CN112695077A

CN112695077A - Method for identifying and analyzing flora in intestinal tract

Info

Publication number: CN112695077A
Application number: CN202011596622.7A
Authority: CN
Inventors: 侯明飞; 朱月艳; 孙子奎
Original assignee: Shanghai Personal Medicine Laboratory Co ltd
Current assignee: Shanghai Personal Medicine Laboratory Co ltd
Priority date: 2020-12-30
Filing date: 2020-12-30
Publication date: 2021-04-23

Abstract

The invention discloses a method for identifying and analyzing flora in intestinal tracts, which comprises the following steps of 1) carrying out dried excrement occult blood detection, 2) extracting a sample, 3) controlling the quality of the sample, 4) carrying out qPCR amplification, diluting DNA samples qualified in quality detection, respectively constructing a qPCR reaction system, and then carrying out amplification; 5) the method can obtain the relative content information of a plurality of intestinal bacteria through PCR reaction, obviously reduce time cost and improve the accuracy of gymnastics screening.

Description

Method for identifying and analyzing flora in intestinal tract

Technical Field

The invention relates to the technical field of gene detection, in particular to an identification and analysis method for flora in intestinal tracts.

Background

In recent years, the incidence rate of intestinal diseases is rising, early symptoms of the intestinal diseases are not obvious, an effective screening method is lacked, and finally, the intestinal diseases are likely to develop into cancers. In the prior art, the examination and screening of intestinal diseases are mainly carried out by preliminarily screening high risk groups through fecal occult blood experiments and then carrying out enteroscopy. However, fecal occult blood experiments lack specificity, the primary screening compliance and the enteroscope detection rate of high risk groups are only 30-40%, and the disease detection rate is about 19%, which needs to be further improved. The noninvasive markers are used for screening the population, the enteroscopy number can be reduced, the specificity and sensitivity of the enteroscopy are further improved, and the method has important clinical significance for early screening of intestinal diseases.

A large number of flora exist in intestinal tracts of people, beneficial bacteria and conditional pathogenic bacteria coexist, the beneficial bacteria in the healthy people are dominant, and the number of the flora is maintained in a balanced steady state; however, in a human body with intestinal diseases, the internal environment changes, so that flora imbalance is caused, and the number of conditional pathogenic bacteria is obviously increased, so that early warning can be given to the intestinal diseases by identifying the flora microecology in the intestinal tract.

Disclosure of Invention

The invention provides a method for identifying and analyzing flora in intestinal tracts.

The scheme of the invention is as follows:

a method for identifying and analyzing flora in intestinal tracts comprises the following steps:

1) carrying out dry excrement occult blood detection, and detecting by using an excrement occult blood detection kit through a colloidal gold method to obtain a detection result;

2) extracting a sample, taking a feces sample, putting the feces sample into a tube, adding a buffer solution GA into the feces sample, suspending the feces sample by oscillation or blowing suction, then adding 20-30 ul of protease K, uniformly mixing, adding a buffer solution GB, oscillating for 15s, placing in a metal bath at 70 ℃ for 25-35 min, simultaneously oscillating for 1000/min, centrifuging after the solution becomes clear, adding absolute ethyl alcohol, fully oscillating and uniformly mixing for 15s, centrifuging, precipitating floccule, adding the solution in the tube into an adsorption column, centrifuging, placing the adsorption column into a collecting tube, then adding a buffer solution GD into the adsorption column, centrifuging, removing waste liquid, rinsing, then placing into a collecting tube, centrifuging, removing the waste liquid, placing at room temperature for 3-6 min, then transferring the adsorption column into a centrifugal tube, dropwise adding a suspended elution buffer solution TE at the middle part of an adsorption film of a box, placing for 2-5 min at 65 ℃, centrifuging for 2min, collecting the solution into the centrifugal tube, obtaining a DNA sample;

3) controlling the quality of the sample, namely testing the concentration of the DNA sample extracted in the step 2) by a spectrophotometer to be more than or equal to 20 ng/mu l, and testing the OD260/OD280 value to be 1.9 +/-0.2 by the spectrophotometer to obtain the DNA sample qualified in quality inspection;

4) qPCR amplification, namely diluting DNA samples qualified by quality inspection, respectively constructing qPCR reaction systems, and then amplifying;

5) and (5) analyzing the data, and obtaining an analysis result through software.

As a preferred technical scheme, the reaction system comprises the following steps:

as a preferred technical scheme, the amplification reaction conditions are as follows:

cycle parameters, 95 ℃,30 s; circulating for 32 times at 95 ℃ and 5-60 ℃ for 34 s; detecting fluorescence at 60 ℃; dissolution curve, 95 ℃, 15 s; detecting fluorescence at 60 deg.C, 1min to 95 deg.C, 0.3 deg.C/sec;

and (4) selecting a fluorescence channel for detection, detecting the fluorescence channel as an SYBR channel, and judging a standard interpretation result according to the result.

The method for identifying and analyzing the flora in the intestinal tract adopts the technical scheme that 1) dry excrement occult blood is detected, and an excrement occult blood detection kit is used for detecting through a colloidal gold method to obtain a detection result; 2) extracting a sample, taking a feces sample, putting the feces sample into a tube, adding a buffer solution GA into the feces sample, suspending the feces sample by oscillation or blowing suction, then adding 20-30 ul of protease K, uniformly mixing, adding a buffer solution GB, oscillating for 15s, placing in a metal bath at 70 ℃ for 25-35 min, simultaneously oscillating for 1000/min, centrifuging after the solution becomes clear, adding absolute ethyl alcohol, fully oscillating and uniformly mixing for 15s, centrifuging, precipitating floccule, adding the solution in the tube into an adsorption column, centrifuging, placing the adsorption column into a collecting tube, then adding a buffer solution GD into the adsorption column, centrifuging, removing waste liquid, rinsing, then placing into a collecting tube, centrifuging, removing the waste liquid, placing at room temperature for 3-6 min, then transferring the adsorption column into a centrifugal tube, dropwise adding a suspended elution buffer solution TE at the middle part of an adsorption film of a box, placing for 2-5 min at 65 ℃, centrifuging for 2min, collecting the solution into the centrifugal tube, obtaining a DNA sample; 3) controlling the quality of the sample, namely testing the concentration of the DNA sample extracted in the step 2) by a spectrophotometer to be more than or equal to 20 ng/mu l, and testing the OD260/OD280 value to be 1.9 +/-0.2 by the spectrophotometer to obtain the DNA sample qualified in quality inspection; 4) qPCR amplification, namely diluting DNA samples qualified by quality inspection, respectively constructing qPCR reaction systems, and then amplifying; 5) and (3) analyzing data, diluting the DNA stock solution with sterilized water, and loading the DNA stock solution on a computer through software to obtain an analysis result.

The invention has the advantages that: the invention is convenient to operate and use, and improves the detection accuracy;

effectively identifying the relative content of various intestinal bacteria in the intestinal tract, and further identifying the microecological condition of the intestinal tract;

according to the invention, a large number of screening researches are carried out to determine that various specific bacteria are used as biomarkers, and the primer disclosed by the invention has high sensitivity;

the invention can obtain the relative content information of a plurality of intestinal bacteria through PCR reaction, obviously reduce time cost and simultaneously reduce errors introduced by an operator in the sample adding process.

Drawings

FIG. 1 is a diagram of a select program type interface for software according to an embodiment of the present invention;

FIG. 2 is an interface diagram of the selection dye and the amplified gene name of the software according to the embodiment of the present invention;

FIG. 3 is a diagram of a set-up control gene interface of software according to an embodiment of the present invention;

FIG. 4 is a diagram of a setup augmentation program interface of software according to an embodiment of the present invention;

FIG. 5 is a result interface diagram of a batch of software according to an embodiment of the present invention;

FIG. 6 is an interfacial view of a preliminary dissolution curve of an example of the present invention;

FIG. 7 is a diagram of an Excel file setup interface according to an embodiment of the present invention;

FIG. 8 is a diagram of a modified Excel file interface according to an embodiment of the present invention;

FIG. 9 is a final melting curve of an embodiment of the present invention;

FIG. 10 is a flow diagram of the present invention.

Detailed Description

In order to make up for the above deficiencies, the present invention provides a method for identifying and analyzing intestinal flora to solve the above problems in the background art.

5) and (3) analyzing data, diluting the DNA stock solution with sterilized water, and loading the DNA stock solution on a computer through software to obtain an analysis result. The reaction system is as follows:

the reaction system is as follows:

the reaction system is as follows:

the reaction system is as follows:

the reaction system is as follows:

the reaction system is as follows:

the reaction system is as follows:

the reaction system is as follows:

the amplification reaction conditions are as follows:

In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further described with the specific embodiments.

Example (b):

the first step is as follows:

and (3) carrying out occult blood detection on dry feces:

the kit comprises: fecal occult blood detection kit (colloidal gold method)

Recording:

and (4) recording the result: and obtaining a hematochezia sample result recording table and a detection chart record.

The second step is extraction reaction SOP:

kit composition and sample requirements

The kit comprises TB-Green produced by TaKaRa, and is extracted by using a radix asparagi extraction kit (cargo number DP302-02), wherein the concentration of the extracted nucleic acid is more than 30ng/uL, and the OD260/OD280 is 1.9 +/-0.2.

1. The extraction method comprises the following specific operation steps:

1.1 taking 1-2 g of a fecal sample, adding 200 mu l of buffer solution GA into the sample, and oscillating or blowing and sucking until the sample is suspended completely;

1.2 adding 20 mul of protease K solution into the tube, and uniformly mixing; (if more feces are taken, the quantity can be increased to 30ul)

1.3 adding 220 mul buffer solution GB, oscillating for 15sec, standing in a metal bath at 70 ℃ for 30min, oscillating for 1000/min at the same time, cleaning the solution strain, and centrifuging briefly to remove water drops on the inner wall of the tube cover;

adding 220 μ l of anhydrous ethanol into 1.4, shaking thoroughly, mixing for 15sec, wherein flocculent precipitate may appear, centrifuging briefly to remove water drops on the inner wall of the tube cover and precipitate flocculent;

1.5 adding the solution (700ul, if the solution is light in color, the solution can be transferred for multiple times) obtained in the previous step into an adsorption column CB3 (the adsorption column is placed into a collection pipe), centrifuging at 12,000rpm (13,400 Xg) for 30sec, pouring the waste liquid, and placing an adsorption column CB3 into the collection pipe; if the solution can not be completely centrifuged, completely removing the liquid in the CB3 column, adding 220 mu l of absolute ethyl alcohol for blowing and sucking for 2-3 times, centrifuging in a centrifuge, adding the obtained solution and flocculent precipitate into an adsorption column CB3, and passing through the column again for adsorption;

1.6 Add 500. mu.l buffer GD (check whether absolute ethanol has been added before use), 12,000rpm to adsorption column CB3

Centrifuging for 30sec (-13,400 Xg), pouring waste liquid, and putting adsorption column CB3 into a collection tube;

1.7 adding 600 μ l rinsing liquid PW (checking whether absolute ethyl alcohol is added before use) into adsorption column CB3, centrifuging for 30sec at 12,000 rpm-13,400 Xg, pouring off waste liquid, and placing adsorption column CB3 into a collecting pipe;

1.8 repeating operation step 1.47;

1.9 the adsorption column CB3 was placed back into the collection tube and centrifuged at 12,000rpm (. about.13,400 Xg) for 2min to discard the waste liquid. The adsorption column CB3 was left at room temperature.

Standing for several minutes to thoroughly dry the residual rinsing liquid in the adsorption material;

1.10 transferring the adsorption column CB3 into a clean centrifuge tube, suspending and dripping 50-200 mu l of elution buffer TE into the middle part of the adsorption membrane, standing at 65 ℃ for 2-5 min, centrifuging at 12,000rpm (13,400 Xg) for 2min, and collecting the solution into the centrifuge tube;

1.11 the experimental wastes were treated according to the regulations on the management of medical wastes of the medical and health institutions in Shanghai City and the regulations on the treatment of laboratory medical wastes

2. Quality control standard

2.1 the concentration of the extracted DNA is more than or equal to 20 ng/mul through the test of a spectrophotometer;

2.2 the OD260/OD280 value of the extracted DNA is 1.9 +/-0.2 through a spectrophotometer test;

3. computer-loading process

3.1 diluting the DNA sample qualified by quality inspection to 30 ng/uL;

3.2qPCR reaction System

Fusobacterium tuberculosis (F.nu)

Reagent	Volume of
		SYBR Green mix	10ul
Primer F.nu-F	0.8ul
		Primer F.nu-R	0.8ul
DNA	30ng
		ROX	0.4ul
H₂O	7ul
		General System	20ul

Peptostreptococcus analobius (anaerobic digestion streptococcus, P.an)

Reagent	Volume of
		SYBR Green mix	10ul
Primer P.an-F	0.8ul
		Primer P.an-R	0.8ul
DNA	30ng
		ROX	0.4ul
H₂O	7ul
		General System	20ul

Porphyromonas asaccharolytica (Porphyromonas saccharolytica, P.as)

Reagent	Volume of
		SYBR Green mix	10ul
Primer P.as-F	0.4ul
		Primer P.as-R	0.4ul
DNA	30ng
		ROX	0.4ul
H₂O	7.8ul
		General System	20ul

Clostridium symbiosum (Clostridium symbiosum, C.sy)

Reagent	Volume of
		SYBR Green mix	10ul
Primer C.sy-F	0.4ul
		Primer C.sy-R	0.4ul
DNA	30ng
		ROX	0.4ul
H₂O	7.8ul
		General System	20ul

Streptococcus salivarius (Streptococcus salivarius, S.sa)

Reagent	Volume of
		SYBR Green mix	10ul
Primer S.sa-F	0.4ul
		Primer S.sa-R	0.4ul
DNA	30ng
		ROX	0.4ul
H₂O	7.8ul
		General System	20ul

Bacteroides fragilis (Bacteroides fragilis, B.f)

Reagent	Volume of
		SYBR Green mix	10ul
Primer B.f-F	0.8ul
		Primer B.f-R	0.8ul
DNA	30ng
		ROX	0.4ul
H₂O	7ul
		General System	20ul

P.anPrevotella intermedia (intermediate Proteus, P.in)

·16S

Reagent	Volume of
		SYBR Green mix	10ul
Primer
	16S-F	0.2ul
Primer
	16S-R	0.2ul
DNA			30ng
	ROX	0.4ul
H₂O			8.2ul
	General System	20ul

3.3ABI 7500 reaction procedure

The experimental procedures of the scheme are as follows: relative dissolution Curve type Quantitation-Relative Standard Curve

Program selection:

the first step is as follows: sequentially selecting in the Experimental Properties

Quantitation-Relative Standard Curve，SYBR-GREEN REAGENTS,STANDARD；

FIG. 1 shows a schematic view of a

The second step is that: setting amplification parameters in a Plate setup; FIG. 2

The third step: setting a control gene; FIG. 3

The fourth step: setting an amplification program; FIG. 4

Reaction conditions:

circulation parameters: 30sec at 95 ℃; cycle at 95 ℃ for 5sec → 60 ℃ for 34sec 32 times, and fluorescence was detected at 60 ℃;

dissolution curve: fluorescence was detected at 95 ℃ for 15sec, 60 ℃ for 1min → 95 ℃ for 0.3 ℃/sec.

Fluorescence channel detection selection: SYBR channels are selected for detection.

3.4 the experimental wastes were treated according to the regulations on the management of medical wastes of the medical and health institutions in Shanghai City and the regulations on the treatment of laboratory medical wastes

3.5 interpreting the result according to the result interpretation standard of the new edition and issuing a detection report;

quality control standard

The concentration of the extracted DNA is more than or equal to 30 ng/mul through a spectrophotometer test;

the OD260/OD280 value of the extracted DNA is 1.9 +/-0.2 through a spectrophotometer test;

appendix: nostoc primer sequence

Strain primer	Sequence information
		Bacteroides fragilis-F	CAGCGTATTAAGAGCCGTTT
Bacteroides fragilis-R	TGAGTTTGGTGGTAGTATCTTCTG
		Prevotella intermedia-F	CGTGGACCAAAGATTCATCGGTGGA
Prevotella intermedia-R	CCGCTTTACTCCCCAACAAA
		Fusobacterium nucleatum-F	CAACCATTACTTTAACTCTACCATGTTCA
Fusobacterium nucleatum-R	TTGACTTTACTGAGGGAGATTATGTAAAAATC
		Peptostreptococcus anaerobius-F	AGACGAATTCAAGTCAGTAAATACA
Peptostreptococcus anaerobius-R	CTCCTATCCACCAGGATATCAA
		Clostridium symbiosum-F	GTGAGATGATGTGCCAGGC
Clostridium symbiosum-R	TACCGGTTGCTTCGTCGATT
		Streptococcus salivarius-F	TTCGCTTCCCAGAATCAAGT
Streptococcus salivarius-R	AAACGACCAGCCAGCAATTC
		Porphyromonas asaccharolytica-F	TCGACCACATAGAGCTAAGCAC
Porphyromonas asaccharolytica-R	TCCTCGACTTTCATACCGTCT
		16s Rrna-F	GGTGAATACGTTCCCGG
16s Rrna-R	TACGGCTACCTTGTTACGACTT

And (4) diluting the DNA extracted from the DNA stock solution by using sterile water (RO water is put into an autoclave, the bottle cap is unscrewed and is slightly covered but not screwed), so that the DNA cannot be used for more than one month, and the machine is required to be arranged as soon as possible after the extraction is finished.

First, data analysis

1. Opening 7500 computer program files of the current batch, selecting samples completely, clicking an 'Export' button, clicking a 'Browse' button in a dialog box, selecting a 'desktop' by a path, clicking a 'StartExport' button, clicking a button multiplied by the right upper corner of the popped dialog box, and exporting the result of the current batch. (FIG. 5)

2. The 16S results are checked first, and the 16S results of all samples are required to have no yellow marks, and if the yellow marks exist, the samples with the yellow marks cannot be detected. The peak height of the dissolution curve is around 0.6, and too low indicates that extraction is problematic. (FIG. 6)

3. Opening an exported result file (Excel document) of the current batch, creating two sheet tables, and copying 'Well', 'Sample Name', 'Target Name' and 'C' from the latest analyzed Sample Excel file_T"four items, posted to sheet1 of the newly created Excel file. (FIG. 7)

4. From the path "screen" → "data sheet" → "analysis data sheet", the "Well", "Sample Name", "Target Name", and "C" of the most recently analyzed specimen are selected_TThe four items of data are copied to corresponding 'Well', 'Sample Name', 'Target Name' and 'C' in the sheet1 of the newly-created Excel file_TUnder the four items, the data has the deletion of 'N/A'. (FIG. 8)

5. The "well number", "CT value", "Δ CT" are copied from the most recent analyzed sample data table, posted to the first row in sheet2 of the newly created Excel file, and the "sample number", "date of examination", "96 well plate number" are copied to the second row to the right of the "well number", "CT value". The "Ct value" and the "Δ Ct" include eight items of "16S", "Fnu", "Pan", "Csy", "Pas", "Ssa", "Pi" and "Bf". The "sample number", "date of detection", and "96-well plate number" of the current batch are sequentially input. And copying the contents of the hole number and the CT value from the current 7500 computer program file, clicking a right key under the corresponding hole number and the CT value in sheet2 posted to the new Excel file, and clicking the value to obtain a numerical value.

6. The "CT value" on the right side of "well numbers" A1-H1 corresponds to the eight items "16S", "Fnu", "Pan", "Csy", "Pas", "Ssa", "Pi", "Bf" of the first sample. The content of "CT value" on the right side of A1-H1 is posted to a column under "16S" under "Ct value", the right key is clicked, the "transpose" is clicked, and the column is rotated. The second, third to last sample is done in sequence.

7、ΔCt_x＝Ct_16S-Ct_xSuch as: delta Ct_Pi＝Ct_16S-Ct_xPi. Copying the Δ Ct VALUE from the current batch of 7500 computer program files to below the corresponding "Δ Ct" in sheet2, the "# VALUE! "Change to extremum" -32 "(system failed to recognize # VALUE!).

8. And checking whether the Tm of the melting curve corresponding to each site-specific primer meets the requirement. (FIG. 9)

	16S	Fnu	Pan	Csy	Pas	Ssa	pi	Bf
									Tm	85-90	75-80	75-80	83-87	80-85	80-85	85-90	80-85

"Fnu", "Pan", "Csy", "Pas", "Ssa", "Pi" and "Bf" have values, but Tm is not in the required range, and the value needs to be changed to an extreme value of-32.

9. The Δ Ct value is copied into SVM _ CRC _ meta _7_ fit _201912 x. csv, and the right click is clicked to select "value". PMID entered laboratory number of sample.

Note: the difference between the "CT value" of each site of the retest and the first "CT value" is within 1, and according to the actual situation, the value above 1 is acceptable as being closer to 1.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Claims

1. A method for identifying and analyzing flora in intestinal tracts, which is characterized by comprising the following steps:

2) extracting a sample, taking a feces sample, putting the feces sample into a tube, adding a buffer solution GA into the feces sample, suspending the feces sample by oscillation or blowing suction, then adding 20-30 ul of Proteinase K, uniformly mixing, adding a buffer solution GB, oscillating for 15s, placing in a metal bath at 70 ℃ for 25-35 min, simultaneously oscillating for 1000/min, centrifuging after the solution becomes clear, adding absolute ethyl alcohol, fully oscillating and uniformly mixing for 15s, centrifuging, precipitating floccule, adding the solution in the tube into an adsorption column, centrifuging, placing the adsorption column into a collecting tube, then adding a buffer solution GD into the adsorption column, centrifuging, removing waste liquid, rinsing, then placing into a collecting tube, centrifuging, removing the waste liquid, placing at room temperature for 3-6 min, then transferring the adsorption column into a centrifugal tube, dropwise adding a suspended elution buffer solution TE at the middle part of an adsorption film of a box, placing at 65 ℃ for 2-5 min, centrifuging for 2min, collecting the solution into the centrifugal tube, obtaining a DNA sample;

4) qPCR amplification, namely diluting the DNA sample qualified for quality inspection to a specified concentration by using sterilized water, then respectively constructing a qPCR reaction system, and then carrying out amplification;

2. The method for the identification and analysis of intestinal flora according to claim 1, wherein the reaction system comprises:

3. the method for the identification and analysis of intestinal flora according to claim 1, wherein the reaction system comprises:

4. the method for the identification and analysis of intestinal flora according to claim 1, wherein the reaction system comprises:

5. the method for the identification and analysis of intestinal flora according to claim 1, wherein the reaction system comprises:

6. the method for the identification and analysis of intestinal flora according to claim 1, wherein the reaction system comprises:

7. the method for the identification and analysis of intestinal flora according to claim 1, wherein the reaction system comprises:

8. the method for the identification and analysis of intestinal flora according to claim 1, wherein the reaction system comprises:

9. the method for the identification and analysis of intestinal flora according to claim 1, wherein the reaction system comprises:

10. the method for the identification and analysis of intestinal flora according to claim 1, wherein the amplification reaction conditions are as follows: