CN109504805A - The nucleic acid compositions and kit and detection method of four kinds of enteroviruses of detection simultaneously - Google Patents
The nucleic acid compositions and kit and detection method of four kinds of enteroviruses of detection simultaneously Download PDFInfo
- Publication number
- CN109504805A CN109504805A CN201811626360.7A CN201811626360A CN109504805A CN 109504805 A CN109504805 A CN 109504805A CN 201811626360 A CN201811626360 A CN 201811626360A CN 109504805 A CN109504805 A CN 109504805A
- Authority
- CN
- China
- Prior art keywords
- type
- coxsackie virus
- seq
- detection probe
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Abstract
The present invention relates to a kind of nucleic acid compositions of four kinds of enteroviruses of detection simultaneously and kit and detection methods.The nucleic acid compositions include: sequence A6 type Coxsackie virus amplimer pair as shown in SEQ ID No.1 and SEQ ID No.2；Sequence A10 type Coxsackie virus amplimer pair as shown in SEQ ID No.3 and SEQ ID No.4；Sequence A16 type Coxsackie virus amplimer pair as shown in SEQ ID No.5 and SEQ ID No.6；And sequence EV71 type enterovirus amplimer pair as shown in SEQ ID No.7 and SEQ ID No.8.The nucleic acid compositions can detect A6 type, A10 type and A16 type Coxsackie virus and EV71 type enterovirus simultaneously.
Description
Technical field
The present invention relates to diagnostic techniques fields, more particularly to a kind of nucleic acid compositions for detecting four kinds of enteroviruses simultaneously
And kit and detection method.
Background technique
Enterovirus (human enterovirus, HEV) belongs to Picornaviridae (Picornavirus) enterovirus
Belong to (Enterovi ridae), is the RNA virus of a kind of single-stranded positive, is divided into 4 groups (A~D).The enteron aisle disease mainly studied at present
Poison includes coxsackievirus A16 (coxsackievirus A16, CVA16) and enterovirns type 71 (enterovirus
71, EV71), 10 type of 6 type of Coxsackie virus A group (coxsackievirus A6, CVA6) and Coxsackie virus A group
(coxsackievirus A10, CVA10) is also more and more widely paid close attention to.
In order to which guide is to above-mentioned four kinds of viral research, needs to develop one kind and be able to detect A6 type Coxsack disease
The product of poison, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus.However, traditional detection method
Or testing product single can only detect a kind of Virus Type, when disposably detecting a variety of Virus Types, deposit between a plurality of primer
It is interfering with each other, is leading to primer dimer, false positive, be unfavorable for above-mentioned four kinds of viral research.
Summary of the invention
Based on this, it is necessary to provide nucleic acid compositions that are a kind of while detecting four kinds of enteroviruses, the nucleic acid compositions energy
Enough while detecting A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus.
Further it is provided that a kind of kit and detection method for detecting four kinds of enteroviruses simultaneously.
Nucleic acid compositions that are a kind of while detecting four kinds of enteroviruses, comprising:
Sequence A6 type Coxsackie virus amplimer pair as shown in SEQ ID No.1 and SEQ ID No.2；
Sequence A10 type Coxsackie virus amplimer pair as shown in SEQ ID No.3 and SEQ ID No.4；
Sequence A16 type Coxsackie virus amplimer pair as shown in SEQ ID No.5 and SEQ ID No.6；And
Sequence EV71 type enterovirus amplimer pair as shown in SEQ ID No.7 and SEQ ID No.8.
In above-mentioned nucleic acid compositions, four pairs of virus amplification primer pairs cooperate, and can be avoided mutual between each primer
Interference disposable i.e. while detecting A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus can be realized
With EV71 type enterovirus.Experiment proves that above-mentioned nucleic acid compositions can detect simultaneously A6 type Coxsack disease to a pipe sample
Poison, A10 type Coxsackie virus, A16 type Coxsackie virus and four projects of EV71 type enterovirus save detection time, sensitive
Degree reaches 10copies/mL, and accuracy is high, specificity is good, reproducible.
In one of the embodiments, further include: with the A6 type Coxsackie virus amplimer to corresponding A6 type Ke
Sa Qi viral diagnosis probe detects corresponding A10 type Coxsackie virus with the A10 type Coxsackie virus amplimer and visits
Needle, with the A16 type Coxsackie virus amplimer to corresponding A16 type Coxsackie virus detection probe, with the EV71 type
Enterovirus amplimer is to corresponding EV71 type enterovirus detection probe, the A6 type Coxsackie virus detection probe, institute
State A10 type Coxsackie virus detection probe, the A16 type Coxsackie virus detection probe, EV71 type enterovirus detection
The first fluorescent reporter group, the second fluorescent reporter group, third fluorescent reporter group, the 4th fluorescence report are connected separately on probe
Accuse group, first fluorescent reporter group, second fluorescent reporter group, the third fluorescent reporter group and described the
Four fluorescent reporter groups are different.
The sequence of the A6 type Coxsackie virus detection probe is as shown in SEQ ID No.9 in one of the embodiments,；
The sequence of the A10 type Coxsackie virus detection probe is as shown in SEQ ID No.10；The A16 type Coxsackie virus detection is visited
The sequence of needle is as shown in SEQ ID No.11；The sequence of the EV71 type enterovirus detection probe such as SEQ ID No.12 institute
Show.
First fluorescent reporter group, second fluorescent reporter group, the third in one of the embodiments,
Fluorescent reporter group and the 4th fluorescent reporter group are selected from one of FAM, VIC, TEXAS RED and CY5.
The A6 type Coxsackie virus detection probe, A10 type Coxsackie virus detection in one of the embodiments,
Probe, the A16 type Coxsackie virus detection probe are also respectively connected first in the EV71 type enterovirus detection probe
Fluorescent quenching group, the second fluorescent quenching group, third fluorescent quenching group, the 4th fluorescent quenching group, first fluorescence
Quencher, the second fluorescent quenching group, the third fluorescent quenching group and the 4th fluorescent quenching group select
From one of BHQ1 and BHQ2.
Kit that is a kind of while detecting four kinds of enteroviruses, including above-mentioned while four kinds of enteroviruses of detection nucleic acid group
Close object.
It in one of the embodiments, further include that RNA extracts reagent, dNTPs, PCR reaction solution, enzyme mixation, positive right
According at least one of product and negative controls.
The PCR reaction solution includes the Tris-base of 220mM~280mM, quality percentage in one of the embodiments,
The MgCl of TritonX-100 and 20mmol/L~30mmol/L that content is 0.2%~0.3%2；
And/or the enzyme mixation includes Taq enzyme and reverse transcriptase.
Detection method that is a kind of while detecting four kinds of enteroviruses, includes the following steps:
Using sample to be tested RNA as template, it is multiple that above-mentioned while four kinds of enteroviruses of detection nucleic acid compositions progress are added
Fluorescent quantitative PCR reaction, is tested and analyzed according to reaction result.
In one of the embodiments, the reaction system of multiple fluorescence quantitative PCR amplified reaction include: 25mM dNTPs,
The PCR reaction solution of 5 μ L, 10 μm of ol A6 type Coxsackie virus amplimer the A10 type Coxsackie virus amplification of, 10 μm of ol is drawn
Object is to the A16 type Coxsackie virus amplimer of, 10 μm of ol to the EV71 type enterovirus amplimer of, 20 μm of ol to, 2 μm of ol
A6 type Coxsackie virus detection probe, the A10 type Coxsackie virus detection probe of 4 μm of ol, the A16 type Coxsack disease of 5 μm of ol
EV71 type enterovirus detection probe, the enzyme mixation of 1 μ L and the sample to be tested of 0.5 μ of μ L~5 L of malicious detection probe, 6 μm of ol
RNA；
And/or
The reaction condition of the multiple fluorescence quantitative PCR amplified reaction are as follows: 40 DEG C~50 DEG C reverse transcription 10min~30min；
93 DEG C~95 DEG C initial denaturation 2min~10min；93 DEG C~95 DEG C denaturation 10s~30s, 55 DEG C~60 DEG C annealing, extension, signal are adopted
Collect 30s~60s, recycles 40 times~45 times.
Detailed description of the invention
Fig. 1 is the amplification curve diagram of the positive product to be tested of various concentration in embodiment 2；
Fig. 2 is the amplification curve in the channel FAM of the A6 type Coxsackie virus of various concentration positive product to be tested in embodiment 2
Figure；
Fig. 3 is the amplification curve in the channel VIC of the A10 type Coxsackie virus of various concentration positive product to be tested in embodiment 2
Figure；
Fig. 4 is the expansion in the channel TEXAS RED of the A16 type Coxsackie virus of various concentration positive product to be tested in embodiment 2
Increase curve graph；
Fig. 5 is the amplification curve in the channel CY5 of the EV71 type enterovirus of various concentration positive product to be tested in embodiment 2
Figure；
Fig. 6 is the amplification curve diagram of the positive sample to be tested of experimental group in embodiment 3；
Fig. 7 is the amplification curve diagram of the positive sample to be tested of control group 1 in embodiment 3；
Fig. 8 is the amplification curve diagram of the positive sample to be tested of control group 2 in embodiment 3；
Fig. 9 is the amplification curve diagram of precision product to be tested repeatability detection in embodiment 4；
Figure 10 is the amplification in the channel FAM of the A6 type Coxsackie virus repeatability detection of precision product to be tested in embodiment 4
Curve graph；
Figure 11 is the amplification in the channel VIC of the A10 type Coxsackie virus repeatability detection of precision product to be tested in embodiment 4
Curve graph；
Figure 12 is the channel TEXAS RED of the A16 type Coxsackie virus repeatability detection of precision product to be tested in embodiment 4
Amplification curve diagram；
Figure 13 is the amplification in the channel CY5 of the EV71 type enterovirus repeatability detection of precision product to be tested in embodiment 4
Curve graph；
Figure 14 is the amplification curve diagram of positive product to be tested in embodiment 5；
Figure 15 is the amplification curve diagram of negative product to be tested in embodiment 5；
Figure 16 is the amplification curve diagram of sample to be tested in embodiment 5.
Specific embodiment
In order to make the foregoing objectives, features and advantages of the present invention clearer and more comprehensible, combined with specific embodiments below and
Specific embodiments of the present invention will be described in detail for attached drawing.Be explained in the following description many details in order to
Fully understand the present invention.But the invention can be embodied in many other ways as described herein, art technology
Personnel can do similar improvement without violating the connotation of the present invention, therefore the present invention is not by following public specific implementation
Limitation.
This research detects the nucleic acid compositions of four kinds of enteroviruses, the nucleic acid compositions packet while providing an embodiment
Include sequence A6 type Coxsackie virus amplimer pair as shown in SEQ ID No.1 and SEQ ID No.2；Sequence such as SEQ ID
A10 type Coxsackie virus amplimer pair shown in No.3 and SEQ ID No.4；Sequence such as SEQ ID No.5 and SEQ ID
A16 type Coxsackie virus amplimer pair shown in No.6；And sequence is as shown in SEQ ID No.7 and SEQ ID No.8
EV71 type enterovirus amplimer pair.
Specifically, the sequence as shown in SEQ ID No.1 are as follows: 5'-GTCAGTGAATCTACCACCGGG-3'；Such as SEQ ID
Sequence shown in No.2 are as follows: 5'-CTAGGTACCCAAGCTCTCACRTG-3', annexing base R is A base or G base；
The sequence as shown in SEQ ID No.3 are as follows: 5'-TGTTGGAAACCACTATCAACCAC-3'；Such as SEQ ID No.4
Shown in sequence are as follows: 5'-CGTCCCCCCATCTGTGAG-3'；
The sequence as shown in SEQ ID No.5 are as follows: 5'-GTACTACCTACAGCTGCCAAYACT-3', merger base Y are C
Base or T base；The sequence as shown in SEQ ID No.6 are as follows: 5'-CCGCRGCTTGTAGTGCTG-3', merger base R are A alkali
Base or G base；
The sequence as shown in SEQ ID No.7 are as follows: 5'-CGAGTGCTTATCAATGGTTTTATG-3'；Such as SEQ ID
Sequence shown in No.8 are as follows: 5'-ACATGCCCCGTATTCAAGAT-3'.
Above-mentioned nucleic acid compositions, which can be realized, disposable i.e. while detecting the A6 type Coxsackie virus in sample to be tested, A10
Type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus save detection time, the high sensitivity of detection and spy
It is anisotropic good.
In a wherein embodiment, sample to be tested is experiment viral diagnosis product.
Detect the nucleic acid compositions of four kinds of enteroviruses simultaneously in one of the embodiments, further include: with A6 type Ke's Sa
The corresponding A6 type Coxsackie virus detection probe of odd virus amplification primer pair, with A10 type Coxsackie virus amplimer to corresponding
A10 type Coxsackie virus detection probe, with A16 type Coxsackie virus amplimer corresponding A16 type Coxsackie virus is examined
Probing needle and EV71 type enterovirus amplimer are to EV71 type enterovirus detection probe.The detection of A6 type Coxsackie virus is visited
Needle, A10 type Coxsackie virus detection probe, A16 type Coxsackie virus detection probe, in EV71 type enterovirus detection probe point
It is not connected with the first fluorescent reporter group, the second fluorescent reporter group, third fluorescent reporter group, the 4th fluorescent reporter group.
First fluorescent reporter group, the second fluorescent reporter group, third fluorescent reporter group and the 4th fluorescent reporter group are different.
By setting different the first fluorescent reporter group, the second fluorescent reporter group, third fluorescent reporter group and the
Four fluorescent reporter groups, convenient in fluorescent PCR pass through different fluorescence signal channels respectively detect judgement sample in whether on
Four kinds of enteroviruses are stated, and determine the type of contained enterovirus.
First fluorescent reporter group, the second fluorescent reporter group, third fluorescent reporter group in one of the embodiments,
And the 4th fluorescent reporter group be selected from one of FAM, VIC, TEXAS RED and CY5.It should be noted that the first fluorescence
Reporter group, the second fluorescent reporter group, third fluorescent reporter group and the 4th fluorescent reporter group are not limited to above-mentioned point out
Fluorescent reporter group, or other fluorescent reporter groups.
Further, A6 type Coxsackie virus detection probe, A10 type Coxsackie virus detection probe, A16 type Coxsack disease
The first fluorescent quenching group, the second fluorescent quenching is also respectively connected in malicious detection probe, EV71 type enterovirus detection probe
Group, third fluorescent quenching group, the 4th fluorescent quenching group.Further, the first fluorescent quenching group, the second fluorescence are sudden
Go out group, third fluorescent quenching group and the 4th fluorescent quenching group is selected from one of BHQ1 and BHQ2.
It should be noted that the first fluorescent quenching group, the second fluorescent quenching group, third fluorescent quenching group, the 4th
Fluorescent quenching group is not limited to the above-mentioned fluorescent quenching group pointed out, or other fluorescent quenching groups.It needs to illustrate
, the first fluorescent quenching group, the second fluorescent quenching group, third fluorescent quenching group, the 4th fluorescent quenching group can be with
It is identical, it can also be different.
In a specific example, the first fluorescent reporter group is FAM.Second fluorescent reporter group is VIC.Third fluorescence
Reporter group is TEXAS RED.4th fluorescent reporter group is CY5.First fluorescent quenching group and the second fluorescent quenching group
It is BHQ1；Third fluorescent quenching group and the 4th fluorescent quenching group are BHQ2.
In a specific example, the sequence of A6 type Coxsackie virus detection probe is as shown in SEQ ID No.9, specifically
Ground, the sequence as shown in SEQ ID No.9 are as follows: 5'-CATCCACGTTCGGGTGTACATGAGAA-3'；
The sequence of A10 type Coxsackie virus detection probe is as shown in SEQ ID No.10, specifically, such as SEQ ID No.10
Shown in sequence are as follows: 5'-CTTCTCCCGCTCTGGATTAGTGGGAGT-3'；
The sequence of A16 type Coxsackie virus detection probe is as shown in SEQ ID No.11, specifically, such as SEQ ID No.11
Shown in sequence are as follows: 5'-CAAGTAGTCACAGATTAGGCACTGGTGTTGT-3'；
The sequence of EV71 type enterovirus detection probe is as shown in SEQ ID No.12, specifically, such as SEQ ID No.12
Shown in sequence are as follows: 5'-CCCACATTCGGAGAACACAAACAGGAG-3'.
Above-mentioned four groups of probes can act synergistically with four groups of primers, realize and be disposably while detecting A6 type Coxsack disease
Poison, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus save detection time, the sensitivity of detection
High and specificity is good.
Certainly, it should be noted that the sequence of above-mentioned A6 type Coxsackie virus detection probe is not limited to the above-mentioned sequence pointed out
Column, or other sequences, as long as being able to detect A6 type Coxsackie virus.Above-mentioned A10 type Coxsackie virus detection is visited
The sequence of needle is not limited to the above-mentioned sequence pointed out, or other sequences, as long as being able to detect A10 type Coxsackie virus i.e.
It can.The sequence of above-mentioned A16 type Coxsackie virus detection probe is not limited to the above-mentioned sequence pointed out, or other sequences, only
It is able to detect A16 type Coxsackie virus.The sequence of above-mentioned EV71 type enterovirus detection probe is not limited to above-mentioned point out
Sequence, or other sequences, as long as being able to detect EV71 type enterovirus.
Nucleic acid compositions are uniformly mixed mixture in one of the embodiments,.The amplification of A6 type Coxsackie virus is drawn
The molar ratio of object pair and A6 type Coxsackie virus detection probe is 5:1；A10 type Coxsackie virus amplimer pair and A10 type Ke
The molar ratio of Sa Qi viral diagnosis probe is 5:2；A16 type Coxsackie virus amplimer pair and A16 type Coxsackie virus detect
The molar ratio of probe is 2:1；EV71 type enterovirus amplimer pair and the molar ratio of EV71 type enterovirus detection probe are
10:3；A6 type Coxsackie virus detection probe, A10 type Coxsackie virus detection probe, A16 type Coxsackie virus detection probe
The molar ratio of EV71 type enterovirus detection probe is 2:4:5:6.The detection reagent high sensitivity of the mixing match, specificity
It is good, it can be realized fast to A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus
The A6 type Coxsackie virus in the same sample, A10 type Coxsackie virus, A16 type Coxsack disease are realized while being detected in speed amplification
Poison and EV71 type enterovirus.
In above-mentioned nucleic acid compositions, four pairs of virus amplification primer pairs cooperate, and can be realized and disposable i.e. while detecting
A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus.Above-mentioned nucleic acid compositions
By realizing the detection of the diagnosing and treating of non-disease to above-mentioned four kinds of virus, can effectively instruct viral to above-mentioned four kinds
Research.Experiment proves that above-mentioned nucleic acid compositions can detect simultaneously A6 type Coxsackie virus, A10 type to a pipe test sample to be checked
Four Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus projects, save detection time, and sensitivity reaches
10copies/mL, accuracy is high, specificity is good.
Furthermore the design of four pairs of virus amplification primer pairs and four corresponding detection probes in above-mentioned nucleic acid compositions is closed
Reason, a pipe test sample to be checked can be detected simultaneously A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus and
Four projects of EV71 type enterovirus, need to only operate once reduces the chance that pollution generates, and guarantees the accuracy of detection, has
Conducive to the research to enterovirus.
The kit of four kinds of enteroviruses is detected while one embodiment, which includes above-mentioned while four kinds of detection
The nucleic acid compositions of enterovirus.
In one of the embodiments, kit further include RNA extract reagent, dNTPs, PCR reaction solution, enzyme mixation,
At least one of positive reference substance and negative controls.
PCR reaction solution is RT-PCR reaction solution in one of the embodiments,.PCR reaction solution includes 220mM~280mM
Tris-base, mass percentage be 0.2%~0.3% TritonX-100,20mmol/L~30mmol/L
MgCl2.Further, PCR reaction solution includes the Tris-base of 250mM, the TritonX- that mass percentage is 0.25%
The MgCl of 100 and 25mmol/L2。
Enzyme mixation includes hot start Taq polymerase and reverse transcriptase in one of the embodiments,.Further, Taq enzyme and
The volume ratio of reverse transcriptase is 4:1.Specifically, Taq enzyme is hot start Taq polymerase.Reverse transcriptase is MMLV reverse transcriptase.
Further, enzyme mixation further includes RNase inhibitor.The volume ratio of RNase inhibitor and Taq enzyme is 3:4.
Positive reference substance includes the plasmid reverse transcription containing A6 type Coxsackie virus target sequence in one of the embodiments,
The RNA (being named as A6 type Coxsackie virus positive criteria product) of formation, the plasmid containing A10 type Coxsackie virus target sequence reverse
Record the RNA (being named as A10 type Coxsackie virus positive criteria product) formed, the plasmid containing A16 type Coxsackie virus target sequence
The RNA (being named as A16 type Coxsackie virus positive criteria product) of reverse transcription formation, the matter containing EV71 type enterovirus target sequence
The RNA (being named as EV71 type enterovirus positive criteria product) that grain reverse transcription is formed.
Specifically, the preparation process of positive reference substance is as follows: extracting A6 type Coxsackie virus, A10 type Coxsack disease respectively
Poison, A16 type Coxsackie virus and EV71 type enterovirus RNA as reverse transcription PCR template, respectively with corresponding primer by phase
The target sequence answered is expanded；Amplified production is connected into carrier, obtains the matter containing A6 type Coxsackie virus target sequence respectively
Grain, contains EV71 type at the plasmid containing A10 type Coxsackie virus target sequence, the plasmid containing A16 type Coxsackie virus target sequence
The plasmid of enterovirus target sequence；Above-mentioned plasmid is subjected to reverse transcription respectively, obtains corresponding RNA, that is, contains A6 type Coxsack
The RNA that the plasmid reverse transcription of Virus target sequence is formed, the plasmid reverse transcription containing A10 type Coxsackie virus target sequence are formed
RNA that RNA, plasmid reverse transcription containing A16 type Coxsackie virus target sequence are formed, contain EV71 type enterovirus target sequence
The RNA that plasmid reverse transcription is formed.Further, carrier is pUC57-Kan carrier.
In a specific example, the preparation process of positive reference substance is as follows: respectively as shown in SEQ ID No.13
CA6 synthesize segment, the CA10 as shown in SEQ ID No.14 synthesis segment, the CA16 as shown in SEQ ID No.15 synthesis segment and
It is template that the EV71 as shown in SEQ ID No.16, which synthesizes segment, is respectively expanded corresponding amplified fragments with corresponding primer
Increase；Amplified production is connected into carrier, the plasmid containing A6 type Coxsackie virus amplified fragments is obtained respectively, contains A10 type Ke
The plasmid of Sa Qi virus amplification segment, the plasmid containing A16 type Coxsackie virus amplified fragments expand containing EV71 type enterovirus
Increase the plasmid of segment；Above-mentioned plasmid is subjected to reverse transcription respectively, obtains corresponding RNA, as A6 type Coxsackie virus positive mark
Quasi- product, A10 type Coxsackie virus positive criteria product, A16 type Coxsackie virus positive criteria product, EV71 type enterovirus positive mark
Quasi- product.
Wherein, the amplified fragments of A6 type Coxsackie virus are as shown in SEQ ID No.17；The amplification of A10 type Coxsackie virus
Segment is as shown in SEQ ID No.18；The amplified fragments of A16 type Coxsackie virus are as shown in SEQ ID No.19；EV71 type enteron aisle
The amplified fragments of virus are as shown in SEQ ID No.20.
Specifically, the sequence as shown in SEQ ID No.13 is 5'-ACCAATTTGCAATATGGGCAGTGCCCTAACAA
CATGATGGGCCACTTTGCCATCCGAACAGTCAGCGAATCTACCACCGGGAAAAACGTCCACGTTCGGGTGTACATG
AGAATTAAGCACGTGAGAGCTTGGGTACCTAGACCCCTTCGATCCCAAGCTTATATGGTCAAGAATTACCCGACAT
ACAGCC-3'；
The sequence as shown in SEQ ID No.14 is 5'-ACGGGTGCCACTTCTAATGCCACAGATGAGAACATGATT
GAGACCCGTTGTGTGGTTAACAGAAATGGAGTGTTGGAAACCACTATCAACCACTTCTTCTCCCGCTCTGGATTAG
TGGGAGTAGTTAACCTTACAGATGGGGGGACGGACACTACTGGGTATGCCACATGGGACATAGACATTATGGGCTT
TGTCCAACTCCGCAGAAAATGCGAGATGTTCACATA-3'；
The sequence as shown in SEQ ID No.15 is 5'-CAAGTGAATCGCTCCTTGACTGCGTTGCAAGTACTACCT
ACAGCTGCCAACACTGAAGCAAGCAGTCACAGATTAGGCACTGGTGTTGTACCAGCTCTACAAGCCGCGGAGACAG
GGGCGTCGTCTAATGCTAGTGACAAGAATCTCATTGAGACTAGATGTGTGTTGAACCATCACTCCAC-3'；
The sequence as shown in SEQ ID No.16 is 5'-AGGGAATCCCTTGCATGGCAAACCGCCACTAACCCCTCA
GTTTTTGTCAAGCTGTCAGACCCTCCAGCGCAGGTTTCAGTGCCATTCATGTCACCTGCGAGTGCTTATCAATGGT
TTTATGACGGATATCCCACATTCGGAGAACACAAACAGGAGAAAGATCTTGAATACGGGGCATGTCCTAATAACAT
GATGGGCACGTTCTCAGTGCGGACTGTGGGGACCTCCAAGTCCAAGTACCCTTTAGTGGTTAGGAT-3'；
The sequence as shown in SEQ ID No.17 is 5'-GTCAGCGAATCTACCACCGGGAAAAACGTCCACGTTCGG
GTGTACATGAGAATTAAGCACGTGAGAGCTTGGGTACCTAG-3'；
The sequence as shown in SEQ ID No.18 is 5'-TGTTGGAAACCACTATCAACCACTTCTTCTCCCGCTCTG
GATTAGTGGGAGTAGTTAACCTTACAGATGGGGGGACG-3'；
The sequence as shown in SEQ ID No.19 is 5'-GTACTACCTACAGCTGCCAACACTGAAGCAAGCAGTCAC
AGATTAGGCACTGGTGTTGTACCAGCTCTACAAGCCGCGG-3'；
The sequence as shown in SEQ ID No.20 is 5'-CGAGTGCTTATCAATGGTTTTATGACGGATATCCCACAT
TCGGAGAACACAAACAGGAGAAAGATCTTGAATACGGGGCATGT-3'。
Negative control is without containing A6 type Coxsackie virus, A10 type Coxsackie virus, A16 in one of the embodiments,
The normal saline solution of type Coxsackie virus and EV71 type enterovirus.It should be noted that negative control may be to be free of
There are A6 type Coxsackie virus gene, A10 type Coxsackie virus gene, A16 type Coxsackie virus gene and EV71 type enterovirus
The normal saline solution of gene.
Kit that is above-mentioned while detecting four kinds of enteroviruses can detect simultaneously A6 type Coxsack to a pipe test sample to be checked
Virus, A10 type Coxsackie virus, A16 type Coxsackie virus and four projects of EV71 type enterovirus, detection time is short, detection
High sensitivity, accuracy is high, specificity is good, reproducible, there is directive significance to above-mentioned four kinds of viral research.
The detection method that four kinds of enteroviruses are detected while one embodiment, includes the following steps: with sample to be tested RNA
For template, above-mentioned while four kinds of enteroviruses of detection nucleic acid compositions are added and carry out multiple fluorescence quantitative PCR amplified reaction, root
It is tested and analyzed according to reaction result.
In one of the embodiments, the reaction system of multiple fluorescence quantitative PCR amplified reaction include: 25mM dNTPs,
The PCR reaction solution of 5 μ L, 10 μm of ol A6 type Coxsackie virus amplimer the A10 type Coxsackie virus amplification of, 10 μm of ol is drawn
Object is to the A16 type Coxsackie virus amplimer of, 10 μm of ol to the EV71 type enterovirus amplimer of, 20u mol to, 2 μ
The A6 type Coxsackie virus detection probe of mol, the A10 type Coxsackie virus detection probe of 4 μm of ol, the A16 type Coxsack of 5 μm of ol
Viral diagnosis probe, the EV71 type enterovirus detection probe of 6 μm of ol, the enzyme mixation of 1 μ L and 0.5 μ of μ L~5 L to test sample
This RNA.
The reaction condition of multiple fluorescence quantitative PCR amplified reaction in one of the embodiments, are as follows: 40 DEG C~50 DEG C reverses
Record 10min~30min；93 DEG C~95 DEG C initial denaturation 2min~10min；93 DEG C~95 DEG C denaturation 10s~30s, 55 DEG C~60 DEG C
Annealing extends, signal acquisition 30s~60s, recycles 40 times~45 times.
Multiple fluorescence quantitative PCR amplified reaction carries out in multiple fluorescence quantitative PCR instrument in one of the embodiments,.
Further, multiple fluorescence quantitative PCR instrument is ABI series multiple fluorescence quantitative PCR instrument, Bio-Rad series (ICycler/MJ
Opticon 2) multiple fluorescence quantitative PCR instrument, Stratagene MX series multiple fluorescence quantitative PCR instrument, Roche
Lightcycler multiple fluorescence quantitative PCR instrument, Ccpheid smartcycler multiple fluorescence quantitative PCR instrument, Corbett
Day series multiple fluorescence quantitative PCR instrument is won in Rortor-Gene multiple fluorescence quantitative PCR instrument, Hangzhou.It should be noted that multiple
Fluorescence quantitative PCR instrument is not limited to the above-mentioned PCR instrument pointed out, other multiple fluorescence quantitative PCR instrument also can be used in this research.
Specifically, while the detection method of four kinds of enteroviruses of detection includes the following steps S110~S120:
S110, using sample to be tested RNA as template, above-mentioned while four kinds of enteroviruses of detection nucleic acid compositions are added and carry out
Multiple fluorescence quantitative PCR amplified reaction obtains the amplification curve and Ct of sample to be tested.
S110 includes: and above-mentioned each virus amplification is added and draws using sample to be tested RNA as template in one of the embodiments,
Object to above-mentioned each viral diagnosis probe, collect the first fluorescence channel, the second fluorescence channel, third fluorescence channel and the 4th fluorescence
The fluorescence signal in channel obtains corresponding first amplification curve of the first fluorescence channel and Ct1, the second fluorescence channel corresponding second
Amplification curve and corresponding 4th amplification of the corresponding third amplification curve of Ct2, third fluorescence channel and Ct3, the 4th fluorescence channel
Curve and Ct4, the first fluorescence channel, the second fluorescence channel, third fluorescence channel and the 4th fluorescence channel correspond respectively to A6 type
Coxsackie virus detection probe, A10 type Coxsackie virus detection probe, A16 type Coxsackie virus detection probe and EV71 type intestines
Road viral diagnosis probe.
It further include the step that sample to be tested RNA is extracted from sample to be tested in one of the embodiments, before S110
Suddenly.It should be noted that the step of then extracting sample to be tested RNA, can be omitted when sample to be tested is RNA.
S120, amplification curve and Ct are analyzed, if amplification curve is S-shaped, and Ct value is less than or equal to 38, then to be measured
Sample contains in A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus extremely
Few one kind.
In one of the embodiments, S120 include: to the first amplification curve, the second amplification curve, third amplification curve,
4th amplification curve, Ct1, Ct2, Ct3 and Ct4 are analyzed；If the first amplification curve is S-shaped, and Ct1 value is less than or equal to
38, then sample to be tested contains A6 type Coxsackie virus；If the second amplification curve is S-shaped, and Ct2 value be less than or equal to 38, then to
Sample contains A10 type Coxsackie virus；If third amplification curve is S-shaped, and Ct3 value is less than or equal to 38, then sample to be tested
Contain A16 type Coxsackie virus；If the 4th amplification curve is S-shaped, and Ct4 value is less than or equal to 38, then sample to be tested contains
EV71 type enterovirus.
Detection method that is above-mentioned while detecting four kinds of enteroviruses can detect simultaneously A6 type Ke's Sa to a pipe test sample to be checked
Odd virus, A10 type Coxsackie virus, A16 type Coxsackie virus and four projects of EV71 type enterovirus, detection time is short, inspection
The high sensitivity of survey, accuracy is high, specificity is good, reproducible.
The following are specific embodiment parts:
It in embodiment if not otherwise indicated using reagent and instrument, is this field conventional selection.It is not specified in embodiment
The experimental method of actual conditions, usually according to normal condition, such as condition described in document, books or kit factory
The method that family is recommended is realized.Reagent used in embodiment is commercially available.
Embodiment 1
Kit that is a kind of while detecting four kinds of enteroviruses is provided.
Kit includes RT-PCR reaction solution while nucleic acid compositions, the enzyme mixation, the positive for detecting four kinds of enteroviruses
Control and negative control.
Wherein, RT-PCR reaction solution includes the Tris-base of 250mM, the TritonX- that mass percentage is 0.25%
100, the MgCl of 25mmol/L2。
Nucleic acid compositions include:
Sequence A6 type Coxsackie virus amplimer pair as shown in SEQ ID No.1 and SEQ ID No.2；
Sequence A10 type Coxsackie virus amplimer pair as shown in SEQ ID No.3 and SEQ ID No.4；
Sequence A16 type Coxsackie virus amplimer pair as shown in SEQ ID No.5 and SEQ ID No.6；
Sequence EV71 type enterovirus amplimer pair as shown in SEQ ID No.7 and SEQ ID No.8；
Sequence A6 type Coxsackie virus detection probe as shown in SEQ ID No.9, A6 type Coxsackie virus detection probe
Both ends be connected separately with FAM and BHQ1；
Sequence A10 type Coxsackie virus detection probe as shown in SEQ ID No.10, the detection of A10 type Coxsackie virus are visited
The both ends of needle are connected separately with VIC and BHQ1；
Sequence A16 type Coxsackie virus detection probe as shown in SEQ ID No.11, the detection of A16 type Coxsackie virus are visited
The both ends of needle are connected separately with TEXAS RED and BHQ2；
Sequence EV71 type enterovirus detection probe as shown in SEQ ID No.12, EV71 type enterovirus detection probe
Both ends be connected separately with CY5 and BHQ2.
Enzyme mixation includes hot start Taq polymerase, MMLV reverse transcriptase, RNase inhibitor.
Positive reference substance includes the RNA of the plasmid reverse transcription formation containing A6 type Coxsackie virus target sequence, contains A10 type
The RNA of the plasmid reverse transcription formation of Coxsackie virus target sequence, the plasmid reverse transcription shape containing A16 type Coxsackie virus target sequence
At RNA, the RNA that is formed of plasmid reverse transcription containing EV71 type enterovirus target sequence.
Specifically, the preparation process of positive reference substance is as follows: respectively with the CA6 answer print as shown in SEQ ID No.13
Section, the synthesis of the CA10 as shown in SEQ ID No.14 segment, the synthesis segment of the CA16 as shown in SEQ ID No.15 and such as SEQ ID
It is template that EV71 shown in No.16, which synthesizes segment, is respectively expanded corresponding amplified fragments with corresponding primer；It will amplification
Product is connected into pUC57-Kan carrier, is obtained the plasmid containing A6 type Coxsackie virus amplified fragments respectively, is contained A10 type Ke
The plasmid of Sa Qi virus amplification segment, the plasmid containing A16 type Coxsackie virus amplified fragments expand containing EV71 type enterovirus
Increase the plasmid of segment；Above-mentioned plasmid is subjected to reverse transcription respectively, obtains corresponding RNA, as A6 type Coxsackie virus positive mark
Quasi- product, A10 type Coxsackie virus positive criteria product, A16 type Coxsackie virus positive criteria product, EV71 type enterovirus positive mark
Quasi- product.Wherein, the amplified fragments of A6 type Coxsackie virus are as shown in SEQ ID No.17；The amplification piece of A10 type Coxsackie virus
Section is as shown in SEQ ID No.18；The amplified fragments of A16 type Coxsackie virus are as shown in SEQ ID No.19；EV71 type enteron aisle disease
The amplified fragments of poison are as shown in SEQ ID No.20.
Negative control is without containing A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71
The normal saline solution of type enterovirus.
Embodiment 2
The sensitivity of the kit of four kinds of enteroviruses of detection while measuring embodiment 1
(1) by A6 type Coxsackie virus positive criteria product, A10 type Coxsackie virus positive mark in the kit of embodiment 1
Quasi- product, A16 type Coxsackie virus positive criteria product, EV71 type enterovirus positive criteria product mix and are made into mixed liquor, obtain
Positive product to be tested.
(2) 10 times of gradient dilution (i.e. 10copies/mL~10 are carried out to positive product to be tested5Copies/mL), using implementation
The kit of example 1 carries out multiple fluorescence quantitative PCR detection, multiple fluorescence quantitative PCR reaction to the positive product to be tested under each gradient
System it is as shown in table 1.The reaction condition of multiple fluorescence quantitative PCR reaction are as follows: 50 DEG C of reverse transcription 15min；95 DEG C of initial denaturations
3min；95 DEG C of denaturation 15s, 55 DEG C of annealing extend, signal acquisition 40s, recycle 40 times.
(3) interpretation of result: judging the yin and yang attribute of testing result by the size of fluorescent amplification curve figure and Ct value, determines
Whether contain A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus, EV71 type enterovirus in sample.
Specifically, when value≤38 amplification curve diagram Ct, and when amplification curve obvious exponential increase (i.e. the S type) of presentation, sun is as a result shown as
Property；When value > 38 amplification curve diagram Ct or without Ct value, feminine gender is as a result shown as.Testing result is as shown in Fig. 1~5.
Wherein, Fig. 1 is the amplification curve diagram of the positive product to be tested of various concentration in embodiment 2.Fig. 2 be embodiment 2 in not
With the amplification curve diagram in the channel FAM of the A6 type Coxsackie virus of concentration positive product to be tested, arrow (2-1), arrow (2- in Fig. 2
2), arrow (2-3), arrow (2-4), arrow (2-5) meaning curve respectively correspond concentration be 105copies/mL、
104copies/mL、103copies/mL、102Amplification curve under copies/mL, 10copies/mL.Fig. 3 is in embodiment 2
The amplification curve diagram in the channel VIC of the A10 type Coxsackie virus of various concentration positive product to be tested, arrow (3-1), arrow in Fig. 3
(3-2), arrow (3-3), arrow (3-4), arrow (3-5) meaning curve respectively correspond concentration be 105copies/mL、
104copies/mL、103copies/mL、102Amplification curve under copies/mL, 10copies/mL.Fig. 4 is in embodiment 2
The amplification curve diagram in the channel TEXAS RED of the A16 type Coxsackie virus of various concentration positive product to be tested, arrow (4- in Fig. 4
1), arrow (4-2), arrow (4-3), arrow (4-4), arrow (4-5) meaning curve respectively correspond concentration be 105copies/
mL、104copies/mL、103copies/mL、102Amplification curve under copies/mL, 10copies/mL.Fig. 5 is embodiment 2
The amplification curve diagram in the channel CY5 of the EV71 type enterovirus of middle various concentration positive product to be tested, arrow (5-1), arrow in Fig. 5
(5-2), arrow (5-3), arrow (5-4), arrow (5-5) meaning curve respectively correspond concentration be 105copies/mL、
104copies/mL、103copies/mL、102Amplification curve under copies/mL, 10copies/mL.
The system of 1 multiple fluorescence quantitative PCR of table reaction
Wherein, hot start Taq polymerase in reaction system, MMLV reverse transcriptase, RNase inhibitor volume ratio be 4:1:3.
ddH2O is distilled water.All reagents in reaction system are placed on progress multiple fluorescence quantitative PCR detection in same reaction tube.
It will be seen from figure 1 that the kit of embodiment 1 can disposably detect A6 type Ke in a sample to be tested simultaneously
Sa Qi virus, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus save detection time.
From Fig. 2~5 as can be seen that A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71
Type enterovirus is in 10copies/mL~105Amplification curve within the scope of copies/mL is in good linear relationship, and four kinds
The detection sensitivity of virus reaches 10copies/mL, and sensitivity is higher.
Embodiment 3
(1) by A6 type Coxsackie virus positive criteria product, A10 type Coxsackie virus positive mark in the kit of embodiment 1
Quasi- product, A16 type Coxsackie virus positive criteria product, EV71 type enterovirus positive criteria product mix and are made into mixed liquor, obtain
Positive product to be tested；Physiological saline without above-mentioned four kinds of enterovirus positive reference substances is negative product to be tested.
(2) experiment is divided into experimental group, control group 1 and control group 2, and the kit of experimental group is the kit of embodiment 1.It is right
It is roughly the same with the kit of embodiment 1 according to the kit of group 1, the difference is that, EV71 type enterovirus amplimer pair
Sequence as shown in SEQ ID No.21 and SEQ ID No.22, and with EV71 type enterovirus amplimer to corresponding EV71
The sequence of type enterovirus detection probe is as shown in SEQ ID No.23.Specifically, the sequence as shown in SEQ ID No.21 are as follows:
5'-CTTATCAATGGTTTTATGACGGATA-3'；The sequence as shown in SEQ ID No.22 are as follows: 5'-
TGTTATTAGGACATGCTCCGTATT-3'；The sequence as shown in SEQ ID No.23 are as follows: 5'-CACATTCGGAGAACACAA
ACAGGAGAAAGATCTT-3'.The kit of control group 2 is roughly the same with the kit of embodiment 1, the difference is that, A10
The sequence of type Coxsackie virus amplimer pair as shown in SEQ ID No.24 and SEQ ID No.25, and with A10 type Coxsack
The sequence of the corresponding A10 type Coxsackie virus detection probe of virus amplification primer pair is as shown in SEQ ID No.26.Specifically, such as
Sequence shown in SEQ ID No.24 are as follows: 5'-GTTGGAAACCACTATCAACCACT-3'；The sequence as shown in SEQ ID No.25
It is classified as: 5'-CCCCCCATCTGTAAGGTTA-3'；The sequence as shown in SEQ ID No.26 are as follows: 5'-
CACTTCTTCTCCCGCTCTGGATTAGTGG-3'。
(3) using the kit of the kit of experimental group, the kit of control group 1 and control group 2 to positive product to be tested and
Negative product to be tested carries out multiple fluorescence quantitative PCR detection, and reaction system, reaction condition and interpretation of result are same as Example 2.
Testing result is as can be seen from figures 6 to 8.
Wherein, Fig. 6 is the amplification curve diagram of the positive sample to be tested of experimental group in embodiment 3, arrow (6-1) institute in Fig. 6
Refer to that curve is the amplification curve of A6 type Coxsackie virus, the signified curve of arrow (6-2) is the expansion of A10 type Coxsackie virus in Fig. 6
Increase curve, the signified curve of arrow (6-3) is the amplification curve of A16 type Coxsackie virus in Fig. 6, and arrow (6-4) is signified bent in Fig. 6
Line is the amplification curve of EV71 type enterovirus.Fig. 7 is the amplification curve diagram of the positive sample to be tested of control group 1 in embodiment 3,
Arrow (7-1) meaning curve is the amplification curve of A6 type Coxsackie virus in Fig. 7, and the signified curve of arrow (7-2) is A10 in Fig. 7
The amplification curve of type Coxsackie virus, the signified curve of arrow (7-3) is the amplification curve of A16 type Coxsackie virus, Fig. 7 in Fig. 7
The signified curve of middle arrow (7-4) is the amplification curve of EV71 type enterovirus.Fig. 8 is that the positive of control group 2 in embodiment 3 is to be measured
The amplification curve diagram of sample, the signified curve of arrow (8-1) is the amplification curve of A6 type Coxsackie virus, arrow in Fig. 8 in Fig. 8
(8-2) meaning curve is the amplification curve of A10 type Coxsackie virus, the signified curve EV71 type enterovirus of arrow (8-4) in Fig. 8
Amplification curve.
From fig. 6, it can be seen that experimental group obtains four S type amplification curves, while negative product to be tested is without amplification curve, explanation
The kit of experimental group can detect simultaneously A6 type Coxsackie virus in positive sample to be tested, A10 type Coxsackie virus,
A16 type Coxsackie virus and EV71 type enterovirus, while being not in non-specific amplification curve.
From figure 7 it can be seen that control group 1 obtains four S type amplification curves, it is to be measured to illustrate that control group can detect simultaneously
A6 type Coxsackie virus, A10 type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus in sample, but
There are false positive amplification curve, illustrate that four pairs of primers of control group 1 and four probes carry out being easy when enterovirus detection
Existing false positive.
From figure 8, it is seen that control group 2 obtains three S type amplification curves, amplification A16 type Coxsackie virus sun is had not been able to
Property standard items, illustrate between four pairs of primers of control group 1 and four probes exist interfere with each other, cause to fail to detect simultaneously
State four kinds of enteroviruses.
Embodiment 4
By A6 type Coxsackie virus positive criteria product, A10 type Coxsackie virus positive criteria in the kit of embodiment 1
Product, A16 type Coxsackie virus positive criteria product, EV71 type enterovirus positive criteria product mix and are made into mixed liquor, obtain sun
Property product to be tested.Positive product to be tested is subjected to 10 times of gradient dilutions, obtains precision product to be tested, the kit used in embodiment 1
Multiple fluorescence quantitative PCR amplification is carried out, expands 10 multiple holes of precision product to be tested, testing result is as shown in Fig. 9~13.Fig. 9 is
The amplification curve diagram that precision product to be tested repeatability detects in embodiment 4.Figure 10 is the A6 type of precision product to be tested in embodiment 4
The amplification curve diagram in the channel FAM of Coxsackie virus repeatability detection.Figure 11 is the A10 type of precision product to be tested in embodiment 4
The amplification curve diagram in the channel VIC of Coxsackie virus repeatability detection.Figure 12 is the A16 type of precision product to be tested in embodiment 4
The amplification curve diagram in the channel TEXAS RED of Coxsackie virus repeatability detection.Figure 13 is precision product to be tested in embodiment 4
The amplification curve diagram in the channel CY5 of EV71 type enterovirus repeatability detection.
From Fig. 9~13 as can be seen that the precision in each channel of kit of above embodiment is all very good, CT value is exported
Data calculate and obtain precision≤3%, and the amplification repeatability of the kit is very good.
Embodiment 5
(1) by A6 type Coxsackie virus positive criteria product, A10 type Coxsackie virus positive mark in the kit of embodiment 1
Quasi- product, A16 type Coxsackie virus positive criteria product, EV71 type enterovirus positive criteria product mix and are made into mixed liquor, obtain
Positive product to be tested, the concentration of positive product to be tested are 105copies/mL.Negative control be without A6 type Coxsackie virus gene,
The physiological saline of A10 type Coxsackie virus gene, A16 type Coxsackie virus gene and EV71 type enterovirus gene.
(2) totally 15, sample to be extracted, respectively 3 A6 type Coxsackie virus samples, 1 A10 type Coxsackie virus sample
This, 3 A16 type Coxsackie virus samples, 4 EV71 type enterovirus samples, 1 A2 type Coxsackie virus sample, 2 rubeolas
Virus Sample and 1 measles virus sample, all sample standard deviations are from Shenzhen Longhua District Disease Control and Prevention Center.It is mentioned using viral RNA
It takes kit (purchased from TIANGEN Biotech (Beijing) Co., Ltd.) to extract the RNA in each sample to be extracted respectively, obtains corresponding
Sample to be tested.
(3) use the kit of embodiment 1 to positive product to be tested, negative control product to be tested and step (2) respectively to test sample
Product carry out carrying out multiple fluorescence quantitative PCR detection, and reaction system, reaction condition and interpretation of result are same as Example 2.Measurement knot
Fruit is as shown in Figure 14~16.Figure 14 is the amplification curve diagram of positive product to be tested in embodiment 5, and arrow (14-1) is signified bent in Figure 14
Line is the amplification curve of A6 type Coxsackie virus, and the signified curve of arrow (14-2) is the amplification of A10 type Coxsackie virus in Figure 14
Curve, the signified curve of arrow (14-2) is the amplification curve of A16 type Coxsackie virus in Figure 14, and arrow (14-4) is signified in Figure 14
Curve is the amplification curve of EV71 type enterovirus.Figure 15 is the amplification curve diagram of negative control product to be tested in embodiment 5.Figure 16
For the amplification curve diagram of sample to be tested in embodiment 5.
From Figure 14~15 as can be seen that the kit of embodiment 1 is capable of detecting when four kinds of viruses in positive product to be tested, yin
Property product to be tested does not detect, and illustrates the kit of embodiment 1 specificity with higher.
As can be seen from Figure 16, sample to be tested is detected by the kit of embodiment 1,3 A6 can have been detected
Type Coxsackie virus sample, 1 A10 type Coxsackie virus sample, 3 A16 type Coxsackie virus samples and 4 EV71 type enteron aisles
Virus Sample；A2 type Coxsackie virus, rubella virus and measles virus are not detected, and detect sample accuracy rate up to 100%.
In conclusion the kit for detecting four kinds of enteroviruses while above embodiment can be to a pipe sample simultaneously
Detect A6 type Coxsackie virus, four A10 type Coxsackie virus, A16 type Coxsackie virus and EV71 type enterovirus projects, inspection
The survey time is short, and the high sensitivity of detection, accuracy is high, specificity is good, reproducible, guidance meaning with higher to clinical application
Justice.
Each technical characteristic of embodiment described above can be combined arbitrarily, for simplicity of description, not to above-mentioned reality
It applies all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited
In contradiction, all should be considered as described in this specification.
The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously
It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art
It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to protection of the invention
Range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.
Sequence table
<110>Shenzhen Ai Weidi Biotechnology Co., Ltd
<120>nucleic acid compositions and kit and detection method of four kinds of enteroviruses of detection simultaneously
<160> 26
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gtcagtgaat ctaccaccgg g 21
<210> 2
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ctaggtaccc aagctctcac rtg 23
<210> 3
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tgttggaaac cactatcaac cac 23
<210> 4
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgtcccccca tctgtgag 18
<210> 5
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gtactaccta cagctgccaa yact 24
<210> 6
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ccgcrgcttg tagtgctg 18
<210> 7
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
cgagtgctta tcaatggttt tatg 24
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
acatgccccg tattcaagat 20
<210> 9
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
catccacgtt cgggtgtaca tgagaa 26
<210> 10
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
cttctcccgc tctggattag tgggagt 27
<210> 11
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
caagtagtca cagattaggc actggtgttg t 31
<210> 12
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
cccacattcg gagaacacaa acaggag 27
<210> 13
<211> 190
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
accaatttgc aatatgggca gtgccctaac aacatgatgg gccactttgc catccgaaca 60
gtcagcgaat ctaccaccgg gaaaaacgtc cacgttcggg tgtacatgag aattaagcac 120
gtgagagctt gggtacctag accccttcga tcccaagctt atatggtcaa gaattacccg 180
acatacagcc 190
<210> 14
<211> 227
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
acgggtgcca cttctaatgc cacagatgag aacatgattg agacccgttg tgtggttaac 60
agaaatggag tgttggaaac cactatcaac cacttcttct cccgctctgg attagtggga 120
gtagttaacc ttacagatgg ggggacggac actactgggt atgccacatg ggacatagac 180
attatgggct ttgtccaact ccgcagaaaa tgcgagatgt tcacata 227
<210> 15
<211> 182
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
caagtgaatc gctccttgac tgcgttgcaa gtactaccta cagctgccaa cactgaagca 60
agcagtcaca gattaggcac tggtgttgta ccagctctac aagccgcgga gacaggggcg 120
tcgtctaatg ctagtgacaa gaatctcatt gagactagat gtgtgttgaa ccatcactcc 180
ac 182
<210> 16
<211> 257
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
agggaatccc ttgcatggca aaccgccact aacccctcag tttttgtcaa gctgtcagac 60
cctccagcgc aggtttcagt gccattcatg tcacctgcga gtgcttatca atggttttat 120
gacggatatc ccacattcgg agaacacaaa caggagaaag atcttgaata cggggcatgt 180
cctaataaca tgatgggcac gttctcagtg cggactgtgg ggacctccaa gtccaagtac 240
cctttagtgg ttaggat 257
<210> 17
<211> 80
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
gtcagcgaat ctaccaccgg gaaaaacgtc cacgttcggg tgtacatgag aattaagcac 60
gtgagagctt gggtacctag 80
<210> 18
<211> 77
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
tgttggaaac cactatcaac cacttcttct cccgctctgg attagtggga gtagttaacc 60
ttacagatgg ggggacg 77
<210> 19
<211> 79
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
gtactaccta cagctgccaa cactgaagca agcagtcaca gattaggcac tggtgttgta 60
ccagctctac aagccgcgg 79
<210> 20
<211> 83
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
cgagtgctta tcaatggttt tatgacggat atcccacatt cggagaacac aaacaggaga 60
aagatcttga atacggggca tgt 83
<210> 21
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
cttatcaatg gttttatgac ggata 25
<210> 22
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
tgttattagg acatgctccg tatt 24
<210> 23
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 23
cacattcgga gaacacaaac aggagaaaga tctt 34
<210> 24
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 24
gttggaaacc actatcaacc act 23
<210> 25
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 25
ccccccatct gtaaggtta 19
<210> 26
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 26
cacttcttct cccgctctgg attagtgg 28
Claims (10)
1. a kind of nucleic acid compositions for detecting four kinds of enteroviruses simultaneously characterized by comprising
Sequence A6 type Coxsackie virus amplimer pair as shown in SEQ ID No.1 and SEQ ID No.2；
Sequence A10 type Coxsackie virus amplimer pair as shown in SEQ ID No.3 and SEQ ID No.4；
Sequence A16 type Coxsackie virus amplimer pair as shown in SEQ ID No.5 and SEQ ID No.6；And
Sequence EV71 type enterovirus amplimer pair as shown in SEQ ID No.7 and SEQ ID No.8.
2. nucleic acid compositions that are according to claim 1 while detecting four kinds of enteroviruses, which is characterized in that further include:
With the A6 type Coxsackie virus amplimer to corresponding A6 type Coxsackie virus detection probe and the A10 type Coxsack
The corresponding A10 type Coxsackie virus detection probe of virus amplification primer pair, with the A16 type Coxsackie virus amplimer to right
The A16 type Coxsackie virus detection probe answered, with the EV71 type enterovirus amplimer to corresponding EV71 type enteron aisle disease
Malicious detection probe, the A6 type Coxsackie virus detection probe, the A10 type Coxsackie virus detection probe, A16 type Ke
The first fluorescent reporter group, second are connected separately on Sa Qi viral diagnosis probe, the EV71 type enterovirus detection probe
Fluorescent reporter group, third fluorescent reporter group, the 4th fluorescent reporter group, first fluorescent reporter group, described second
Fluorescent reporter group, the third fluorescent reporter group and the 4th fluorescent reporter group are different.
3. nucleic acid compositions that are according to claim 2 while detecting four kinds of enteroviruses, which is characterized in that the A6 type
The sequence of Coxsackie virus detection probe is as shown in SEQ ID No.9；The sequence of the A10 type Coxsackie virus detection probe is such as
Shown in SEQ ID No.10；The sequence of the A16 type Coxsackie virus detection probe is as shown in SEQ ID No.11；The EV71
The sequence of type enterovirus detection probe is as shown in SEQ ID No.12.
4. nucleic acid compositions that are according to claim 2 or 3 while detecting four kinds of enteroviruses, which is characterized in that described
First fluorescent reporter group, second fluorescent reporter group, the third fluorescent reporter group and the 4th fluorescence report
Group is selected from one of FAM, VIC, TEXAS RED and CY5.
5. nucleic acid compositions that are according to claim 4 while detecting four kinds of enteroviruses, which is characterized in that the A6 type
Coxsackie virus detection probe, the A10 type Coxsackie virus detection probe, the A16 type Coxsackie virus detection probe, institute
It states and the first fluorescent quenching group, the second fluorescent quenching group, third is also respectively connected in EV71 type enterovirus detection probe
Fluorescent quenching group, the 4th fluorescent quenching group, it is the first fluorescent quenching group, the second fluorescent quenching group, described
Third fluorescent quenching group and the 4th fluorescent quenching group are selected from one of BHQ1 and BHQ2.
6. a kind of kit for detecting four kinds of enteroviruses simultaneously, which is characterized in that including described in any one of Claims 1 to 5
While detect four kinds of enteroviruses nucleic acid compositions.
7. kit that is according to claim 6 while detecting four kinds of enteroviruses, which is characterized in that further include that RNA is mentioned
Take at least one of reagent, dNTPs, PCR reaction solution, enzyme mixation, positive reference substance and negative controls.
8. kit that is according to claim 7 while detecting four kinds of enteroviruses, which is characterized in that the PCR reaction
Liquid include the Tris-base of 220mM~280mM, mass percentage be 0.2%~0.3% TritonX-100 and
The MgCl of 20mmol/L~30mmol/L2；
And/or the enzyme mixation includes Taq enzyme and reverse transcriptase.
9. a kind of detection method for detecting four kinds of enteroviruses simultaneously, which comprises the steps of:
Using sample to be tested RNA as template, addition Claims 1 to 5 is described in any item while detecting the core of four kinds of enteroviruses
Acid composition carries out multiple fluorescence quantitative PCR amplified reaction, is tested and analyzed according to reaction result.
10. detection method that is according to claim 9 while detecting four kinds of enteroviruses, which is characterized in that described multiple
The reaction system of fluorescent quantitative PCR reaction includes: A6 type Ke's Sa of the dNTPs of 25mM, the PCR reaction solution of 5 μ L, 10 μm of ol
Odd virus amplification primer pair, 10 μm of ol A10 type Coxsackie virus amplimer the A16 type Coxsackie virus of, 10 μm of ol is expanded
Increase primer pair, 20 μm of ol EV71 type enterovirus amplimer to, the A6 type Coxsackie virus detection probe of 2 μm of ol, 4 μm of ol
A10 type Coxsackie virus detection probe, the A16 type Coxsackie virus detection probe of 5 μm of ol, the EV71 type enteron aisle disease of 6 μm of ol
The sample to be tested RNA of malicious detection probe, the enzyme mixation of 1 μ L and 0.5 μ of μ L~5 L；And/or
The reaction condition of the multiple fluorescence quantitative PCR amplified reaction are as follows: 40 DEG C~50 DEG C reverse transcription 10min~30min；93℃
~95 DEG C of initial denaturation 2min~10min；93 DEG C~95 DEG C denaturation 10s~30s, 55 DEG C~60 DEG C annealing extend, signal acquisition
30s~60s is recycled 40 times~45 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811626360.7A CN109504805A (en) | 2018-12-28 | 2018-12-28 | The nucleic acid compositions and kit and detection method of four kinds of enteroviruses of detection simultaneously |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811626360.7A CN109504805A (en) | 2018-12-28 | 2018-12-28 | The nucleic acid compositions and kit and detection method of four kinds of enteroviruses of detection simultaneously |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109504805A true CN109504805A (en) | 2019-03-22 |
Family
ID=65755681
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811626360.7A Pending CN109504805A (en) | 2018-12-28 | 2018-12-28 | The nucleic acid compositions and kit and detection method of four kinds of enteroviruses of detection simultaneously |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109504805A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055354A (en) * | 2019-04-23 | 2019-07-26 | 深圳市亚辉龙生物科技股份有限公司 | Nucleic acid compositions, detection unit, micro-fluidic chip and detection device |
| CN110863065A (en) * | 2019-10-21 | 2020-03-06 | 珞可为科技(武汉)有限公司 | Kit for detecting four enteroviruses and detection method thereof |
| CN111647691A (en) * | 2020-06-23 | 2020-09-11 | 深圳市艾伟迪生物科技有限公司 | Nucleic acid composition for simultaneously detecting 4 coxsackie virus subtypes in group A, kit and detection method thereof |
| CN111748648A (en) * | 2019-12-24 | 2020-10-09 | 深圳市人民医院 | Kit for detecting five infant hand-foot-and-mouth disease series viruses and application thereof |
| CN111748650A (en) * | 2020-06-23 | 2020-10-09 | 深圳市艾伟迪生物科技有限公司 | Nucleic acid composition for simultaneously detecting four B-group coxsackie virus subtypes and kit and detection method thereof |
| WO2021179469A1 (en) * | 2020-03-13 | 2021-09-16 | 圣湘生物科技股份有限公司 | Composition for detecting pathogens, and kit and method therefor |
| CN113564131A (en) * | 2021-09-23 | 2021-10-29 | 北京民海生物科技有限公司 | Coxsackie virus A6 type strain and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998014611A2 (en) * | 1996-10-02 | 1998-04-09 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Detection and identification of non-polio enteroviruses |
| CN103305636A (en) * | 2013-06-27 | 2013-09-18 | 中国医学科学院病原生物学研究所 | Method for detecting human intestinal virus with high sensitivity |
| CN107529559A (en) * | 2017-08-31 | 2018-01-02 | 南京美宁康诚生物科技有限公司 | A kind of multiple fluorescence PCR detection reagent box of hand-foot-and-mouth disease virus and application |
| CN108424977A (en) * | 2018-02-09 | 2018-08-21 | 上海伯杰医疗科技有限公司 | Enterovirus Classification Identification primed probe and identification method |
-
2018
- 2018-12-28 CN CN201811626360.7A patent/CN109504805A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998014611A2 (en) * | 1996-10-02 | 1998-04-09 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Detection and identification of non-polio enteroviruses |
| CN103305636A (en) * | 2013-06-27 | 2013-09-18 | 中国医学科学院病原生物学研究所 | Method for detecting human intestinal virus with high sensitivity |
| CN107529559A (en) * | 2017-08-31 | 2018-01-02 | 南京美宁康诚生物科技有限公司 | A kind of multiple fluorescence PCR detection reagent box of hand-foot-and-mouth disease virus and application |
| CN108424977A (en) * | 2018-02-09 | 2018-08-21 | 上海伯杰医疗科技有限公司 | Enterovirus Classification Identification primed probe and identification method |
Non-Patent Citations (2)
| Title |
|---|
| JINGZI PIAO等: "Simultaneous Detection and Identification of Enteric Viruses by PCR-Mass Assay", 《PLOS ONE》 * |
| MIN WANG等: "Rapid detection of hand, foot and mouth disease enterovirus genotypes by multiplex PCR", 《JOURNAL OF VIROLOGICAL METHODS》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055354A (en) * | 2019-04-23 | 2019-07-26 | 深圳市亚辉龙生物科技股份有限公司 | Nucleic acid compositions, detection unit, micro-fluidic chip and detection device |
| CN110055354B (en) * | 2019-04-23 | 2023-11-03 | 深圳市亚辉龙生物科技股份有限公司 | Nucleic acid composition, detection unit, microfluidic chip and detection device |
| CN110863065A (en) * | 2019-10-21 | 2020-03-06 | 珞可为科技(武汉)有限公司 | Kit for detecting four enteroviruses and detection method thereof |
| CN111748648A (en) * | 2019-12-24 | 2020-10-09 | 深圳市人民医院 | Kit for detecting five infant hand-foot-and-mouth disease series viruses and application thereof |
| WO2021179469A1 (en) * | 2020-03-13 | 2021-09-16 | 圣湘生物科技股份有限公司 | Composition for detecting pathogens, and kit and method therefor |
| CN111647691A (en) * | 2020-06-23 | 2020-09-11 | 深圳市艾伟迪生物科技有限公司 | Nucleic acid composition for simultaneously detecting 4 coxsackie virus subtypes in group A, kit and detection method thereof |
| CN111748650A (en) * | 2020-06-23 | 2020-10-09 | 深圳市艾伟迪生物科技有限公司 | Nucleic acid composition for simultaneously detecting four B-group coxsackie virus subtypes and kit and detection method thereof |
| CN113564131A (en) * | 2021-09-23 | 2021-10-29 | 北京民海生物科技有限公司 | Coxsackie virus A6 type strain and application thereof |
| CN113564131B (en) * | 2021-09-23 | 2022-01-07 | 北京民海生物科技有限公司 | Coxsackie virus A6 type strain and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109504805A (en) | The nucleic acid compositions and kit and detection method of four kinds of enteroviruses of detection simultaneously | |
| CN103114131B (en) | A kind of primer middle part sequence interferes round pcr | |
| JP2021129582A (en) | Nucleic acid amplification | |
| CN104195268B (en) | Detect test kit and the preparation method of foot and mouth disease A type, O type and Asia 1 C-type virus C | |
| CN106868196A (en) | A kind of probe for detecting thalassemia gene mutation, primer and kit | |
| CN106167833B (en) | A kind of while 8 kinds of entomophila encephalitis viruses of detection RT-PCR primers and probe combinations and kit | |
| CN109777893A (en) | The invisible hepatitis B detection kit of droplet type digital pcr | |
| CN1995386A (en) | BCR-ABL gene fluorescence quantitative RT-PCR primer and probe and reagent kit | |
| WO2022068079A1 (en) | Method for detecting hepatitis b virus t216c mutation based on micro-droplet digital pcr technology | |
| CN106086236A (en) | Detect test kit and the method for influenza virus H1, H3, H5, H7 simultaneously | |
| CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
| CN113718021A (en) | Primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene | |
| CN111763766A (en) | Primer pair, TaqMan probe and method for detecting canine diarrhea virus by one-step method and application | |
| CN114958984A (en) | Method for quantitatively determining content of nucleic acid in sample | |
| CN105368943B (en) | A kind of kit and method for identification of mycobacterium strain | |
| CN103911462B (en) | Identification and detection method for yellow fever, Japanese encephalitis, chikungunya fever and west Nile fever, primers and probes | |
| CN106755352A (en) | Nucleic acid, kit and method for quick detection ABCB1 gene C 3435T polymorphisms | |
| CN109161611A (en) | A kind of primed probe group and kit based on triple fluorescent PCR method joint-detection banna virus, card land for building promise virus and Liaoning virus | |
| CN103773894B (en) | For detecting the dual probe determination method of HCV | |
| CN110863065A (en) | Kit for detecting four enteroviruses and detection method thereof | |
| Yang et al. | Development of highly accurate digital PCR method and reference material for monkeypox virus detection | |
| CN107190103A (en) | Multiple PCR primer group, kit and the method for three kinds of fishes virus are detected simultaneously | |
| CN109797247A (en) | The method of the nucleic acid compositions and kit and rhinovirus parting of A type rhinovirus, Type B rhinovirus and c-type rhinovirus is detected simultaneously | |
| CN107299129A (en) | Circle nucleic acid as breast cancer biomarker application | |
| CN106754902B (en) | A kind of fluorescence resonance probe and its application and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190322 |
|
| RJ01 | Rejection of invention patent application after publication |