CN109576386B - Primer composition for identifying intestinal microecological state and application thereof - Google Patents
Primer composition for identifying intestinal microecological state and application thereof Download PDFInfo
- Publication number
- CN109576386B CN109576386B CN201910087568.4A CN201910087568A CN109576386B CN 109576386 B CN109576386 B CN 109576386B CN 201910087568 A CN201910087568 A CN 201910087568A CN 109576386 B CN109576386 B CN 109576386B
- Authority
- CN
- China
- Prior art keywords
- seq
- intestinal
- kit
- bacteria
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer composition for identifying the microecological state of intestinal tract and application thereof, wherein the primer composition is a specific primer designed aiming at 16S rRNA of intestinal bacteria, the specific primer comprises random bases, and the number of the random bases is 3-5; the intestinal bacteria comprise any one or combination of at least two of clostridium symbiosum, bifidobacterium adolescentis, fusobacterium nucleatum, streptococcus anaerobicus or klebsiella. The kit developed based on the primer composition has the specificity of detecting intestinal microecological imbalance as high as 92.5 percent and the sensitivity as high as 80.43 percent.
Description
Technical Field
The invention belongs to the technical field of biology, relates to a primer composition and application thereof, mainly relates to a primer composition for identifying the intestinal microecological state and application thereof, and particularly relates to a primer composition for identifying the intestinal microecological state and a kit prepared from the primer composition.
Background
In recent years, the incidence rate of intestinal diseases is rising, early symptoms of the intestinal diseases are not obvious, an effective screening method is lacked, and finally, the intestinal diseases are likely to develop into cancers. In the prior art, the examination and screening of intestinal diseases are mainly carried out by preliminarily screening high risk groups through fecal occult blood experiments and then carrying out enteroscopy. However, fecal occult blood experiments lack specificity, the primary screening compliance and the enteroscope detection rate of high risk groups are only 30-40%, and the disease detection rate is about 19%, which needs to be further improved. The noninvasive markers are used for screening the population, the enteroscopy number can be reduced, the specificity and sensitivity of the enteroscopy are further improved, and the method has important clinical significance for early screening of intestinal diseases.
A large number of flora exist in intestinal tracts of people, beneficial bacteria and conditional pathogenic bacteria coexist, the beneficial bacteria in the healthy people are dominant, and the number of the flora is maintained in a balanced steady state; however, in a human body with intestinal diseases, the internal environment changes, so that flora imbalance is caused, and the number of conditional pathogenic bacteria is obviously increased, so that early warning can be given to the intestinal diseases by identifying the flora microecology in the intestinal tract.
CN108690864A discloses a calculation method of flora balance relation indexes in individual fecal samples and application thereof in colorectal cancer (CRC) screening, diagnosis or auxiliary diagnosis. The characteristics of the types and the numbers of the bacteria are obtained by extracting DNA sequencing of the bacteria in the feces, and the diagnosis of CRC is carried out on the basis of the number ratio characteristics of various bacteria. Compared with the method for screening CRC in a non-invasive way, which is used in clinic or applied for patent at present, the invention has the advantages of complete non-invasive and more accurate CRC diagnosis. The analysis result shows that the ratio of the number of fusobacterium nucleatum Fn to the number of bifidobacterium Bb (Fn/Bb) has higher sensitivity and specificity for screening CRC, and reaches 84.6% and 92.3%, respectively (AUC ═ 0.911). Further combining the ratio of the number of F n of F.nucleatum to the number of Fp of C.tenella (Fn/Fp) improves the diagnostic value of CRC, and the area under the curve of the working characteristic curve of the subject reaches 0.943. In addition, joint screening for stage I CRC with Fn/Bb and Fn/Fp quantitative ratios has a specificity of 60% and a sensitivity of 90%. However, this method is complicated in operation and low in detection sensitivity.
CN105803061A discloses an application of a reagent for detecting clostridium symbiosum in the preparation of an early colorectal cancer diagnostic kit. The kit obtains the relative abundance characteristic of the clostridium symbiosum by extracting DNA of bacteria in feces and carrying out quantitative polymerase chain reaction, and diagnoses early colorectal cancer (colon cancer and rectal cancer limited to submucosa) based on the characteristic. The method is completely noninvasive, relatively simple and cheap in operation, and capable of predicting and diagnosing the colorectal cancer more accurately, and the area under the ROC curve (AUC value) is more than 0.70. However, the method has strong limitation and cannot predict the overall condition of intestinal microecology.
Therefore, the primer composition for identifying the intestinal microecological state, which is high in efficiency, convenience and sensitivity, has important significance and wide application prospect.
Disclosure of Invention
Aiming at the defects and actual requirements of the prior art, the primer composition provided by the invention comprises specific primers aiming at five specific microorganisms, the specificity of the primers is obviously enhanced by adding random bases, the identification effect of the primer composition on microecological flora is improved, and the primer composition has important significance and wide application prospect.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a primer composition for identifying intestinal microecological state, wherein the primer composition is a specific primer designed for 16S rRNA of intestinal bacteria, the specific primer comprises random bases, and the number of the random bases is 3-5; the intestinal bacteria comprise any one or combination of at least two of clostridium symbiosum, bifidobacterium adolescentis, fusobacterium nucleatum, streptococcus anaerobicus or klebsiella.
The primer composition provided by the invention is used for designing a specific primer aiming at 16S rRNA of specific intestinal bacteria, and the number of random bases is regulated and controlled by adding random bases, so that the detection specificity is improved, and the intestinal microecological state is efficiently and conveniently identified.
Preferably, the enteric bacteria are clostridium symbiosum, bifidobacterium adolescentis, fusobacterium nucleatum, streptococcus anaerobicus, and klebsiella.
In the invention, sequencing analysis on a large number of normal samples and intestinal microecological imbalance samples shows that clostridium symbiosum, bifidobacterium adolescentis, fusobacterium nucleatum, streptococcus anaerobicus and klebsiella are obviously related to intestinal microecology, so that the clostridium symbiosum, the bifidobacterium adolescentis, the streptococcus anaerobicus and the klebsiella are taken as co-detection strains, and the detection specificity and sensitivity are obviously improved.
Preferably, the primer combination also comprises a total bacteria detection primer designed aiming at the 16S rRNA V3-V4 region of the 5 microorganisms.
The 16S rRNA sequence of the microorganism comprises 9 variable regions and 10 highly conserved regions, in order to ensure the specificity of the primers, the primers are designed in the conserved regions, and compared with other variable regions, the V3-V4 regions can cover more than 98 percent of bacteria, and the length of the amplification product of the V3-V4 regions meets the length requirement of qPCR on the expected product of the primers; under the condition, a pair of primers meeting the requirements is designed and obtained, the total amount of all microorganisms in the excrement sample can be identified, and then the relative content of the 5 kinds of biomarker bacteria is determined.
Preferably, the primer length of the primer composition is 18-25bp, for example, 18bp, 19bp, 20bp, 21bp, 22bp, 23bp, 24bp or 25bp, preferably 20 bp.
Preferably, the GC content of the primer composition is 50-60%, for example, it may be 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%.
Preferably, the primer composition has a Tm value of 58-63 ℃ and may be, for example, 58 ℃, 59 ℃, 60 ℃, 61 ℃, 62 ℃ or 63 ℃, preferably 60 ℃.
Preferably, the nucleotide sequence of the specific primer pair of the clostridium symbiosum is shown as SEQ ID No.1-8, and the specific sequence is as follows:
clostridium symbiosum C-P1F (SEQ ID NO. 1): CGGCATTGAATTGACTGAGTGGCGGA are provided.
Clostridium symbiosum C-P1R (SEQ ID NO. 2): CCATCTTGTACCACCGGAGTTAGAT are provided.
Clostridium symbiosum C-P2F (SEQ ID NO. 3): AGTTGAATTGACTGAGTGGCGGAGC are provided.
Clostridium symbiosum C-P2R (SEQ ID NO. 4): TAACGCCATCTTGTACCACCGGAGT are provided.
Clostridium symbiosum C-P3F (SEQ ID NO. 5): GCCATTGAATTGACTGAGTGGCGGA are provided.
Clostridium symbiosum C-P3R (SEQ ID NO. 6): ATCCATCTTGTACCACCGGAGTCCG are provided.
Clostridium symbiosum C-P4F (SEQ ID NO. 7): AGTTTGAATTGACTGAGTGGCGGA are provided.
Clostridium symbiosum C-P4R (SEQ ID NO. 8): GGCCATCTTGTACCACCGGAGTATT are provided.
Preferably, the nucleotide sequence of the specific primer pair of bifidobacterium adolescentis is shown as SEQ ID No.9-16, and the specific sequence is as follows:
bifidobacterium adolescentis B-P1F (SEQ ID NO. 9): GGTCAGGATGTTGTCGGAAGCCATT are provided.
Bifidobacterium adolescentis B-P1R (SEQ ID NO. 10): ACTTCATTCAACGCCGACTTCGATA are provided.
Bifidobacterium adolescentis B-P2F (SEQ ID NO. 11): TTCCTCAGGATGTTGTCGGAAGCCC are provided.
Bifidobacterium adolescentis B-P2R (SEQ ID NO. 12): AGCCATTCAACGCCGACTTCGAT are provided.
Bifidobacterium adolescentis B-P3F (SEQ ID NO. 13): GGTCTCAGGATGTTGTCGGAAGCC are provided.
Bifidobacterium adolescentis B-P3R (SEQ ID No. 14): AAGTCATTCAACGCCGACTTCGAT are provided.
Bifidobacterium adolescentis B-P4F (SEQ ID NO. 15): CGTATCAGGATGTTGTCGGAAGCC are provided.
Bifidobacterium adolescentis B-P4R (SEQ ID NO. 16): GTCCATTCAACGCCGACTTCGAT are provided.
Preferably, the nucleotide sequence of the specific primer pair of the fusobacterium nucleatum is shown in SEQ ID NO.17-22, and the specific sequence is as follows:
F-P1F (SEQ ID NO. 17): CCTCTTAGGAATGAGACAGAGATG are provided.
F-P1R (SEQ ID NO. 18): ATTGATGGTAACATACGAAAGGGCC are provided.
F-P2F (SEQ ID NO. 19): TTCACTTAGGAATGAGACAGAGATG are provided.
F-P2R (SEQ ID NO. 20): TGATGGTAACATACGAAAGGCATG are provided.
F-P3F (SEQ ID NO. 21): TGGACTTAGGAATGAGACAGAGATG are provided.
F-P3R (SEQ ID NO. 22): ACCTGATGGTAACATACGAAAGGT are provided.
Preferably, the nucleotide sequence of the specific primer pair of the streptococcus anaerobicus is shown in SEQ ID No.23-28, and the specific sequence is as follows:
anaerobic digestion of Streptococcus sp-P1F (SEQ ID NO. 23): TGACTGACGATCAGTAGCCGACCTG are provided.
Anaerobic digestion of Streptococcus sp-P1R (SEQ ID NO. 24): ACTTGAAAGACCACCTACGCACC are provided.
Anaerobic digestion of Streptococcus sp-P2F (SEQ ID NO. 25): GACGATCAGTAGCCGACCTGTGG are provided.
Anaerobic digestion of Streptococcus sp-P2R (SEQ ID NO. 26): AACTGAAAGACCACCTACGCACC are provided.
Anaerobic digestion of Streptococcus sp-P3F (SEQ ID NO. 27): CCGGACGATCAGTAGCCGACCTG are provided.
Anaerobic digestion of Streptococcus sp-P3R (SEQ ID NO. 28): TTGTGAAAGACCACCTACGCACC are provided.
Preferably, the nucleotide sequence of the specific primer pair of the Klebsiella is shown as SEQ ID NO.29-36, and the specific sequence is as follows:
klebsiella K-P1F (SEQ ID NO. 29): CCGATTACGACCAGGGCTACAC are provided.
Klebsiella K-P1R (SEQ ID NO. 30): GGGAACGTATTCACCGTACCTA are provided.
Klebsiella K-P2F (SEQ ID NO. 31): GCATTACGACCAGGGCTACACT are provided.
Klebsiella K-P2R (SEQ ID NO. 32): ACTGGGAACGTATTCACCGTAG are provided.
Klebsiella K-P3F (SEQ ID NO. 33): TTGCTTACGACCAGGGCTACAC are provided.
Klebsiella K-P3R (SEQ ID NO. 34): AGTGGGAACGTATTCACCGTA are provided.
Klebsiella K-P4F (SEQ ID NO. 35): CTGATTACGACCAGGGCTACAC are provided.
Klebsiella K-P4R (SEQ ID NO. 36): AACGGGAACGTATTCACCGTAT are provided.
Preferably, the nucleotide sequence of the total bacteria detection primer pair is shown as SEQ ID NO.37-42, and the specific sequence is as follows:
total bacteria assay T-P1F (SEQ ID NO. 37): TCCGTGSTGCAYGGYTGTCGTCAG are provided.
Total bacteria were tested for T-P1R (SEQ ID NO. 38: AGGTACGTCRTCCMCACCTTCCTC.
Total bacteria assay T-P1F (SEQ ID NO. 39): CCTTGTGSTGCAYGGYTGTCGTCA are provided.
Total bacteria were tested for T-P1R (SEQ ID NO. 40: ATCCACGTCRTCCMCACCTTCCTC.
Total bacteria assay T-P1F (SEQ ID NO. 41): GTGSTGCAYGGYTGTCGTCATGGAC are provided.
Total bacteria were tested for T-P1R (SEQ ID NO. 42: CTGGACGTCRTCCMCACCTTCCTCT.
The invention provides different specific primer pairs aiming at 5 intestinal bacteria respectively, and any primer pair can realize the detection of the corresponding bacteria.
In a second aspect, the present invention provides a kit for identifying gut microbiota, said kit comprising any one or a combination of at least two pairs of primers of the primer composition according to the first aspect.
Preferably, the kit further comprises an amplification octal-tube, and the octal-tube is pre-filled with PCR premix for detecting different bacteria and total bacteria.
In the invention, the optimal PCR reaction solution respectively aiming at different bacteria and total bacteria detection is subpackaged in the eight-connected tubes of the kit, when the kit is used, an operator only needs to add the extracted fecal sample genome template into the reaction tubes according to the specification amount to carry out PCR amplification reaction, so that the process of respectively adding samples is saved, the error caused by operation is reduced, the time cost is saved, and the sensitivity and the accuracy of the detection result are ensured.
Preferably, the premix comprises a PCR reaction solution and corresponding primers.
Preferably, the reaction solution comprises Tris-HCl, ammonium sulfate, MgCl2And dNTPs.
The optimal reaction systems corresponding to different primers will be slightly different, and the reaction system is selected at will, and the phenomenon of amplification failure is likely to occur, specifically including that the amplification band is not single, no amplification band is generated, or the amplification band is single but the fragment length is different from the expected one. The premix of the present invention is prepared by preliminarily mixing Tris-HCl, ammonium sulfate and MgCl2dNTPs and corresponding primers are mixed, and the reaction liquid components in each reaction hole are adjusted according to the characteristics of bacterial primers to ensure that the reaction liquid components are subjected to the same PCR programThe detection reaction can be successful, the time cost is greatly reduced, and the detection efficiency is improved.
Preferably, the octuple further comprises a negative quality control and a positive quality control.
In the invention, the other two eight-connected tubes respectively correspond to a negative quality control system and a positive quality control system, the negative quality control system comprises a reaction solution and a total bacteria detection primer, a template is sterile water, and the negative quality control is used for detecting whether the test environment is polluted or not and eliminating false positive results; the positive quality control system contains Mg2+Any genome template of BSA, DMSO, glycerol and 5 specific bacteria and a corresponding primer thereof are used for detecting whether the kit works normally, and in the using process, an operator does not need to configure a positive quality control system by himself, and the positive quality control system in the kit can directly carry out PCR reaction.
Preferably, the negative quality control is sterile water.
Preferably, the positive quality control is the genome DNA of any one of the bacteria of the genera Clostridium symbiosum, Bifidobacterium adolescentis, Fusobacterium nucleatum, Streptococcus anaerobiosis or Klebsiella.
In a third aspect, the present invention provides a method for identifying the intestinal micro-ecology using the kit of the second aspect, comprising the steps of:
(1) taking excrement sample DNA as a template, and respectively adding the excrement sample DNA into the premix solution of the eight-union pipe;
(2) adding sterile water into the negative quality control tube;
(3) and (4) PCR amplification.
Preferably, the template has a final concentration of 0.25-1.25 ng/. mu.L, e.g., 0.25 ng/. mu.L, 0.3 ng/. mu.L, 0.35 ng/. mu.L, 0.4 ng/. mu.L, 0.45 ng/. mu.L, 0.5 ng/. mu.L, 0.55 ng/. mu.L, 0.6 ng/. mu.L, 0.65 ng/. mu.L, 0.7 ng/. mu.L, 0.75 ng/. mu.L, 0.8 ng/. mu.L, 0.85 ng/. mu.L, 0.9 ng/. mu.L, 0.95 ng/. mu.L, 1 ng/. mu.L, 1.05 ng/. mu.L, 1.1 ng/. mu.L, 1.15 ng/. mu.L, 1.2 ng/. mu.L, or 1.25 ng/. mu.L.
Preferably, the final concentration of the primer in the reaction solution is 0.25-1.25 ng/. mu.L, and may be, for example, 0.25 ng/. mu.L, 0.3 ng/. mu.L, 0.35 ng/. mu.L, 0.4 ng/. mu.L, 0.45 ng/. mu.L, 0.5 ng/. mu.L, 0.55 ng/. mu.L, 0.6 ng/. mu.L, 0.65 ng/. mu.L, 0.7 ng/. mu.L, 0.75 ng/. mu.L, 0.8 ng/. mu.L, 0.85 ng/. mu.L, 0.9 ng/. mu.L, 0.95 ng/. mu.L, 1 ng/. mu.L, 1.05 ng/. mu.L, 1.1 ng/. mu.L, 1.15 ng/. mu.L, 1.2 ng/. mu.L, or 1.25 ng/. mu.L.
Preferably, the final concentration of Tris-HCl in the reaction solution is 10-80mmol/L, for example, 10mmol/L, 15mmol/L, 20mmol/L, 25mmol/L, 30mmol/L, 35mmol/L, 40mmol/L, 45mmol/L, 50mmol/L, 55mmol/L, 60mmol/L, 65mmol/L, 70mmol/L, 75mmol/L or 80 mmol/L.
Preferably, the final concentration of ammonium sulfate in the reaction solution is 10-40mmol/L, for example, 10mmol/L, 15mmol/L, 20mmol/L, 25mmol/L, 30mmol/L, 35mmol/L or 40 mmol/L.
Preferably, MgCl is contained in the reaction solution2The final concentration of (b) is 1 to 5.5mmol/L, and may be, for example, 1mmol/L, 1.5mmol/L, 2mmol/L, 2.5mmol/L, 3mmol/L, 3.5mmol/L, 4mmol/L, 4.5mmol/L, 5mmol/L or 5.5 mmol/L.
Preferably, the final concentration of dNTPs in the reaction solution is 100-500. mu. mol/L, and may be, for example, 100. mu. mol/L, 110. mu. mol/L, 120. mu. mol/L, 130. mu. mol/L, 140. mu. mol/L, 150. mu. mol/L, 160. mu. mol/L, 170. mu. mol/L, 180. mu. mol/L, 190. mu. mol/L, 200. mu. mol/L, 210. mu. mol/L, 220. mu. mol/L, 230. mu. mol/L, 240. mu. mol/L, 250. mu. mol/L, 260. mu. mol/L, 270. mu. mol/L, 280. mol/L, 290. mu. mol/L, 300. mu. mol/L, 310. mu. mol/L, 320. mu. mol/L, 330. mol/L, 340. mol/L, 350. mu. mol/L, 360. mol/L, 370. mu. mol/L, 370. mol/L, or the like, 380. mu. mol/L, 390. mu. mol/L, 400. mu. mol/L, 410. mu. mol/L, 420. mu. mol/L, 430. mu. mol/L, 440. mu. mol/L, 450. mu. mol/L, 460. mu. mol/L, 470. mu. mol/L, 480. mu. mol/L, 490. mu. mol/L or 500. mu. mol/L.
In the invention, the relative content of 5 specific bacteria in the fecal sample is detected in one step by adjusting the composition of the reaction solution and the matching of the reaction conditions, so as to identify whether the intestinal microecology is unbalanced.
The reaction liquid of each reaction hole of the eight-connecting pipe comprises the following components:
symbiotic clostridium PCR reaction liquid: Tris-HCl: 10mmol/L, pH8.5; ammonium sulfate: 10 mmol/L; MgCl2：3mmol/L；dNTPs：200μmol/L；
B, bifidobacterium adolesentis PCR reaction solution: Tris-HCl: 40mmol/L, pH8.5; ammonium sulfate: 30 mmol/L; MgCl2：2.5mmol/L；dNTPs：150μmol/L；
B, C, F-M PCR reaction solution: Tris-HCl: 60mmol/L, pH8.5; ammonium sulfate: 40 mmol/L; MgCl2：5.5mmol/L；dNTPs：400μmol/L；
Anaerobic digestion streptococcus PCR reaction solution: Tris-HCl: 80mmol/L, pH8.5; ammonium sulfate: 10 mmol/L; MgCl2：2mmol/L；dNTPs：500μmol/L；
Klebsiella PCR reaction solution: Tris-HCl: 50mmol/L, pH8.5; ammonium sulfate: 20 mmol/L; MgCl2：1mmol/L；dNTPs：100μmol/L；
Total bacteria PCR reaction solution: Tris-HCl: 40mmol/L, pH8.5; ammonium sulfate: 30 mmol/L; MgCl2：3mmol/L；dNTPs：300μmol/L；
Negative control PCR reaction: Tris-HCl: 40mmol/L, pH8.5; ammonium sulfate: 30 mmol/L; MgCl2：3mmol/L；dNTPs：300μmol/L；
Positive control PCR reaction: Tris-HCl: 40mmol/L, pH8.5; ammonium sulfate: 30 mmol/L; MgCl2：3mmol/L；dNTPs：300μmol/L。
Preferably, the PCR amplification conditions in step (2) are:
1) pre-denaturation at 90-96 deg.C for 2-4 min;
2) denaturation at 90-96 deg.C for 10-15s, extension at 55-65 deg.C for 1-1.5min, and 38-42 cycles.
The pre-denaturation temperature in step (1) is 90 to 96 ℃, and may be 91 ℃, 92 ℃, 93 ℃, 94 ℃, 95 ℃ or 96 ℃, for example, and is preferably 95 ℃.
The time for the pre-denaturation in the step (1) is 2-4min, for example, 2min, 3min or 4min, preferably 3 min.
The temperature of the deformation in step (2) is 90 to 96 ℃, and may be, for example, 91 ℃, 92 ℃, 93 ℃, 94 ℃, 95 ℃ or 96 ℃, preferably 95 ℃.
The deformation time in step (2) is 10-15s, for example, 10s, 11s, 12s, 13s, 14s or 15s, preferably 15 s.
The temperature for the extension in step (2) is 55 to 65 ℃, and may be, for example, 55 ℃, 56 ℃, 57 ℃, 58 ℃, 59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃ or 65 ℃, preferably 60 ℃.
The extension time in step (2) is 1-2min, for example, 1min, 1.5min or 2min, preferably 1 min.
The number of cycles in step (2) is 38-42, for example, 38, 39, 40, 41 or 42, preferably 40.
Preferably, the conditions for PCR amplification are:
1) pre-denaturation at 95 ℃ for 3 min;
2) denaturation at 95 ℃ for 15s, extension at 60 ℃ for 1min, 40 cycles.
Preferably, the determination of the PCR result is as follows:
A) experimental validity:
(1') negative control: no canonical sigmoid amplification curve;
(2') Positive control: a typical S-shaped amplification curve is formed, and the Ct value is less than or equal to 30;
(3') Ct value of the detection sample is less than 40;
B) and (4) interpretation of results:
relative content of bacteria 2-ΔCt(ii) a Wherein Δ Ct ═ CtBacteria-CtTotal bacteria。
In the invention, the experiment is proved to be effective under the conditions of (1 ') - (3') simultaneously, if a typical S-shaped amplification curve appears in a negative control, the experiment is proved to be polluted or improperly operated; if all the wells have no typical sigmoidal amplification curve, the reagent may fail or the instrument may be in trouble or the operation process is not proper; if the Ct value of the detected sample is more than or equal to 40, the sample is too little, and the detection specificity is reduced.
On the premise of proving that the experiment is effective, according to the Ct values (Ct) of 5 bacteria holes of the eight-connected tubeBacteria) And total bacterial Ct values (Ct) of V3-V4 wellsTotal bacteria) By the formula: 2-ΔCt(ΔCt＝CtBacteria-CtTotal bacteria) The relative contents of the five bacteria in the sample are obtained.
In a fourth aspect, the present invention provides a use of any one or at least two pairs of primers of the primer composition according to the first aspect and/or the kit according to the second aspect for preparing a diagnostic agent and/or a medicament for intestinal dysbiosis.
Compared with the prior art, the invention has the following beneficial effects:
(1) the primer composition disclosed by the invention is good in specificity, and can be used for effectively identifying the relative content of 5 intestinal bacteria in the intestinal tract so as to identify the microecological condition of the intestinal tract;
(2) according to the invention, through a large amount of screening researches, 5 specific bacteria are determined to be used as biomarkers, and the primer disclosed by the invention has high sensitivity;
(3) the kit provided by the invention can obtain the relative content information of 5 intestinal bacteria through one-time PCR reaction, and the reaction liquid is subpackaged in the PCR amplification octaplex tubes in advance, so that the time cost is obviously reduced, and errors caused by the sample adding process of operators are reduced.
Drawings
FIG. 1 is a schematic diagram of PCR amplification octa-tubes of example 1 of the present invention, wherein C.s represents a Clostridium symbiosum detection tube; kleb stands for Klebsiella detection tube; b.a represents a bifidobacterium adolescentis detection tube; f.n represents Fusobacterium nucleatum detection tubes; p.a denotes anaerobic digestion streptococcal test tube; V3V4 represents a total bacteria detection tube; NC represents control of yin property; PC stands for positive control.
Detailed Description
To further illustrate the technical means and effects of the present invention, the following embodiments further illustrate the technical solutions of the present invention, but the present invention is not limited to the scope of the embodiments.
EXAMPLE 1 kit Assembly
The specific sequences of the primer compositions are shown in Table 1:
TABLE 1
PCR reaction solution: Tris-HCl: 10-80mmol/L, pH8.5; ammonium sulfate: 10-40 mmol/L; MgCl2: 1-5.5 mmol/L; dNTPs: 100-500 mu mol/L; the final concentration of the primer is 0.25-1.25 ng/. mu.L. The components of the reaction liquid in each reaction hole are as follows:
symbiotic clostridium PCR reaction liquid: Tris-HCl: 10mmol/L, pH8.5; ammonium sulfate: 10 mmol/L; MgCl2：3mmol/L；dNTPs：200μmol/L；
B, bifidobacterium adolesentis PCR reaction solution: Tris-HCl: 40mmol/L, pH8.5; ammonium sulfate: 30 mmol/L; MgCl2：2.5mmol/L；dNTPs：150μmol/L；
B, C, F-M PCR reaction solution: Tris-HCl: 60mmol/L, pH8.5; ammonium sulfate: 40 mmol/L; MgCl2：5.5mmol/L；dNTPs：400μmol/L；
Anaerobic digestion streptococcus PCR reaction solution: Tris-HCl: 80mmol/L, pH8.5; ammonium sulfate: 10 mmol/L; MgCl2：2mmol/L；dNTPs：500μmol/L；
Klebsiella PCR reaction solution: Tris-HCl: 50mmol/L, pH8.5; ammonium sulfate: 20 mmol/L; MgCl2：1mmol/L；dNTPs：100μmol/L；
Total bacteria PCR reaction solution: Tris-HCl: 40mmol/L, pH8.5; ammonium sulfate: 30 mmol/L; MgCl2：3mmol/L；dNTPs：300μmol/L；
Negative control PCR reaction: Tris-HCl: 40mmol/L, pH8.5; ammonium sulfate: 30 mmol/L; MgCl2：3mmol/L；dNTPs：300μmol/L；
Positive control PCR reaction: Tris-HCl: 40mmol/L, pH8.5; ammonium sulfate: 30 mmol/L; MgCl2：3mmol/L；dNTPs：300μmol/L；
Negative quality control product: sterile water;
positive quality control product: fusobacterium nucleatum genomic DNA.
The invention designs a plurality of pairs of specific primers aiming at V3-V4 areas of clostridium symbiosum, bifidobacterium adolescentis, fusobacterium nucleatum, streptococcus anaerobically digested, klebsiella and total bacteria, and any one of the specific implementation can meet the requirement of the kit of the invention to prepare a premixed solution.
The PCR amplification octa-tube is identified in FIG. 1, and the corresponding system formulation is shown in Table 2:
TABLE 2
Example 2 clinical validation
1. Sample selection
In the hospital, 46 clearly diagnosed intestinal microecological imbalance samples were collected, and all samples were confirmed by stool microscopy and a doctor, including 8 intestinal polyps and 38 adenomas. Meanwhile, 28 healthy people in physical examination are collected, physical examination indexes are normal, fecal microscopic examination is normal, and all people have no intestinal diseases after enteroscopy.
2. Extraction of genome from fecal samples
Bacterial genomes in different samples were extracted according to the instructions of fecal bacterial genome extraction kit (DP328, Tiangen Biochemical technology (Beijing) Ltd.) to detect the concentration and quality of DNA.
3. Testing a sample to be tested
The extracted DNA was used as a template, and the loading amount was 5 ng/sample. Adding the same genome template into a corresponding tube of the octal-connected tube, adding 9 mu L of sterile water into the negative quality control tube, not processing the positive quality control tube, putting the octal-connected tube added with the genome template to be detected into a PCR instrument, and reacting according to the following reaction system:
1) pre-denaturation at 95 ℃ for 3 min;
2) denaturation at 95 ℃ for 15s, extension at 60 ℃ for 1min, 40 cycles.
Fluorescence data was collected at 60 and repeated three times for each sample.
4. And (4) analyzing results: the PCR results were determined as follows:
A) experimental validity:
(1') negative control: there is no typical sigmoidal amplification curve.
(2') Positive control: presents a typical S-shaped amplification curve and has a Ct value less than or equal to 30.
(3') Ct value of the test sample should be < 40.
(4') under the condition of simultaneously satisfying 1, 2 and 3, the experiment is effective, otherwise, the experiment is ineffective.
B) And (4) interpretation of results:
ct values (Ct) according to the respective 5 bacterial wells of the eight-tubeBacteria) And total bacterial Ct values (Ct) of V3-V4 wellsTotal bacteria) By the formula:
2-ΔCt(ΔCt＝Ctbacteria-CtTotal bacteria) The relative contents of the five bacteria in the sample are obtained.
The results of the tests on all 46 intestinal microecological imbalance samples and 28 normal intestinal microecological samples are shown in table 3.
TABLE 3
As can be seen from Table 3, the primer composition of the present invention has a sensitivity of 80.43% and a specificity of 92.5% for detecting intestinal microecological imbalance.
In conclusion, the primer composition disclosed by the invention is good in specificity, can effectively identify the relative content of 5 intestinal bacteria in the intestinal tract, is high in sensitivity, and further can identify the microecological condition of the intestinal tract.
The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.
SEQUENCE LISTING
<110> Suzhou Prisisen Gene science and technology, Inc
<120> primer composition for identifying intestinal microecological state and application thereof
<130> 2019
<160> 42
<170> PatentIn version 3.3
<210> 1
<211> 26
<212> DNA
<213> artificially synthesized sequence
<400> 1
cggcattgaa ttgactgagt ggcgga 26
<210> 2
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 2
ccatcttgta ccaccggagt tagat 25
<210> 3
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 3
agttgaattg actgagtggc ggagc 25
<210> 4
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 4
taacgccatc ttgtaccacc ggagt 25
<210> 5
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 5
gccattgaat tgactgagtg gcgga 25
<210> 6
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 6
atccatcttg taccaccgga gtccg 25
<210> 7
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 7
agtttgaatt gactgagtgg cgga 24
<210> 8
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 8
ggccatcttg taccaccgga gtatt 25
<210> 9
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 9
ggtcaggatg ttgtcggaag ccatt 25
<210> 10
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 10
acttcattca acgccgactt cgata 25
<210> 11
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 11
ttcctcagga tgttgtcgga agccc 25
<210> 12
<211> 23
<212> DNA
<213> artificially synthesized sequence
<400> 12
agccattcaa cgccgacttc gat 23
<210> 13
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 13
ggtctcagga tgttgtcgga agcc 24
<210> 14
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 14
aagtcattca acgccgactt cgat 24
<210> 15
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 15
cgtatcagga tgttgtcgga agcc 24
<210> 16
<211> 23
<212> DNA
<213> artificially synthesized sequence
<400> 16
gtccattcaa cgccgacttc gat 23
<210> 17
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 17
cctcttagga atgagacaga gatg 24
<210> 18
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 18
attgatggta acatacgaaa gggcc 25
<210> 19
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 19
ttcacttagg aatgagacag agatg 25
<210> 20
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 20
tgatggtaac atacgaaagg catg 24
<210> 21
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 21
tggacttagg aatgagacag agatg 25
<210> 22
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 22
acctgatggt aacatacgaa aggt 24
<210> 23
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 23
tgactgacga tcagtagccg acctg 25
<210> 24
<211> 23
<212> DNA
<213> artificially synthesized sequence
<400> 24
acttgaaaga ccacctacgc acc 23
<210> 25
<211> 23
<212> DNA
<213> artificially synthesized sequence
<400> 25
gacgatcagt agccgacctg tgg 23
<210> 26
<211> 23
<212> DNA
<213> artificially synthesized sequence
<400> 26
aactgaaaga ccacctacgc acc 23
<210> 27
<211> 23
<212> DNA
<213> artificially synthesized sequence
<400> 27
ccggacgatc agtagccgac ctg 23
<210> 28
<211> 23
<212> DNA
<213> artificially synthesized sequence
<400> 28
ttgtgaaaga ccacctacgc acc 23
<210> 29
<211> 22
<212> DNA
<213> artificially synthesized sequence
<400> 29
ccgattacga ccagggctac ac 22
<210> 30
<211> 22
<212> DNA
<213> artificially synthesized sequence
<400> 30
gggaacgtat tcaccgtacc ta 22
<210> 31
<211> 22
<212> DNA
<213> artificially synthesized sequence
<400> 31
gcattacgac cagggctaca ct 22
<210> 32
<211> 22
<212> DNA
<213> artificially synthesized sequence
<400> 32
actgggaacg tattcaccgt ag 22
<210> 33
<211> 22
<212> DNA
<213> artificially synthesized sequence
<400> 33
ttgcttacga ccagggctac ac 22
<210> 34
<211> 21
<212> DNA
<213> artificially synthesized sequence
<400> 34
agtgggaacg tattcaccgt a 21
<210> 35
<211> 22
<212> DNA
<213> artificially synthesized sequence
<400> 35
ctgattacga ccagggctac ac 22
<210> 36
<211> 22
<212> DNA
<213> artificially synthesized sequence
<400> 36
aacgggaacg tattcaccgt at 22
<210> 37
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 37
tccgtgstgc ayggytgtcg tcag 24
<210> 38
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 38
aggtacgtcr tccmcacctt cctc 24
<210> 39
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 39
ccttgtgstg cayggytgtc gtca 24
<210> 40
<211> 24
<212> DNA
<213> artificially synthesized sequence
<400> 40
atccacgtcr tccmcacctt cctc 24
<210> 41
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 41
gtgstgcayg gytgtcgtca tggac 25
<210> 42
<211> 25
<212> DNA
<213> artificially synthesized sequence
<400> 42
ctggacgtcr tccmcacctt cctct 25
Claims (9)
1. A primer set for identifying the intestinal microecological state, wherein the primer set comprises a specific primer designed for 16S rRNA of intestinal bacteria;
the intestinal bacteria are clostridium symbiosum, bifidobacterium adolescentis, fusobacterium nucleatum, streptococcus anaerobicus and klebsiella;
the nucleotide sequence of the specific primer pair of the clostridium symbiosum is shown in SEQ ID NO. 1-8;
the nucleotide sequence of the specific primer pair of the bifidobacterium adolescentis is shown as SEQ ID NO. 9-16;
the nucleotide sequence of the specific primer pair of the fusobacterium nucleatum is shown in SEQ ID NO. 17-22;
the nucleotide sequence of the specific primer pair of the anaerobic digestion streptococcus is shown as SEQ ID NO. 23-28;
the nucleotide sequence of the specific primer pair of the Klebsiella is shown as SEQ ID NO. 29-36;
the primer group also comprises a total bacteria detection primer designed aiming at the 16S rRNA V3-V4 region of the 5 microorganisms;
the nucleotide sequence of the total bacteria detection primer pair is shown in SEQ ID NO. 37-42.
2. A kit for identifying the intestinal micro-ecology, comprising the primer set of claim 1.
3. The kit according to claim 2, further comprising an amplification octal tube, wherein the octal tube is pre-filled with PCR premix for detection of different bacteria and total bacteria.
4. The kit of claim 3, wherein the pre-mix comprises PCR reaction solution and corresponding primers.
5. The kit of claim 4, wherein the reaction solution comprises Tris-HCl, ammonium sulfate, MgCl2And dNTPs.
6. The kit of claim 3, wherein the octal tubes further comprise a negative quality control and a positive quality control.
7. The kit of claim 6, wherein the negative quality control is sterile water.
8. The kit of claim 6, wherein the positive quality control is genomic DNA of Clostridium symbiosum, Bifidobacterium adolescentis, Clostridium nucleatum, Streptococcus anaerobiosis, and Klebsiella.
9. Use of the primer set according to claim 1 and/or the kit according to any one of claims 2 to 8 for the preparation of a diagnostic agent for intestinal dysbiosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910087568.4A CN109576386B (en) | 2019-01-29 | 2019-01-29 | Primer composition for identifying intestinal microecological state and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910087568.4A CN109576386B (en) | 2019-01-29 | 2019-01-29 | Primer composition for identifying intestinal microecological state and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109576386A CN109576386A (en) | 2019-04-05 |
| CN109576386B true CN109576386B (en) | 2022-05-03 |
Family
ID=65918131
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910087568.4A Active CN109576386B (en) | 2019-01-29 | 2019-01-29 | Primer composition for identifying intestinal microecological state and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109576386B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110512015A (en) * | 2019-09-11 | 2019-11-29 | 苏州普瑞森基因科技有限公司 | A kind of intestinal cancer biomarker combinations object and its application |
| CN110699468B (en) * | 2019-10-29 | 2023-05-02 | 圣湘生物科技股份有限公司 | Composition, kit and method for detecting human intestinal bacteria |
| CN112695077A (en) * | 2020-12-30 | 2021-04-23 | 上海派森诺医学检验所有限公司 | Method for identifying and analyzing flora in intestinal tract |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2948134C (en) * | 2014-05-06 | 2023-03-14 | Is-Diagnostics Ltd. | Microbial population analysis |
| ITUB20169847A1 (en) * | 2016-01-05 | 2017-07-05 | Wellmicro S R L | METHOD FOR ASSESSING THE HEALTH STATUS OF AN INDIVIDUAL |
| CN107904298A (en) * | 2017-12-29 | 2018-04-13 | 苏州普瑞森基因科技有限公司 | A kind of kit and its application for being used to analyze enteric microorganism |
| CN107937582A (en) * | 2017-12-29 | 2018-04-20 | 苏州普瑞森基因科技有限公司 | A kind of primer sets and its application for being used to analyze enteric microorganism |
-
2019
- 2019-01-29 CN CN201910087568.4A patent/CN109576386B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109576386A (en) | 2019-04-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109576386B (en) | Primer composition for identifying intestinal microecological state and application thereof | |
| CN112094915B (en) | Sarcoma fusion gene and/or mutation joint detection primer group and kit | |
| WO2019145306A1 (en) | Biomarker panel and methods for detecting microsatellite instability in cancers | |
| CN106676190A (en) | Spinal muscular atrophy related gene mutation detection kit and application thereof | |
| CN113265456B (en) | Primer and probe combination for detecting cervical high-grade lesion and methylation of cervical cancer related genes | |
| CN111187842A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN110656187A (en) | Kit and method for detecting echinococcus in lesion tissues or canine feces by using multiple RAA and multiple PCR (polymerase chain reaction) | |
| CN112646888B (en) | Kit for detecting mammary tumor specific methylation | |
| CN117070607B (en) | Fluorescent quantitative PCR kit for detecting human spinal muscular atrophy SMN1 and SMN2 gene copy numbers | |
| CN102834525A (en) | Methods for PCR and HLA typing using raw blood | |
| CN113355414B (en) | Esophageal cancer detection kit and application thereof | |
| CN113621704B (en) | Reagent and kit for detecting and diagnosing liver cancer | |
| CN109439704B (en) | Method and kit for detecting leukemia related gene variation | |
| CN101845502A (en) | Probe amplification method with multiple connection and extending independency and kit thereof | |
| CN109402259B (en) | Kit for detecting leukemia fusion gene and gene mutation | |
| CN114959030B (en) | Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer | |
| CN110777205A (en) | Breast cancer 21 gene detection kit and detection method thereof | |
| CN114214416B (en) | Biomarkers associated with pre-cervical lesion occurrence and uses thereof | |
| WO2017167034A1 (en) | Bladder cancer detection method and kit | |
| CN108531602A (en) | A kind of primer and detection method for detecting the relevant SNP site of lymph cancer neurological susceptibility | |
| CN104946779B (en) | A kind of detection HLA-B*57:The TaqMan probe real time fluorescent PCR method of 01 allele | |
| CN111566229B (en) | Breast cancer molecular typing and distant metastasis risk gene group, diagnosis product and application | |
| CN112522386A (en) | Kit for detecting copy number variation of MECP2 gene | |
| CN108018285B (en) | Super-sensitive primer and design method and application thereof | |
| CN111647661A (en) | Novel diagnosis method for acute myelogenous leukemia and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 215123 unit 505, A5 / F, bio nano Park, 218 Xinghu street, Suzhou Industrial Park, Suzhou City, Jiangsu Province Applicant after: Suzhou preyson Biotechnology Co.,Ltd. Address before: 215123 unit 505, A5 / F, bio nano Park, 218 Xinghu street, Suzhou Industrial Park, Suzhou City, Jiangsu Province Applicant before: SUZHOU PRECISION GENE Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |