore, the invention provides a kind of method that detects sudden change, described method comprises the steps:

1) for the sudden change that will detect, the combination of design outer primer and inner primer, in the region of 5 bases of described inner primer 3 ' end, from 3 ' to 5 ' direction, introduces artificial mispairing according to thermodynamic stability " height height " or the height phase inter mode of " low height is high " successively;

2) carry out PCR reaction with primer, obtain the product of pairing amplification;

3) described product is carried out to semi-quantitative analysis.

In a specific embodiment, described method comprises the steps:

1) for the sudden change that will detect, design the combination of a pair of outer primer and a pair of inner primer;

Described outer primer be positioned at sudden change both sides, position intron on or across intron;

In opposite directions, 3 ' end is positioned at sudden change position to described two inner primer directions, 3 ' end of an inner primer and normal base complementrity, 3 ' end of another inner primer and the mutating alkali yl complementation of sudden change position;

Respectively with one inner primer of described two outer primers can match and carry out pcr amplification, and they self also can match amplification;

Fluorescence is added in 5 ' end of outer primer, and uses the fluorescence dye of different colours to carry out mark to two inner primers;

The product of described two outer primers pairing amplification and described two outer primers match the length difference of two products of generation with described two inner primers respectively must be more than 5 bp, preferably more than 10 bp, more preferably more than 20 bp;

Mispairing is introduced in region to described inner primer 3 ' end 5 bases reciprocal, and according to the alternate pattern of thermodynamic stability height, principle is as follows in detail:

If 3 ' end mispairing has certain stability, can introduce corresponding mispairing (as shown in Fig. 2 a, b) antepenulatimate and the 5th so;

If 3 ' end mispairing has lower destructiveness to stability, so need further to judge whether introduce mispairing (as shown in Fig. 2 c, d) according to the stability of penultimate base pair;

If 3 ' end mispairing has stronger destructiveness (being less stable) for stability, do not introduce mispairing in antepenulatimate so, but in the time that penultimate is the base pair having compared with stiff stability, make an exception (as shown in Fig. 2 e, f); For example, for this group primer of AGCGA/TCGCT, its thermodynamic stability is: _---_ (" _ " represents low thermodynamic stability, "-" represents high heating power stability), therefore can introduce mispairing in antepenulatimate, its thermodynamic stability changes into: _-_-_, mispairing is also introduced to as alternative primer in fourth from the last position simultaneously, its thermodynamic stability is: _ _ _-_; Here reflect the binding ability power of primer and template with thermodynamic stability height; A little less than low thermodynamic stability refers to primer and template binding ability, built on the sand, for example, contain the AT pairing of two hydrogen bonds, or AC, the mispairing such as AG; High heating power is learned stability and is referred to that primer and template binding ability are strong, more firm, as the CG that contains three hydrogen bonds matches.

Inside and outside primer keeps melting temperature(Tm) as far as possible consistent, for example, differ in 6 degrees Celsius, preferably in 4 degrees Celsius, more preferably in 2 degrees Celsius;

Inside and outside primer GC content is consistent as far as possible, for example, differ in 20%, preferably in 15%, more preferably in 5%;

Inside and outside primer length is consistent as far as possible, for example, differ in 6 nt, preferably within 4 nt;

Self can not form hairpin structure inside and outside primer;

Between inside and outside primer, can not form dimer, non-specific amplification occurs;

2) carry out PCR reaction with the primer of step 1), obtain the product 1 of described two outer primers pairing amplification and described two outer primers and match product 2 and the product 3 of generation with described two inner primers respectively;

3) above-mentioned product is carried out to semi-quantitative analysis by fluorescent capillary electrophoresis tube, wherein meet while all having obvious peak value at product 1, product 2 and product 3, being illustrated in sudden change position has mutating alkali yl; Further the peak value of each peak value and standard substance is carried out to ratio processing, can carry out sxemiquantitative comparison to the content of the content of mutating alkali yl and normal base.

In the present invention, thermodynamic stability height is binding ability power for reflecting primer and template; A little less than low thermodynamic stability refers to primer and template binding ability, built on the sand, for example, contain the AT pairing of two hydrogen bonds, or AC, the mispairing such as AG; High heating power is learned stability and is referred to that primer and template binding ability are strong, more firm, as the CG that contains three hydrogen bonds matches.For example, for this group primer of AGCGA/TCGCT, its thermodynamic stability is: _---_ (" _ " represents low thermodynamic stability, "-" represents high heating power stability), therefore can introduce mispairing in antepenulatimate, its thermodynamic stability changes into: _-_-_, mispairing is also introduced to as alternative primer in fourth from the last position simultaneously, its thermodynamic stability is: _ _ _-_.

Technical superiority of the present invention is as follows:

1) present method, by the technology for detection sudden change of PCR-based, has very high sensitivity, and being low to moderate 5-10 copy can accurately detect.

2) present method, by introducing one or more than one artificial mutation in the region of 5 bases of primer 3 ' end, has guaranteed the stability of archaeal dna polymerase combination on the one hand, and another one aspect has improved again selectivity greatly.

3) by adding fluorescence and detect PCR product by fluorescent capillary electrophoresis tube at primer 5 ' end, further improve selectivity, global selectivity is 10 ^-4-10 ^-5between.

4) outer primer of present method design is positioned at intron region, by adding fluorescence dye, avoid introducing extra probe at primer 5 ' end, has further increased specificity, has reduced false positive rate.

5) present method combined with fluorescent capillary electrophoresis technique, can realize the semi-quantitative analysis to sample sudden change.

6) present method process is simple, only comprises two steps, i.e. PCR process and capillary electrophoresis, and therefore detection speed is fast, and whole process only need be less than 1 hour.

Accompanying drawing explanation

Fig. 1 illustrates: the schematic diagram that the quantitative sudden change based on manually modified primer detects.

Fig. 2 illustrates: 5 base zones of primer 3 ' end are artificially introduced the design of primers schematic diagram of mispairing.

Remove 3 ' and hold the mispairing of last base to design according to mutational site, other mispairing is artificial introducing, introduces mispairing Specific Principles and is:

If 3 ' end mispairing has certain stability, can introduce corresponding mispairing (a, b) antepenulatimate and the 5th so;

If 3 ' end mispairing has lower destructiveness to stability, so need further to judge whether introduce mispairing (c, d) according to the stability of penultimate base pair;

If 3 ' end mispairing has stronger destructiveness for stability, do not advise so introducing mispairing in antepenulatimate, but in the time that penultimate is the base pair having compared with stiff stability, can consider (e, f).

Arrow indicates thermodynamic stability, and long arrow represents high stability base pair, and short arrow represents low stability base pair, x represents mispairing and destroys lower to stability, X represents mispairing and larger to stability destruction, although x and upward arrow thereof represent it is mispairing, but still has certain stability.

Fig. 3 illustrates: the positive and negative findings comparative example figure that capillary electrophoresis detects.

Fig. 4 illustrates: PCR-sequencing sensitivity experiment results peaks figure.

Fig. 5 illustrates: the product electrophorogram example that the quantitative sudden change based on manually modified primer detects.

Fig. 6 illustrates: utilize quantitative sudden change detection method based on manually modified primer to detect respectively the capillary electrophoresis fluorescence peak figure result of people's cancerous lung tissue EGFR gene L858R point mutation standard substance of 0%, 0.02%, 0.2%, 2%, 10%, 20%, 50% and 100%.

Fig. 7 illustrates: the accuracy rate that the L858R sudden change that utilizes PCR sequencing, AMRS method, AMP-MDS method to carry out EGFR gene detects.

Embodiment

The present invention relates to a kind of quantitative sudden change detection system (Mutation Detection System by Artificial Modified Primers, AMP-MDS) based on manually modified primer.For the 3 ' impact of end on archaeal dna polymerase combination of reasonably estimating that primer is combined with template, take into account stability and specificity, our emphasis is considered to introduce mispairing in the region of 5 bases of 3 ' end, guarantee that necessary stability is beneficial to archaeal dna polymerase combination on the one hand, what DNA was combined with to material impact is 6 bases of 3 ' end.Here adopt conservative way, get 5 bases and carry out manual intervention; On the other hand, according to pairing particular case, suitably introduce mispairing, avoid the 3 ' false positive results that end causes that causes stability too high.Compare with traditional method, the innovation of method of the present invention is to hold the region of 5 bases according to one alternate of pattern introducing of thermodynamic stability height or the design of primers theory of more than one artificial mutation at primer 3 ', both consider the also stable fact of some mispairing, also considered the impact on archaeal dna polymerase; Last and combine capillary electrophoresis technique, making it can highly sensitive and the highly selective detection by quantitative of suddenling change.

Goal of the invention relates generally to following 6 points:

1) present method detects the design of primers of sudden change.

For sudden change, present method designs a pair of inner primer and a pair of outer primer, and wherein 3 ' of inner primer end is positioned at sudden change position, 3 ' end of an inner primer and normal base complementrity, 3 ' end and mutating alkali yl complementation of another inner primer; Outer primer is positioned at catastrophe point both sides, and respectively with one inner primer can match and carry out pcr amplification, and they self also can match amplification.For, the amplified production of sudden change, only needs the length difference that guarantees three products more than base can analyze by capillary electrophoresis at 5.

2) present method is by improving selectivity in one of region introducing or the more than one artificial mutation of 5 bases of primer 3 ' end.

For the inner primer of sudden change, present method is added artificial mispairing in the region of 5 bases of its 3 ' end, compares with the mispairing in ARMS technology, and present method is incorporated into mispairing except penultimate, is also incorporated into antepenulatimate, the 4th, even the 5th; And base mismatch number is not confined to 2, even can reach three or four.The principle of introducing base mismatch is according to the alternate pattern of thermodynamic stability height, avoid the region of 5 bases of 3 ' end to occur stronger thermodynamic stability, make it to remain on lower, but more uniform thermodynamics level, thereby prevent the 3 ' end that combination stability is stronger, avoid non-specific amplification (being false positive).

3) present method, by adding fluorescence and detect PCR product by fluorescent capillary electrophoresis tube at primer 5 ' end, further improves selectivity.

For sudden change, fluorescence is added in 5 ' end of outer primer, and uses the fluorescence dye that shows different colours to carry out mark to two outer primers.Because fluorescent capillary electrophoresis tube is to detect by the accumulation to fluorescent signal, even if the mutant DNA content therefore in sample is less, in pcr amplification, also in competitive disadvantages, and the content of PCR product is also relatively low, and fluorescent capillary electrophoresis tube still can accurately detect.

4) present method, by adding fluorescence dye, avoid introducing extra probe at primer 5 ' end, has further reduced false positive rate.

Compare with common fluorescent quantitative PCR technique, hold because the fluorescence in present method is added in 5 ' of primer, there is no extra probe, therefore compare the step of also having avoided hybridization with traditional method, reduced false-positive risk.

Can be by interior target fluorescence intensity in the fluorescence intensity of mutant DNA relatively and fluorescent capillary electrophoresis tube, calculate one without scale, can lateral comparison scale parameter, carry out sxemiquantitative description for the sudden change content to sample.

6) present method, by the position of design outer primer, can prevent the pollution of transcript to pcr amplification product.

In present method, outer primer designs on intron or across an intron, thereby has avoided the interference of transcription product for PCR product, has further reduced false-positive risk.

The schematic diagram of AMP-MDS as shown in Figure 1.

The invention provides a kind of method that detects sudden change, described method comprises step:

In opposite directions, 3 ' end is positioned at sudden change position to described two inner primer directions, 3 ' end of an inner primer and normal base complementrity, 3 ' end and mutating alkali yl complementation of another inner primer;

Respectively with one inner primer of described 2 outer primers can match and carry out pcr amplification, and they self also can match amplification;

Fluorescence is added in 5 ' end of outer primer, and two outer primers use the fluorescence dye of different Show Colors;

The product of described two outer primers pairing amplification and described two outer primers match the length difference of two products of generation with described two inner primers respectively must be more than 5bp;

If 3 ' end mispairing has stronger destructiveness for stability, do not introduce mispairing in antepenulatimate so, but in the time that penultimate is the base pair having compared with stiff stability, make an exception (as shown in Fig. 2 e, f);

For example, AGCGA/TCGCT, this group primer, its thermodynamic stability is: _---_ (" _ " represents low thermodynamic stability, "-" represents high heating power stability), therefore can introduce mispairing in antepenulatimate, its thermodynamic stability changes into: _-_-_, mispairing is also introduced to as alternative primer in fourth from the last position, its thermodynamic stability is simultaneously: _ _ _-_;

Inside and outside primer keeps melting temperature(Tm) as far as possible consistent, for example, differ in 6 degrees Celsius;

Inside and outside primer GC content is consistent as far as possible, for example, differ in 20%;

Inside and outside primer length is consistent as far as possible, for example, differ in 6 nt;

Self can not form hairpin structure inside and outside primer;

2) PCR reaction

Primer with step 1 carries out PCR reaction, obtains the product of described two outer primers pairing amplification and described two outer primers and matches the product of generation with described two inner primers respectively;

For example, reaction system and the reaction conditions of PCR reaction are as follows:

Reaction system

Reaction system	Reaction conditions
		RTaq enzyme	2.5 μl
10 × damping fluid	5 μl
		dNTP-MIX	200 μmol/L
MgCl ₂	1.5-2.0 mmol/L
		Outer primer	Each 1 μ l
Methane amide
		1 μl
Inner primer			Each 1 μ l
	Water	Supply system
DMSO
		1 μl
Template
		1 μl
Total system			50 μl

Reaction conditions:

PCR reaction conditions is:

95 ℃ of denaturations 5 minutes;

95 ℃ of sex change 30 seconds, 60 ℃ of annealing 30 seconds, 72 ℃ are extended 30 seconds, 10 circulations;

95 ℃ of sex change 15 seconds, 69 ℃ of annealing 15 seconds, 72 ℃ are extended 15 seconds, 25 circulations;

Finally extend 7 minutes.

3) product detects

Above-mentioned product is carried out to semi-quantitative analysis by fluorescent capillary electrophoresis tube.

In one embodiment, described semi-quantitative analysis is specially STR and detects, be STR (Short Tandem Repeat, STR) analysis platform, for a kind of technique means of genetic material difference between working sample (STR difference).STR (STR) detects STR and claims again microsatellite DNA (micro-satellite DNA).

Concrete steps are as follows:

(1) mix in the ratio of 1:13130 with methane amide with ABI GS500LIZ.

(2) mixing liquid is taken out after 9 μ l, add testing sample 0.5 μ l.

(3) on ABI3730 sequenator, carry out capillary electrophoresis detection, obtain corresponding glue figure and peak figure.

Below in conjunction with the embodiment of the present invention and accompanying drawing, the present invention is further detailed.

Embodiment mono-, detects the single mutation in the paraffin-embedded tissue pathological slice tissue of nonsmall-cell lung cancer.In the present embodiment with technical project of the present invention series primer, and detect EGFR gene, the i.e. transgenation in 21 exons the 858th mutational site of EGF-R ELISA (Epidermal Growth Factor Receptor) in sample in conjunction with capillary electrophoresis.

Experiment material is as follows:

Reagent	Manufacturer
		RTaq enzyme	TAKALA (precious biological) company
10 × damping fluid	TAKALA (precious biological) company
		dNTP-MIX	TAKALA (precious biological) company
MgCl ₂	TAKALA (precious biological) company
		Primer is synthetic	Beijing Qing Kexin industry Bioisystech Co., Ltd
Methane amide	SIGMA company of the U.S.
		DMSO	SIGMA company of the U.S.
Proteinase K	QIAGEN company
		QIAamp MinElute post	QIAGEN company
AW1, AW2, ATL etc.	QIAGEN company

Sample and reference standards preparation process are as follows:

1. detect sample

The paraffin-embedded pathological section of process that is derived from hospital pathology department, is put into tissue slice to dye in sheet cylinder, adds dimethylbenzene fully to soak 2 hours, with alcohol rinsing 2 times, adds 100% alcohol immersion 10 minutes, dries.The tissue slice drying is kept flat on experiment table and fixed, with careful tissue is peeled off from slide of flat scraper, rapidly tissue sample is put into 1.5 ml EP pipes and built lid.Add 180 μ l ATL damping fluids and 20 μ l Proteinase Ks, fully mix with oscillator, mixture is put into 56 ℃ of digestion of water-bath 60 minutes.Postdigestive mixture is put into 90 ℃ of digestion of water-bath 60 minutes.Add 200 μ l AL damping fluids fully to mix; add again 200 μ l 100% ethanol to mix; biased sample is put into QIAamp MinElute column; centrifugal 2 min of 8000 rpm; then respectively with 500 μ l Buffer AW1 and the 500 μ l Buffer AW2 centrifugal 1 min wash-out of 6000 × g (8000 rpm) respectively, last 20000 × g; 14000 rpm are centrifugal, and 3 min dry, and add 100 μ l ATE20000 × g; After the centrifugal 1 min wash-out of 14000 rpm, collect eluting liquid and carry out DNA quality evalution.

2. the preparation of reference standards

EGFR gene 21 exons the 858th mutational site gene wild-type and the mutator gene sequence announced according to Cosmic database compare analysis, direct labor's synthetic standards sequence SEQ ID NO.1:

5-GCAGCGGGTTACATCTTCTTTCATGCGCCTttccattctttggatcagtagtca ctaacgttcgccagccataagtcctcgacgtggagaggctcagagcctGGCATGAA CTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCCAGGAACGTACTGG TGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGC kgGCCAAACTGCTGGGTGCGGAAGAGAAAGA ATA CCATGCAGAAGGAGGCAAAGTAAGGAGGTGGCT-3, wherein K is t(wild-type) or G(sudden change)

3. design of primers

Inner Fp1 CGCAGCATGTCAAGATCACAGATTTTGGGC T（SEQ ID NO.2 ）

Inner Rp1 CTTTCTCTTCCGCACCCAGCAGTTTGGCC C（SEQ ID NO.3 ）

Inner Fp2 CGCAGCATGTCAAGATCACAGATTTTGGG TT（SEQ ID NO.4 ）

Inner Rp2 CTTTCTCTTCCGCACCCAGCAGTTTGGC TC（SEQ ID NO.5 ）

Inner Fp3 CGCAGCATGTCAAGATCACAGATTTTGG ACT（SEQ ID NO.6 ）

Inner Rp3 CTTTCTCTTCCGCACCCAGCAGTTTGG TCC（SEQ ID NO.7 ）

Inner4 Fp CGCAGCATGTCAAGATCACAGATTTTG GATT（SEQ ID NO.8 ）

Inner4 Rp CTTTCTCTTCCGCACCCAGCAGTTTG GTTC（SEQ ID NO.9 ）

Inner5 Fp CATGTCAAGATCACAGATTTT GGATT（SEQ ID NO.10 ）

Inner5 Rp TCTTCCGCACCCAGCAGTTT GGTTC（SEQ ID NO.11 ）

Outer Fp GCAGCGGGTTACATCTTCTTTCATGCGCCT （SEQ ID NO.12 ）

Outer Rp AGCCACCTCCTTACTTTGCCTCCTTCTGCA(fluorescent mark) (sEQ ID NO.13 )

4. pcr amplification

PCR reaction system is as follows:

Reaction system	Reaction conditions
		RTaq enzyme	2.5 μl
10 × damping fluid	5 μl
		dNTP-MIX	200 μmol/L
MgCl ₂	1.5-2.0 mmol/L
		Outer primer	Each 1 μ l
Methane amide
		1 μl
Inner primer is each			1 μl
	Water	Supply system
DMSO
		1 μl
Template
		1 μl
Total system			50 μl

PCR reaction conditions is: 95 ℃ of denaturations 5 minutes;

Finally extend 7 minutes.

5. detect

Utilize gs500 to detect the goal gene with fluorescence in PCR result.

6. specificity analyses

Using the positive of synthesizing, negative DNA as template detection target fragment contrast experiment, result as shown in Figure 3.

7. sensitivity experiment

Positive and the feminine gender of sample is 1:X shown below according to 1:0,0:1,1:1,1:4,1:50,1:500 and 1:5000(respectively) amount ratio mix, and to make to mix rear cumulative volume be 100 μ l.Volume required according to concentration calculating, process is as follows:

C ₁V ₁:C ₂V ₂=1:X；

V ₁+V ₂=100；

Comprehensive above two equations draw V ₁=200C ₂/ (XC ₁+ C ₂), V ₂=100-V ₁.

Having recorded each sample concentration is C ₁=33 ng/ μ l, C ₂=41.95 ng/ μ l.

Automatically calculate the V under each X correspondence with Excel software ₁and V ₂.Obtain fresh sample 1 to No. 7.

Mixed ratio	X	V ₁	V ₂	Send and survey numbering
					1 former state		100	0	1
2 former states		0	100	2
					50.00%	1	55.97	44.03	3
20.00%	4	24.12	75.88	4
					1.96%	50	2.4794	97.521	5
0.20%	500	0.2536	99.746	6
					0.02%	5000	0.02542	99.975	7

Biased sample is identified in order-checking, and result as shown in Figure 4.

Different inner primer design fluorescent capillary electrophoresis tube detection sensitivity experimental results are as following table.

The segment of not suddenling change

Sudden change segment

50% sudden change

20% sudden change

10% sudden change

2% sudden change

0.2% sudden change

0.02% sudden change

Inner primer design 1

+

Inner primer design 2

--

+

Inner primer design 3

--

+

+ -

+

8. selectivity experiment

1) electrophoresis observed result as shown in Figure 5.

2) capillary detection result as shown in Figure 6.

By to interpretation of result: it is very good that the positive and feminine gender of sample is mixed application the inventive method detection selectivity according to 1:0,0:1,1:1,1:4,1:50,1:500 and 1:5000 ratio respectively.

9. repeatability and accuracy rate

1) standard substance carry out 10 experiments, repeatability and rate of accuracy reached 100%.

2) choose the routine traditional sequencing of clinical pathology 100 and the inventive method and compare, this experimental technique detection sensitivity, accuracy rate are obviously better than traditional sequencing, have greatly lowered the false negative rate of traditional sequencing.

10. detect odds ratio

We have chosen the clinical case of 10 routine Patients with Non-small-cell Lungs, and the L858R sudden change that utilizes respectively PCR sequencing, AMRS method and our AMP-MDS method to carry out EGFR gene detects and compares, and comparative result sees table.As shown in Figure 7, the accuracy rate of AMP-MDS method is the highest, reaches 100%, and false positive rate is better than ARMS method greatly, and false negative rate is better than PCR sequencing greatly.

Figure 2014100441502100002DEST_PATH_IMAGE002

Note: CR: alleviate PR completely: partial rcsponse, SD: stable, PD: progress.

<110> thinks to win AudioCodes bioinformation science and technology (Beijing) company limited

Mono-kind of the <120> quantitative sudden change detection system based on manually modified primer

<130> 20140120

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 272

<212> DNA

<213> artificial sequence

<220>

<221> misc_feature

<222> (206)..(206)

<223> k is g or t

<400> 1

gcagcgggtt acatcttctt tcatgcgcct ttccattctt tggatcagta gtcactaacg 60

ttcgccagcc ataagtcctc gacgtggaga ggctcagagc ctggcatgaa ctacttggag 120

gaccgtcgct tggtgcaccg cgacctggca gccaggaacg tactggtgaa aacaccgcag 180

catgtcaaga tcacagattt tgggckggcc aaactgctgg gtgcggaaga gaaagaatac 240

catgcagaag gaggcaaagt aaggaggtgg ct 272

<210> 2

<211> 31

<212> DNA

<213> artificial sequence

<400> 2

cgcagcatgt caagatcaca gattttgggc t 31

<210> 3

<211> 30

<212> DNA

<213> artificial sequence

<400> 3

ctttctcttc cgcacccagc agtttggccc 30

<210> 4

<211> 31

<212> DNA

<213> artificial sequence

<400> 4

cgcagcatgt caagatcaca gattttgggt t 31

<210> 5

<211> 30

<212> DNA

<213> artificial sequence

<400> 5

ctttctcttc cgcacccagc agtttggctc 30

<210> 6

<211> 31

<212> DNA

<213> artificial sequence

<400> 6

cgcagcatgt caagatcaca gattttggac t 31

<210> 7

<211> 30

<212> DNA

<213> artificial sequence

<400> 7

ctttctcttc cgcacccagc agtttggtcc 30

<210> 8

<211> 31

<212> DNA

<213> artificial sequence

<400> 8

cgcagcatgt caagatcaca gattttggat t 31

<210> 9

<211> 30

<212> DNA

<213> artificial sequence

<400> 9

ctttctcttc cgcacccagc agtttggttc 30

<210> 10

<211> 26

<212> DNA

<213> artificial sequence

<400> 10

catgtcaaga tcacagattt tggatt 26

<210> 11

<211> 25

<212> DNA

<213> artificial sequence

<400> 11

tcttccgcac ccagcagttt ggttc 25

<210> 12

<211> 30

<212> DNA

<213> artificial sequence

<400> 12

gcagcgggtt acatcttctt tcatgcgcct 30

<210> 13

<211> 30

<212> DNA

<213> artificial sequence

<400> 13

agccacctcc ttactttgcc tccttctgca 30

Claims

1. for detection of a method for sudden change, described method comprises the steps:

3) described product is carried out to semi-quantitative analysis.

2. according to the method for claim 1, introduce a kind of method that detects sudden change, described method comprises step:

1), for the sudden change that will detect, design the combination of a pair of outer primer and a pair of inner primer;

Fluorescence is added in 5 ' end of outer primer, and two outer primers use the fluorescence dye that shows different colours to carry out mark;

The product of described two outer primers pairing amplification and described two outer primers match the length difference of two products of generation with described two inner primers respectively must be more than 5 bp;

If 3 ' end mispairing has certain stability, so in antepenulatimate and the 5th the corresponding mispairing of introducing;

If 3 ' end mispairing has lower destructiveness to stability, so need further to judge whether introduce mispairing according to the stability of penultimate base pair;

If 3 ' end mispairing has stronger destructiveness for stability, do not introduce mispairing in antepenulatimate so, but make an exception in the time that penultimate is the base pair having compared with stiff stability;

Inside and outside primer melting temperature(Tm) differs in 6 degrees Celsius;

Inside and outside primer GC content differs in 20%;

Inside and outside primer length differs in 6 nt;

Self can not form hairpin structure inside and outside primer;

3. the method for claim 2, wherein said outer primer length is 28 ± 3 nt, described inner primer length is 28 ± 3 nt.

4. the method for claim 2, the fluorescence dye of the wherein said 5 ' end that is added in outer primer is HEX and FAM.

5. the method for claim 2, wherein said semi-quantitative analysis is specially STR (STR) analysis platform based on ABI3730xl system.

6. the method for claim 2, wherein said sudden change is EGFR gene 21 exons the 858th mutational sites, and described inner primer is respectively Inner Fp1-5 and Inner Rp1-5, and described outer primer is respectively Outer Fp and Outer Rp.

7. the method for claim 2, wherein said inside and outside primer melting temperature(Tm) differs in 4 degrees Celsius, preferably in 2 degrees Celsius.

8. the method for claim 2, wherein said inside and outside primer GC content differs in 15%, preferably in 5%.

9. the method for claim 2, wherein said inside and outside primer length differs in 4 nt.