CN109423513A - A kind of human-cytochrome CYP2C19 and PAR1 gene polymorphism sites detection kit and purposes - Google Patents

Abstract

The present invention provides the detection method of a kind of cerebral apoplexy medication and genetic correlation, the detection method is used according to cytochrome P450 2C19 * 2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560 and PAR-1:rs168753, the synthetic oligonucleotide primer sequence object and probe of the 4 of totally 2 genes polymorphic site, carry out real time fluorescent quantitative allele probe in detecting, judge whether object to be measured belongs to medication Susceptible population.Using this method, the guidance and adjustment of clinical application scheme can be carried out, provides foundation, the adverse reaction of prophylactic agent for clinic personalized treatment.This method can simultaneously detect 4 polymorphic sites of 2 genes simultaneously, have many advantages, such as easy, accurate, quick, high-throughput.

Description

A kind of human-cytochrome CYP2C19 and PAR1 gene polymorphism sites detection kit And purposes

Technical field

The present invention relates to biomedicine fields, more particularly to a kind of human-cytochrome P450CYP2C19 and PAR1 gene Polymorphic site detection kit and purposes.

Background technique

Ischemic heart disease and cerebral arterial thrombosis are primary the two of the global cause of the death that the World Health Organization (WHO) is announced Position, atherosclerosis, plaque rupture, thrombosis are the immediate causes that cardiocerebrovasculaevents events occur, and thrombotic diseases are As the first killer of human health, Antiplatelet therapy is to prevent the main means of thrombotic diseases.

Plaque rupture and thrombosis are the basic pathological changes for leading to acute cardiovascular event, and the especially anti-blood of anti-bolt is small Plate treatment is the most important intervening measure of acute coronary syndrome.Blood platelet is cell-free core is generated from bone marrow megakaryocyte born of the same parents The fragment of slurry.Its maxage about 10d in the circulating cycle.Under normal circumstances, blood platelet is in blood circulation in non- State of activation, and when blood vessel endothelium injury or atherosclerotic plaque rupture, the exposure of subendothelial matrix, occur activation because The period of the day from 11 p.m. to 1 a.m, blood platelet can be activated and play an important role during physiological hemostasis.

Made of links and related target research and development of the antiplatelet drug aiming at platelet activation, in mechanism It may act on platelet activation, each stage sticked, assembled.

The drug being currently mainly used has:

Cycloxygenase (COX) inhibitor: aspirin can promote the 529th serine acetylation of COX-1 active site, no The activity of reversible inhibition COX-1.COX-1 plays key effect in the initial step of prostanoid biosynthesis, it can be urged Change arachidonic acid and is converted into prostaglandin H2 (PGH2), and PGH2 is the direct precursor of TXA2.Aspirin inhibits COX-1's It is reduced the result is that TXA2 is caused to generate, and TXA2 is that strong blood platelet causes polymers, TXA2 generates to reduce influences blood platelet eventually Aggregation and release reaction.

Adp receptor inhibitor: clopidogrel.In small intestinal absorption, the proton encoded by ABCB1 gene after the drug oral The regulation of P- glycoprotein is pumped, it is inactive carboxylic acids metabolite SR26334 that 85%-95%, which is carboxylation enzyme hydrolysis, after absorption, only 10%-15% is metabolized as activated product through liver cytochrome P 450 (CYP450) enzyme system.Clopidogrel active metabolite R- 130964 are irreversibly combined with the adp receptor of platelet surface (P2Y12) when by liver circulation by covalent bond, are blocked Inhibiting effect of the ADP to adenyl cyclase, the VASP phosphorylation for promoting cAMP to rely on, inhibition fibrinogen and human platelet glycoprotein II b/ of Protein G P, III a receptor combines, and then inhibits the aggregation of blood platelet.In addition, clopidogrel can also block secondary ADP to mediate II b/ of glycoprotein GP, III a compound activation after the amplification of caused platelet activation, to inhibit other agonist inductions Platelet aggregation.

It could inhibit the aggregation of blood platelet since clopidogrel must be biologically converted into activated product.The bioconversion mistake Journey need CYP2C19 gene encode Cytochrome P450 intrahepatic metabolism complete, activated product can selectively, irreversible ground resistance The platelet aggregation that disconnected adenosine diphosphate (ADP) relies on.

Different Individual has different reactivity for clopidogrel, and there are about 40% patients asian ancestry still to show after the treatment Remaining platelet aggregation out, i.e., it is so-called " clopidogrel Resistant ".The main reason is that CYP2C19*2, CYP2C19* Caused by 3CYP2C19 gene mutation causes the active metabolite of clopidogrel to reduce.Newest clinical study results confirm Weak metabolism individual, the risk that embolism re-forms caused by CYP2C19 gene mutation increase, the generation of cardiocerebrovasculaevents events Risk increases, and case fatality rate increases.For the individual of CYP2C19 gene mutation, need to increase the dosage (loading dose of clopidogrel For 300mg or 600mg), to achieve the effect that blocking platelet is assembled.

Proteinase-activated receptor-1 (PAR-1) is a kind of g protein coupled receptor of cell surface, is thrombin receptor.It is solidifying Hemase is strongest inducer of platelet activation, is reacted by PAR1 mediated cell.Human platelet expresses PAR1 receptor, and PAR1 can be with The coupling of G12/13 and Gq family, and by secreting ADP indirect activation Gi signaling pathways, cause a system of platelet activation Column change, and induce Coagulation test.Key effect is played in thrombosis and hemostasis.

Therefore, above-mentioned polygenes carries out SNP detection for the personalized medicine of realization antiplatelet drug, reduces cardiovascular The case fatality rate of disease has important clinical meaning.

Summary of the invention

The purpose of the present invention is to provide a kind of human-cytochrome CYP2C19 and PAR1 gene polymorphism sites detection reagent Box and purposes.

The first aspect of the present invention provides PAR-1:rs168753 gene loci and/or the purposes of its detection reagent, uses In reagent preparation or kit, the reagent or kit are for detecting detected object to the sensibility of antiplatelet drug.

In another preferred example, the reagent or kit further include detecting one or more gene locis selected from the group below Detection reagent: CYP2C19*2:rs4244285 gene loci, CYP2C19*3:rs4986893 gene loci and CYP2C19* 17:rs12248560 gene loci.

In another preferred example, the detected object includes: people or non-human animal (such as domestic animal, poultry, experimental animal Deng).

In another preferred example, the antiplatelet drug is selected from the group:

Cycloxygenase (COX) inhibitor and adp receptor inhibitor.

In another preferred example, Cycloxygenase (COX) inhibitor includes: aspirin, Diclofenac, U.S. Lip river former times Health, Nabumetone or combinations thereof.

In another preferred example, the adp receptor inhibitor includes: clopidogrel and Panaldine.

In another preferred example, the antiplatelet drug is selected from the group: clopidogrel and aspirin.

In another preferred example, if the PAR-1:rs168753 gene loci of the detected object sports T by A, Then illustrate that the object is sensitive to clopidogrel.

In another preferred example, if the PAR-1:rs168753 gene loci of the detected object sports T by A, Then illustrate that the object is more sensitive to clopidogrel-aspirin combination medication.

In another preferred example, if the genotype of the PAR-1:rs168753 gene loci of the detected object is TT then illustrates that the object is more sensitive to clopidogrel-aspirin combination medication.

In another preferred example, if the detected object occurs such as in one or more gene locis selected from the group below Lower mutation, then it is not recommended that the object uses clopidogrel (insensitive to clopidogrel):

CYP2C19*2:rs4244285G → A；

CYP2C19*3:rs4986893G → A；

CYP2C19*17:rs12248560C → T.

In another preferred example, the reagent includes primer, probe, chip or antibody.

In another preferred example, the kit contains one or more reagents selected from the group below:

(A) it is used for the specific primer of genetic test；

(B) it is used for the specific probe of genetic test；

(C) it is used for the chip of genetic test；

(D) for detecting the specific antibody of amino acid mutation corresponding to the gene of mutation；

Wherein, the specific primer, the specific probe, the chip pins are to gene loci selected from the group below: CYP2C19*2:rs4244285 gene loci, CYP2C19*3:rs4986893 gene loci, CYP2C19*17:rs12248560 Gene loci and PAR1:rs168753 gene loci；

The gene of the mutation contains the gene loci of mutation selected from the group below: CYP2C19*2:rs4244285 gene position Point, CYP2C19*3:rs4986893 gene loci, CYP2C19*17:rs12248560 gene loci PAR1:rs168753 gene Site.

In another preferred example, the primer includes:

Primer pair 1, for CYP2C19*2:rs4244285 gene loci:

The sequence of upstream primer 5 ' -3 ' are as follows: AGATATGCAATAATTTTCCCACTATC (Seq ID No.1),

The sequence of downstream primer 5 ' -3 ' are as follows: ATAAAGTCCCGAGGGTTGTTGATG (Seq ID No.2)；

Primer pair 2, for CYP2C19*3:rs4986893 gene loci:

The sequence of upstream primer 5 ' -3 ' are as follows: GATGGAAAAATTGAATGAAAACATCA (Seq ID No.3),

The sequence of downstream primer 5 ' -3 ' are as follows: CTGGGAAATCCAAAATTCTATATTG (Seq ID No.4)；

Primer pair 3, for CYP2C19*17:rs12248560 gene loci:

The sequence of upstream primer 5 ' -3 ' are as follows: TCTTCTGATGCCCATCGTGGCGCATT (Seq ID No.5),

The sequence of downstream primer 5 ' -3 ' are as follows: TAGTTATTCTGAATATATACCACATT (Seq ID No.6).

Primer pair 4, for PAR-1:rs168753 gene loci

The sequence of upstream primer 5 ' -3 ' are as follows: CTTTTGCCTTGTTGATGCGTTCAC (Seq ID No.7),

The sequence of downstream primer 5 ' -3 ' are as follows: CAACAAATGCCACCTTAGATC (Seq ID No.8).

In another preferred example, a primer further includes the extension primer of the ID of Seq containing primer sequence No.1-14.

In another preferred example, the reagent or kit are detected for real-time fluorescence quantitative PCR.

In another preferred example, in the real-time fluorescence quantitative PCR, annealing temperature is PCR amplification piece between 60-67 DEG C Segment length is 80-300bp.

In another preferred example, in the real-time fluorescence quantitative PCR, fluorescence probe annealing temperature is between 60-70 DEG C.

In another preferred example, double ends of the probe carry out the modification of chemical group, and 5 ' terminal modified have fluorescence excitation Group, 3 terminal modified have fluorescence Cui to go out group.

In another preferred example, further include probe sequence selected from the group below in the reagent or kit:

In another preferred example, further include probe sequence selected from the group below in the kit:

Probe 1, for CYP2C19*2:rs4244285 gene loci:

P1:FAM-TATGGGTTCCCCGGGAAATAA-BHQ1 (SEQ ID NO.9)

P2:ROX-TATGGGTTCCCTGGGAAATAA-BHQ2(SEQ ID NO.10)；

Probe 2, for CYP2C19*3:rs4986893 gene loci:

P3:VIC-TTACCTGGATTCAGGGGGT-BHQ1 (SEQ ID NO.11)

P4:TAMRA-TTACCTGGATCCAGGGGGT-BHQ2 (SEQ ID NO.12)；

Probe 3, for CYP2C19*17rs12248560 gene loci:

P5:FAM-TTCTCAAAGCATCTCTGATGT-BHQ1 (SEQ ID NO.13)

P6:ROX-TTCTCAAAGTATCTCTGATGT-BHQ2 (SEQ ID NO.14).

Probe 4, for PAR1:rs168753 gene loci:

P13:FAM-CTGAAAAATAAAATTAAAAAAATTTT-BHQ1 (SEQ ID NO.15)

P14:ROX-CTGAAAAATAAAATAAAAAAAATTTT-BHQ2 (SEQ ID NO.16).

In another preferred example, the probe also includes the extension primer series of probe sequence P1-P14.

The second aspect of the present invention, provides a kind of kit, and the kit includes PAR1:rs168753 gene loci Detection reagent.

In another preferred example, the kit further includes the detection for detecting one or more gene locis selected from the group below Reagent: CYP2C19*2:rs4244285 gene loci, CYP2C19*3:rs4986893 gene loci and CYP2C19*17: Rs12248560 gene loci.

In another preferred example, the kit contains one or more reagents selected from the group below:

(A) it is used for the specific primer of genetic test；

(B) it is used for the specific probe of genetic test；

(C) it is used for the chip of genetic test；

(D) for detecting the specific antibody of amino acid mutation corresponding to the gene of mutation；

Wherein, the specific primer, the specific probe, the chip pins are to gene loci selected from the group below: CYP2C19*2:rs4244285 gene loci, CYP2C19*3:rs4986893 gene loci, CYP2C19*17:rs12248560 Gene loci and PAR-1:rs168753 gene loci；

The gene of the mutation contains the gene loci of mutation selected from the group below:

CYP2C19*2:rs4244285 gene loci, CYP2C19*3:rs4986893 gene loci, CYP2C19*17: Rs12248560 gene loci and PAR1:rs168753 gene loci.

In another preferred example, the primer includes:

Primer pair 1, for CYP2C19*2:rs4244285 gene loci:

The sequence of upstream primer 5 ' -3 ' are as follows: AGATATGCAATAATTTTCCCACTATC (Seq ID No.1),

The sequence of downstream primer 5 ' -3 ' are as follows: ATAAAGTCCCGAGGGTTGTTGATG (Seq ID No.2)；

Primer pair 2, for CYP2C19*3:rs4986893 gene loci:

The sequence of upstream primer 5 ' -3 ' are as follows: GATGGAAAAATTGAATGAAAACATCA (Seq ID No.3),

The sequence of downstream primer 5 ' -3 ' are as follows: CTGGGAAATCCAAAATTCTATATTG (Seq ID No.4)；

Primer pair 3, for CYP2C19*17:rs12248560 gene loci:

The sequence of upstream primer 5 ' -3 ' are as follows: TCTTCTGATGCCCATCGTGGCGCATT (Seq ID No.5),

The sequence of downstream primer 5 ' -3 ' are as follows: TAGTTATTCTGAATATATACCACATT (Seq ID No.6).

Primer pair 4, for PAR-1:rs168753 gene loci

The sequence of upstream primer 5 ' -3 ' are as follows: CTTTTGCCTTGTTGATGCGTTCAC (Seq ID No.7),

The sequence of downstream primer 5 ' -3 ' are as follows: CAACAAATGCCACCTTAGATC (Seq ID No.8).

In another preferred example, a primer further includes the extension primer of the ID of Seq containing primer sequence No.1-8.

In another preferred example, the kit is detected for real-time fluorescence quantitative PCR.

In another preferred example, in the real-time fluorescence quantitative PCR, annealing temperature is PCR amplification piece between 60-67 DEG C Segment length is 80-300bp.

In another preferred example, in the real-time fluorescence quantitative PCR, fluorescence probe annealing temperature is between 60-70 DEG C.

In another preferred example, double ends of the probe carry out the modification of chemical group, and 5 ' terminal modified have fluorescence excitation Group, 3 terminal modified have fluorescence Cui to go out group.

In another preferred example, further include probe sequence selected from the group below in the kit:

In another preferred example, further include probe sequence selected from the group below in the kit:

Probe 1, for CYP2C19*2:rs4244285 gene loci:

P1:FAM-TATGGGTTCCCCGGGAAATAA-BHQ1 (SEQ ID NO.9)

P2:ROX-TATGGGTTCCCTGGGAAATAA-BHQ2(SEQ ID NO.10)；

Probe 2, for CYP2C19*3:rs4986893 gene loci:

P3:VIC-TTACCTGGATTCAGGGGGT-BHQ1 (SEQ ID NO.11)

P4:TAMRA-TTACCTGGATCCAGGGGGT-BHQ2 (SEQ ID NO.12)；

Probe 3, for CYP2C19*17rs12248560 gene loci:

P5:FAM-TTCTCAAAGCATCTCTGATGT-BHQ1 (SEQ ID NO.13)

P6:ROX-TTCTCAAAGTATCTCTGATGT-BHQ2 (SEQ ID NO.14).

Probe 4, for PAR1:rs168753 gene loci:

P13:FAM-CTGAAAAATAAAATTAAAAAAATTTT-BHQ1 (SEQ ID NO.15)

P14:ROX-CTGAAAAATAAAATAAAAAAAATTTT-BHQ2 (SEQ ID NO.16).

In another preferred example, the probe also includes the extension primer series of probe sequence P1-P14.

The third aspect of the present invention, providing a kind of vitro detection sample whether there is the method for single nucleotide variations, packet Include step:

(a) polynucleotides for using primer amplified sample, obtain amplified production；With

(b) detecting whether there is following single nucleotide variations in amplified production:

CYP2C19*2:rs4244285G → A；

CYP2C19*3:rs4986893G → A；

CYP2C19*17:rs12248560C → T；With

PAR-1:rs168753A→T。

In another preferred example, the length of the amplified production is 80-2000bp, and is selected from down containing one or more The single nucleotide variations of group:

CYP2C19*2:rs4244285G → A；

CYP2C19*3:rs4986893G → A；

CYP2C19*17:rs12248560C → T.

PAR-1:rs168753A→T。

The fourth aspect of the present invention provides a kind of method of individual sensibility to antiplatelet drug of detection, it is wrapped Include step:

(i) gene loci selected from the group below of the individual is detected, and whether is deposited compared with corresponding normal gene site In gene mutation:

CYP2C19*2:rs4244285；

CYP2C19*3:rs4986893；

CYP2C19*17:rs12248560；

PAR-1:rs168753。

In another preferred example, the gene mutation is single nucleotide variations selected from the group below:

CYP2C19*2:rs4244285G → A；

CYP2C19*3:rs4986893G → A；

CYP2C19*17:rs12248560C → T.

PAR-1:rs168753A→T。

In another preferred example, the individual is people.

In another preferred example, if PAR-1:rs168753 has mutation, and/or

If CYP2C19*2:rs4244285；And/or CYP2C19*3:rs4986893；And/or CYP2C19*17: There is no mutation by rs12248560, then illustrate sensitive to clopidogrel.

In within the scope of the present invention, above-mentioned each technical characteristic of the invention and specifically described in below (e.g. embodiment) It can be combined with each other between each technical characteristic, to form a new or preferred technical solution.As space is limited, not another herein One tired states.

Specific embodiment

The present inventor obtains a kind of gene relevant to the sensibility of antiplatelet drug by extensive and in-depth research Polymorphic site, the experimental results showed that, it can be small to assessment individual confrontation blood by detecting gene polymorphism sites of the invention The sensibility of plate drug.Again on the basis of this, the present invention is completed.

It the present invention relates to the use of fluorescent hydrolysis probe (Taqman) method and screen cytochrome P450 2C19 * 2: rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；With 2 genes of PAR1:rs168753 4 polymorphic sites method.And it is formed by kit using this method, it is susceptible to judge whether object to be measured belongs to medication Crowd, and then clinical application scheme is instructed and adjusts, foundation, the adverse reaction of prophylactic agent are provided for clinic personalized treatment. Therefore kit provided by the invention and detection method can be used for instructing cerebral apoplexy personalized medicine.

Before describing the present invention, it should be understood that the present invention is not limited to the specific method and experiment conditions, because this Class method and condition can change.It should also be understood that its purpose of the term as used herein is only that description specific embodiment, and And it is not intended to be restrictive, the scope of the present invention will be limited only by the claims which follow.

Unless otherwise defined, otherwise whole technologies used herein and scientific term all have such as fields of the present invention The normally understood identical meanings of those of ordinary skill.As used herein, in use, term in mentioning the numerical value specifically enumerated " about " mean that the value can change not more than 1% from the value enumerated.For example, as used herein, statement " about 100 " includes 99 Hes 101 and between whole values (for example, 99.1,99.2,99.3,99.4 etc.).

Although can be used in implementation or test of the invention and heretofore described similar or of equal value any method And material, place enumerates preferred method and material herein.

Cytochrome P450

Cytochrome P450 (cytochromeP450, CYP) is superfamily oxidizing ferment, is distributed widely in various life shapes How histiocytic micro- formula be the important composition ingredient of mixed-functional oxidase, be present in from lower bacteria to high animal and plant In plastochondria, the enzyme is primarily present in liver organization in human body.The metabolic rate and removing in vivo that P450 activity determines drug, Thus also known as drug metabolic enzyme.The gene of P450 enzyme system mainly has CYP1, and tri- families of CYP2, CYP3 are corresponding several heavy Enzyme is wanted to have: CYP1A2, CYP2A6, CYP2C9, CYP2C19, CYP2D6, CYP2E1, CYP3A4, CYP3A5.

The drug that P450 family participates in metabolism accounts for sells 80% or more of drug in the market, once the function of the enzyme changes Become, will affect the metabolism and curative effect of drug.In the adverse reaction research of drug, about 48% with the polymorphism of P450 enzyme gene It is closely related.

P450 genetic polymorphism is that P450 enzyme is caused to lack, and expression quantity declines or increases, and substrate specificity sexually revises main Reason finally causes pharmacokinetics to change, and Different Individual is caused to generate different pharmaceutical response to same drug.

CYP2C19 is an important member in the second subfamily, and CYP2C19 gene is located on the 10q24.2 of chromosomal region, It is all made of 9 exons, there is 92% sequence homology with CYP2C9, the albumen being made of 490 amino acid is mainly expressed In hepatic tissue, also there is expression in duodenum, is important one of the drug metabolic enzyme of human body.It is responsible for the drug of metabolism by P450 enzyme In, 12% is metabolized through CYP2C19.

CYP2C19 has many SNP sites, and genetic polymorphism plays important in the metabolic process of cardiovascular medicament Effect.

Currently, at least 10 cause changing for enzymatic activity in 25 mutation alleles of the CYP2C19 having found Become, most commonly CYP2C19*2 and CYP2C19*3 and CYP2C19*17 (rs12248560).Wherein slow inactivation with CYP2C19*2: and based on CYP2C19*3, fast metabolic pattern is based on CYP2C19*17.

The shearing of albumen will lead to mutant inactive when CYP2C19*2mRNA is translated, and CYP2C19*3 can constitute a termination Son destroys the activity of transcription factor.According to statistics, two mutational sites CYP2C19*2 and CYP2C19*3 can explain almost 100% Gook to 85% Caucasoid related weak metabolism inheritance defect.It is a large amount of to demonstrate,prove it is demonstrated that different ethnic groups are in CYP2C19 The metabolic capability of substrate have very big difference；2-5% Caucasians are poor metabolizers, and 13-23% Asian is weak metabolism Person.This is one as caused by the high-frequency of CYP2C19*2 and CYP2C19*3 allele in the population of Asia.

Proteinase-activated receptor-1 (PAR-1)

PAR-1 is a kind of g protein coupled receptor of cell surface, is thrombin receptor.Fibrin ferment is strongest blood platelet Activator is reacted by PAR1 mediated cell.Human platelet expresses PAR1 receptor, and PAR1 can be with G12/13 and Gq family idol Connection, and by secreting ADP indirect activation Gi signaling pathways, cause a series of changes of platelet activation, induces blood coagulation Reaction.Key effect is played in thrombosis and hemostasis.

Judge whether object to be measured belongs to medication based on cerebral apoplexy medication and genetic correlation the invention proposes a kind of The detection method of Susceptible population.According to cytochrome P450 2C19 * 2:rs4244285；CYP2C19*3:rs4986893； CYP2C19*17:rs12248560；It is closed with the nucleotide sequence of 4 polymorphic sites of 2 genes of PAR1:rs168753 At primer and probe, real time fluorescent quantitative hydrolysis probes PCR is carried out to sample to be tested, is judged according to the fluorescent value generated is reacted The genotype of pcr amplification product.Judge whether the sample is to belong to medicaments insensitive crowd according to the difference of fluorescence.

In a preferred embodiment of the invention, used primer includes:

CYP2C19*2:rs4244285 covers primer

The sequence of upstream primer 5 ' -3 ' (Seq ID No.1) are as follows: AGATATGCAATAATTTTCCCACTATC,

The sequence of downstream primer 5 ' -3 ' (Seq ID No.2) are as follows: ATAAAGTCCCGAGGGTTGTTGATG；

CYP2C19*3:rs4986893 covers primer

The sequence of upstream primer 5 ' -3 ' (Seq ID No.3) are as follows: GATGGAAAAATTGAATGAAAACATCA,

The sequence of downstream primer 5 ' -3 ' (Seq ID No.4) are as follows: CTGGGAAATCCAAAATTCTATATTG；

CYP2C19*17:rs12248560 covers primer

The sequence of upstream primer 5 ' -3 ' (Seq ID No.5) are as follows: TCTTCTGATGCCCATCGTGGCGCATT,

The sequence of downstream primer 5 ' -3 ' (Seq ID No.6) are as follows: TAGTTATTCTGAATATATACCACATT；

PAR1:rs168753 covers primer

The sequence of upstream primer 5 ' -3 ' (Seq ID No.7) are as follows: CTTTTGCCTTGTTGATGCGTTCAC,

The sequence of downstream primer 5 ' -3 ' (Seq ID No.8) are as follows: CAACAAATGCCACCTTAGATC.

Primer of the present invention can also be the extension containing above-mentioned primer sequence (Seq ID No.1-Seq ID No.14) Primer sets.

Preferably, annealing temperature is between 60-67 DEG C, and pcr amplified fragment length is 80-300bp.

Preferably, in real-time fluorescence quantitative PCR, fluorescence probe annealing temperature is between 60-70 DEG C.Wherein, the reality When fluorescent quantitation ApoE gene in, annealing temperature be 60-67 DEG C between, pcr amplified fragment length be 820- 300bp；Testing gene group DNA concentration range is between 1-20ng.

Preferably, in real-time fluorescence quantitative PCR, probe used includes:

In another preferred example, further include probe sequence selected from the group below in the kit:

Probe 1, for CYP2C19*2:rs4244285 gene loci:

P1:FAM-TATGGGTTCCCCGGGAAATAA-BHQ1 (SEQ ID NO.9)

P2:ROX-TATGGGTTCCCTGGGAAATAA-BHQ2(SEQ ID NO.10)；

Probe 2, for CYP2C19*3:rs4986893 gene loci:

P3:VIC-TTACCTGGATTCAGGGGGT-BHQ1 (SEQ ID NO.11)

P4:TAMRA-TTACCTGGATCCAGGGGGT-BHQ2 (SEQ ID NO.12)；

Probe 3, for CYP2C19*17rs12248560 gene loci:

P5:FAM-TTCTCAAAGCATCTCTGATGT-BHQ1 (SEQ ID NO.13)

P6:ROX-TTCTCAAAGTATCTCTGATGT-BHQ2 (SEQ ID NO.14).

Probe 4, for PAR1:rs168753 gene loci:

P13:FAM-CTGAAAAATAAAATTAAAAAAATTTT-BHQ1 (SEQ ID NO.15)

P14:ROX-CTGAAAAATAAAATAAAAAAAATTTT-BHQ2 (SEQ ID NO.16).

Probe of the present invention includes: the modification that double ends carry out chemical groups, 5 ' the fluorescence excitation group at end and 3 ends Fluorescent quenching group.With the extension primer series containing probe sequence (P1-P14).

In the present invention, the cerebral apoplexy can be to be developed by cardiovascular disease and be formed.

The present invention also provides one kind to be based on cytochrome P450 2C19 * 2:rs4244285；CYP2C19*3: rs4986893；CYP2C19*17:rs12248560；It is diagnosed with 4 polymorphic sites of 2 genes of PAR1:rs168753 Use reagent.It is used to implement detection method of the present invention, and the real time fluorescent quantitative hydrolysis probes multiplex PCR including optimization is anti- Answer system；The primer；P450CYP2C19*2:rs4244285 containing people；CYP2C19*3:rs4986893；CYP2C19*17: rs12248560；The plasmid positive control of PAR1:rs168753 gene group DNA fragmentation；Taq archaeal dna polymerase；DMSO etc. PCR reinforcing agent.

The present invention also provides a kind of kit, it is used to implement detection method of the present invention, including above-mentioned cell color Plain P450CYP2C19*2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；And PAR1: Reagent is used in 4 polymorphic sites diagnosis of 2 genes of rs168753.

The present invention is screening cytochrome P450 2C19 * 2:rs4244285；CYP2C19*3:rs4986893； CYP2C19*17:rs12248560；On the basis of the technical solution of 4 polymorphic site genotype of PAR1:rs168753, Medicaments insensitive crowd's diagnostic reagent is provided, in the real time fluorescent quantitative hydrolysis probes PCR, using 4 sets of the present invention Primer.

The present invention screens P450CYP2C19*2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17: rs12248560；It is applied in preparation medication sensitive group diagnostic reagent with 4 polymorphic sites of PAR1:rs168753, institute Stating diagnostic reagent to be includes primer of the invention, reaction buffer, P450CYP2C19*2:rs4244285 containing people；CYP2C19* 3:rs4986893；CYP2C19*17:rs12248560；Plasmid, Taq DNA with PAR1:rs168753 genomic DNA fragment The kit of polymerase and fluorescence probe.

The present invention establishes a kind of easy, accurate, fast in cerebral apoplexy medication sensitive group gene genetic polymorphism research The method of speed, the high-throughput real time fluorescent quantitative probe hydrolysis PCR for detecting cerebral apoplexy medication sensitive group screening, may be used also To be applied to the correlation research of SNP and other diseases.

The present invention is according to people P450CYP2C19*2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17: rs12248560；Corresponding primer is synthesized with the nucleic acid sequence of the two sides PAR1:rs168753SNP, it is corresponding according to SNP site design Nucleotide probe designs SNP site in the centre of probe, and ' end carries out fluorochrome label, together in the nucleotide of probe 5 When ' end carries out the labels of fluorescence quencher dyes 3.It is quantitative by real-time fluorescence probe hydrolysis using the PCR response procedures of optimization PCR reaction, expands the genomic DNA of human blood sample extraction, and the fluorescence of the different wave length according to each probe label Data are read to carry out Polymorphism Analysis.

In the present invention, the optimization process of used real-time fluorescence probe hydrolysis quantifying PCR method includes TaqDNA polymerization The utilization of enzyme, reasonable primer and probe design and modification and the optimization of multi-PRC reaction system.

Due to the presence of non-specific amplification and primer dimer in PCR amplification, the present invention has used the Taq of thermal starting Archaeal dna polymerase, the sharpest edges of the polymerase are that it is different from general T aq archaeal dna polymerase, by chemical modification, when temperature is low When 50 DEG C, polymerase activity is completely suppressed, 95 DEG C after ten minutes its polymerase activity be released.Therefore, DNA is carried out The specificity of PCR amplification is greatly improved when synthesis, while reducing the generation of primer dimer.

Meanwhile by selecting more optimized PCR reaction condition, such as primer concentration range (0.5-5mM)；Primer length range (20-30bp)；Probe length range (15-21bp)；Annealing temperature (57 DEG C -67 DEG C) when reaction；Expanding fragment length (80-300bp)；Testing gene group DNA concentration range (0.5-10ng) etc. further improves the specificity and expansion of PCR amplification Increasing Efficiency.

In the present invention, with the fluorescence probe Hydrolyze method (Taqman PCR) in Real-Time Fluorescent Quantitative PCR Technique, according to thin Born of the same parents' cytochrome p 450 CYP2C19*2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；With The synthetic oligonucleotide primer sequence object and probe of 4 polymorphic sites of 2 genes of PAR1:rs168753 carry out sample to be tested Real time fluorescent quantitative hydrolysis probes PCR judges the gene polymorphic of pcr amplification product gene according to the fluorescent value for reacting generation Property.(clone's contains human-cytochrome to the fluorescent differences and standard reference sample of genome amplification product between 4 sets of primers P450CYP2C19*2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；And PAR1: The plasmid of rs168753 genomic DNA fragment) comparison, improve the reliability and accuracy rate of data analysis result.

A specific fluorescence probe is added when the present invention is expanded using probe PCR while pair of primers is added, The probe is an oligonucleotides, both ends one reporter fluorescence group of label and a quenching fluorescence group respectively.When probe is complete, The fluorescence signal of reporter group transmitting is quenched group absorptions；When PCR amplification, the 5'-3' 5 prime excision enzyme activity of Taq enzyme is by probe Digestion degradation separates reporter fluorescence group and quenching fluorescence group, so that fluorescence monitoring system can receive fluorescence signal, i.e., As soon as every amplification DNA chain, has a fluorescent molecule to be formed, realizes the accumulation of fluorescence signal and PCR product is formed completely together Step.To reaction system such as primer concentration, annealing temperature, fragment amplification length, template DNA concentration, the reagent of reaction system is added Agent etc. carries out series of optimum, thus the P450CYP2C19*2:rs4244285 in accurate quickly detection human genome； CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；With the site PAR1:rs168753SNP, the technology of the present invention side The principle and method of case are also suitable for the SNP detection of other genes.

4 sets of specific primers are provided in the present invention, expand people P450CYP2C19*2:rs4244285；CYP2C19*3: rs4986893；CYP2C19*17:rs12248560；With the distinguished sequence on PAR1:rs168753 gene；With real-time fluorescence The Taqman method of quantitative PCR detects people P450CYP2C19*2:rs4244285；CYP2C19*3:rs4986893； CYP2C19*17:rs12248560；With 4 SNP sites of PAR1:rs168753.The present invention establishes fixed by real-time fluorescence for the first time Amount PCR hydrolysis probes technology (Taqman technology) detects P450CYP2C19*2:rs4244285 simultaneously；CYP2C19*3: rs4986893；CYP2C19*17:rs12248560；With the method for 4 polymorphisms of PAR1:rs168753 distribution.Of the invention 4 The detection scheme of a SNP combination has the characteristics that easy to operate, quick, accuracy rate is high, high-throughput, is appropriate for extensive P450CYP2C19*2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；And PAR1: The distribution of rs168753 gene SNP detects and its correlation research with disease.Meanwhile judging whether object to be measured belongs to medication Susceptible population, and then instruct and adjustment clinical application scheme provides foundation for clinical personalized treatment, prophylactic agent it is bad instead It answers, realizes accurate medication.

The present invention analyzes people P450CYP2C19*2:rs4244285 by real-time fluorescence quantitative PCR Taqman method； CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；With 4 polymorphic sites of PAR1:rs168753.And it answers Wherein P450CYP2C19*2:rs4244285 is detected with this method；CYP2C19*3:rs4986893；CYP2C19*17: rs12248560；3 SNP site combinations, with the distribution in cerebral apoplexy drug therapy patients with recurrent, are determined in China's Healthy crowd Specific 3SNP recurs close correlation with cerebral apoplexy drug therapy, to demonstrate present invention application clinically and can Row.

The present invention is to CYP2C19*2；CYP2C19*3；With 3 SNP of CYP2C19*17 combination China's Healthy crowd with The assessment of distribution in cerebral apoplexy drug therapy patients with recurrent, it has further been found that this 3 SNP sites may as clopidogrel/ The Risk factors of aspirin for treatment apoplexy patient event drug resistance can be detected from cerebral apoplexy drug therapy patients with recurrent Susceptible population, and then realize guidance and adjustment clinical application scheme.In addition, as the completely new anti-medicine of clopidogrel/aspirin Property biomarker combinations, are greatly improved medication precision, the adverse reaction of prophylactic agent.In conclusion for CYP2C19*2；CYP2C19*3；This 3 SNP site combine detections cannot be only used for the bad of prophylactic agent with CYP2C19*17 Reaction, and then instruct and adjust clinical application scheme, also foundation can be provided for clinical personalized treatment, realize accurate medication.

P450CYP2C19*2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；With Adverse reaction of the detection of 4 SNP sites of PAR1:rs168753 combination for prophylactic agent, guidance and adjustment clinical application side Case realizes that accurate medication correlation plays an important role and clinical meaning, and therefore, the present invention is not only that clopidogrel/aspirin is controlled Treatment provides experimental basis, also establishes high-throughput real-time fluorescence quantitative PCR Taqman method to screen, to realize early stage Theoretical and experiment basis has been established in accurate medication.To substantially reduce the adverse reaction disease incidence of drug, not only to patient individual Also there is immeasurable important meaning to development, the raising of the economy of entire society and medical level.

Main advantages of the present invention are:

Establish a kind of easy, accurate, quickly, high-throughput side for being used to detect cerebral apoplexy medication sensitive group screening Method.

Combined with specific embodiments below, the further old present invention in detail.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.The experimental method of detailed conditions is not specified in the following example, usually according to conventional strip Part such as U.S. Sambrook.J etc. writes " Molecular Cloning: A Laboratory room guide " (Huang Peitang etc. is translated, Beijing: Science Press, 2002) Described in condition, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number be by weight It calculates.Experimental material used in following embodiment and reagent can obtain unless otherwise instructed from commercially available channel.

The foundation of 1 real time fluorescent quantitative ApoE gene of embodiment and its clinical assessment and application

The foundation of one, real time fluorescent quantitative ApoE gene method

Real-Time Fluorescent Quantitative PCR Technique has the characteristics that real-time monitoring, quantitative and high throughput, and easy to operate, sensitive Degree is high.Quantitative fluorescent PCR is divided into probe quantitative PCR (Taqman method) and fluorescent dye quantitative PCR.Probe PCR (Taqman method) When referring to amplification while pair of primers is added be added a specific fluorescence probe, the probe be an oligonucleotides, two Hold one reporter fluorescence group of label and a quenching fluorescence group respectively.When probe is complete, the fluorescence letter of reporter group transmitting Number it is quenched group absorptions；When PCR amplification, the 5'-3' 5 prime excision enzyme activity of Taq enzyme degrades probe digestion, makes reporter fluorescence base Group separates with quenching fluorescence group, so that fluorescence monitoring system can receive fluorescence signal, as soon as that is, every amplification DNA chain, has One fluorescent molecule is formed, realize the accumulation of fluorescence signal and PCR product formed it is fully synchronized.The phase arrived according to reaction detection The fluorescence answered is to judge product.Relative to fluorescent dye, Taqman probe has sequence-specific, is bonded only to mutually Area is mended, and fluorescence signal and the copy number of amplification have one-to-one relationship, therefore high specificity high sensitivity, and item Piece optimization is easy；And relative to hybridization probe, as long as Taqman probe designs a probe, therefore probe designs relatively inexpensive side Just, and basic quantitative PCR requirement can be completed.

The basic principle of Taqman method detection SNP is that the fluorescence probe based on specificity can only be with corresponding complete complementary Nucleic acid-templated combination, but the nucleic acid-templated non-specific nucleic acid sequence probe of appearance cannot be combined with template.So using a pair of double marks Remember Taqman probe, respectively for the different genotype of double equipotential SNP, the probe amplification only exactly matched is corresponding out Genotype；Both probes are marked respectively with the fluorescent dye of two kinds of different wave lengths, so that it may the completion pair in a PCR reaction The genotype of single SNP site determines.

The present invention using it is above-mentioned based on by improvement real-time fluorescence quantitative PCR Taqman method: in a reaction tube into The reaction of row double PCR, detects quadruple fluorescence.It can once be completed to CYP2C19*2 by carrying out two reacting hole reactions simultaneously； 6 fluorescence channels detection of 3 SNP sites of CYP2C19*3 and CYP2C19*17 combination.To 1068 aspirin for treatment groups Clinical trial is carried out with 1081 clopidogrels/aspirin for treatment patient, to its possibility as medication metabolism detection combination Property makes assessment.First to CYP2C19*2；CYP2C19*3；CYP2C19*17 is combined: at least carrying a * 2 or * 3 Variation is known as afunction allele carrier.The function acquisition allele that is known as at least carrying one * 17 variation is taken Band person.Its distribution is shown in Table 1.

Table 1

Phase is applied alone with aspirin in the equipotentials gene carrier such as CYP2C19 afunction, clopidogrel-aspirin combination Than obviously not benefiting.And in function normal allele carrier, clopidogrel-aspirin combination and aspirin list Reduce Stroke Recurrence into 50% with comparing.

The present invention in people's full-length genome (GenBank:NCBI Reference Sequence:P450 CYP2C19*2: rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；And PAR-1:rs168753) SNP site Based on nucleotide sequence between the 100-200 of two sides, designs corresponding primer pair and carry out the amplification of DNA target fragment；Same hour hands 8 nucleic acid sequences Taqman probe that specifically different fluorophors mark is designed to this 4 SNP sites, it is fixed with real-time fluorescence The method for measuring PCRT Taqman detects P450CYP2C19*2:rs4244285；CYP2C19*3:rs4986893；CYP2C19* 17:rs12248560；With 8 SNP sites on PAR1:rs168753 gene.

The present invention is according to people P450CYP2C19*2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17: rs12248560；With the SNP of PAR1:rs168753 gene (GenBank:NCBI Reference Sequence: rs4244285；rs4986893；rs12248560；And rs168753) the corresponding primer of two sides sequent synthesis, SNP site is set Meter is at the middle part of Taqman probe.It is reacted by real-time fluorescence quantitative PCR Taqman, the DNA of human blood sample extraction is carried out Amplification, and according to the snp analysis of the shown fluorescent value progress target gene of amplification.

Two, experimental methods:

1. obtaining sample to be tested: the extracting of human gene group DNA in blood takes 500 μ L of human blood, is extracted and is tried with blood DNA The extracting of agent box measures 260nm light absorption value to calculate DNA concentration, and is diluted to 10ng/uL concentration.

2. according in human genome (GenBank:NCBI Reference Sequence:P450 CYP2C19*2: rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560；And PAR1:rs168753) SNP site two Based on nucleotide sequence between the 100-200 of side, designs corresponding primer pair and carry out the amplification of DNA target fragment；It is directed to simultaneously This 4 SNP sites design 8 nucleic acid sequences Taqman probe that specifically different fluorophors mark, with real time fluorescent quantitative The method of PCR Taqman detects P450CYP2C19*2；CYP2C19*3；CYP2C19*17；With 8 SNP on PAR1 gene Point.

Specific design is as follows, and (intermediate underscore is labeled as probe；It is SNP site in bracket):

CYP2C19*2:rs4244285 (SEQ ID NO.17)

AGATATGCAATAATTTTCCCACTATCATTGATTATTTCCC(G/A) GGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGA ATCGATGGACATCAACAACCCTCGGGACTTTAT

CYP2C19*3:rs4986893 (SEQ ID NO.18)

GATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTG(A/G) ATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTTTTTTTCTGGGAAATCCAAAATTCTATA TTG

CYP2C19*17:rs12248560 (SEQ ID NO.19)

AATGTGGTATATATTCAGAATAACTAATGTTTGGAAGTTGTTTTGTTTTGCTAAAACAAAGTTTTAGCAAACGATTT TTTTTTTCAAATTTGTGTCTTCTGTTCTCAAAG(C/T) ATCTCTGATGTAAGAGATAATGCGCCACGATGGGCATCAG AAGA

PAR1:rs1687537(SEQ ID NO.20)

ATAAACAAAAGTAAAATATGCTCTCTGCTTGTCGCTTTTGCCTTGTTGATGCGTTCACTTTTTACATTTAAAATTTT TTT(A/T)ATTTTATTTTTCAGAATCAAAAGCAACAAATGCCACCTTAGATCCCCGGTCATTTCTTCT

2 real-time fluorescence quantitative PCR primer of table and Taqman probe

The primer that the present invention constructs-fluorescence probe value and gene SNP type corresponding relationship, as shown in table 3.

Table 3 show two holes prediction fluorescence detection result of real-time fluorescence quantitative PCR Taqman proposed by the present invention (writing a Chinese character in simplified form for fluorescence in table)

Table 3

3. people CYP2C19*2；CYP2C19*3；CYP2C19*17；Clone and sequencing with PAR1 gene DNA fragment, sequencing As a result with GenBank sequences than more consistent

4. the implementation of real time fluorescent quantitative ApoE gene: to human gene group DNA (gDNA, 10ng/ μ L), into The real-time real-time fluorescence quantitative PCR Taqman reaction of row.Positive control is the CYP2C19* containing people that the present invention cloned and be sequenced identification 2；CYP2C19*3；CYP2C19*17；With the plasmid of PAR1 genomic DNA fragment, negative control is water.Reaction system and condition It is as follows:

Reaction condition is 95 DEG C, 5min；95 DEG C 30 seconds；62 DEG C 60 seconds；40 circulations.

5. the assessment of real time fluorescent quantitative equipotential PCR method

5.1. the test on positive control plasmid:

Contain CYP2C19*2 respectively with 8 prepared by the present invention；CYP2C19*3；CYP2C19*17；With PAR1 4 SNP (SK (+) plasmid is the positive control of PCR reaction to the pBluescript II of point gene group DNA fragmentation, to real time fluorescent quantitative PCR system is assessed, such as primer concentration, concentration and probe concentration, Mg ion concentration are adjusted, and further to reaction condition into Row optimization, inquires into the clinical application feasibility of method.

With CYP2C19*2；CYP2C19*3；CYP2C19*17；It is reaction condition: 95 for template with PAR1 gene plasmid DEG C 10 minutes, 95 DEG C 15 seconds, 64 DEG C 60 seconds；40 circulations.Snp analysis is carried out according to fluorescent value obtained after amplification.

In the present embodiment, fluorescent quantitative PCR reaction is carried out using 4 sets of primers and 8 probes.

5.2. the test on human gene group DNA's sample obtains the test result on genomic DNA sample.

6. the optimization of real-time fluorescence quantitative PCR Taqman method

6.1 due to non-specific amplification and primer dimer in PCR amplification presence, the present invention used chemical modification Thermal starting archaeal dna polymerase, due to the presence of non-specific amplification and primer dimer in PCR amplification, the present invention has used heat The Taq archaeal dna polymerase of starting, the sharpest edges of the polymerase are that it is different from general T aq archaeal dna polymerase, are repaired by chemistry Decorations, when temperature be lower than 50 DEG C when, polymerase activity is completely suppressed, 95 DEG C after ten minutes its polymerase activity be released.Cause This, carries out greatly improving the specificity of PCR amplification when DNA synthesis, while reducing the generation of primer dimer.

6.2 simultaneously, by selecting more optimized PCR reaction condition, such as primer concentration range (0.5-5mM)；Primer length Range (20-30bp)；Probe length range (15-21bp)；Annealing temperature (57 DEG C -67 DEG C) when reaction；Amplified fragments are long It spends (80-300bp)；Testing gene group DNA concentration range (0.5-10ng) etc. further improve PCR amplification specificity and Amplification efficiency.

Two, clinical assessments and clinical application:

The CYP2C19*2 established using the present invention；CYP2C19*3；4 of CYP2C19*17 and PAR-1 gene are polymorphic The detection method in property site.Screening is carried out to aspirin for treatment crowd and clopidogrel/aspirin for treatment crowd, can be sentenced Whether disconnected object to be measured belongs to medication Susceptible population, carries out the guidance and adjustment of clinical application scheme, for clinical personalized treatment Foundation, the adverse reaction of prophylactic agent are provided.

Distribution of each SNP type in crowd, as shown in table 4, it can be seen that, 4 SNP sites and clopidogrel/Ah Si There are high correlations for woods drug resistance, and it is easily touching to may determine that whether object to be measured belongs to medication to the detection of SNP combination Group carries out the guidance and adjustment of clinical application scheme, provides foundation, the adverse reaction of prophylactic agent for clinic personalized treatment.

4 4SNP of table combines the screening results in aspirin for treatment crowd and clopidogrel/aspirin for treatment crowd

Abbreviation: NE does not detect

In upper table, incidence is Stroke Recurrence rate after medication, in clopidogrel/aspirin combination group, PAR-1 variation The Stroke Recurrence rate of carrier (AT or TT) is substantially less than wild type patient, and (wherein, AT type recurrence rate compared with AA type reduces 46.2%) 20.3%, TT type recurrence rate compared with AA type reduce, therefore recommend PAR-1 variation carrier (AT or TT) plus use Clopidogrel.And in the unmutated patient of CYP2C19*2, CYP2C19*3 and CYP2C19*17, it is applied alone the incidence of aspirin to want It is significantly higher than incidence associated with clopidogrel-aspirin, thus suggests clopidogrel-aspirin combination.

Embodiment 2: CYP2C19*2 is detected with PCR sequencing PCR；CYP2C19*3；CYP2C19*17 and PAR-1 gene type

The goldstandard in the site of gene pleiomorphism is PCR sequencing PCR at present, and the present embodiment is using PCR sequencing PCR to CYP2C19*2； CYP2C19*3；Distribution of the CYP2C19*17 and PAR-1 gene in healthy population is studied.By with real time fluorescent quantitative PCR Taqman result obtained is compared to assess the reliability of method of the invention and accuracy.

PCR sequencing PCR, which refers to, is expanded the target gene fragment of sample to be tested by Standard PCR technology, by traditional double de- Oxygen method carries out sequencing, and compares with original series, to analyze polymorphic site, most generally uses at present Method for SNP research.It can be measured in population using this method, between population in the species molecule level of different level Difference can be used for the research of genotyping and bio-diversity.

The present embodiment is with CYP2C19*2；CYP2C19*3；Screening of the CYP2C19*17 and PAR-1 gene in healthy population For distribution, the genotype distribution situation in healthy population is detected using sequencing means.

Detection method is sequenced in the present embodiment, to CYP2C19*2；CYP2C19*3；CYP2C19*17 and PAR-1 gene SNP exists Distribution in healthy population is studied.By the way that compared with other ethnic groups, this group of SNP site is in chlorine pyrrole in parsing Chinese population Gray/aspirin Drug Sensitivity difference.It is compared simultaneously with above-mentioned Taqman method, it was demonstrated that two methods detection knot The consistency of fruit

According to people CYP2C19*2；CYP2C19*3；CYP2C19*17 and PAR-1 gene polymorphism sites two sides nucleotides sequence Column are respectively synthesized 4 sets of corresponding primers, and every set primer is directed to a single-minded polymorphic site, which is located at Among pcr amplification product, consequently facilitating sequencing and analysis

Preferably above-mentioned PCR response procedures include:

(a) due to the presence of non-specific amplification and primer dimer in PCR amplification, the present invention has used pfu DAN Polymerase, which has the DNA synthase activity at -3 ' end of 5 ' end and the DNA 5 prime excision enzyme activity at 3 ' -5 ' ends, therefore both can be carried out DNA synthesis can identify immediately again and cut off mismatched nucleotide, greatly improve the specificity of PCR amplification, while reducing and drawing The generation of object dimer.

(b) by holding end to carry out thiophosphorylation modification primer 3 ', prevent prime end by pfu DAN polymerase 3 ' -5 ' 5 prime excision enzyme activities are degraded, to further increase the specificity of amplification.

(c) by primer concentration range (0.5-5mM), primer length range (20-30bp), reaction annealing temperature when Spend (60 DEG C -67 DEG C), expanding fragment length (200-400bp), testing gene group DNA concentration range (5-15ng), reactant System etc. more accurately optimizes and selectes, and further improves the amplification efficiency and amplification specificity of PCR.

In 3 ' end ends, there are features inductile when mispairing using primer in PCR reaction for the present embodiment, by equipotential base SNP locus of gene designs the end at 3 ' ends of fluorescence quantification PCR primer, and is suitably modified it, in addition pfu DNA is poly- The means such as the application of synthase, in addition also to the reaction condition of PCR such as primer concentration, annealing temperature, fragment amplification length, template The a series of conditions such as DNA concentration optimize, and are detected by DNA agarose gel electrophoresis, according to whether there is or not amplified production and BanI Endonuclease bamhi length and obtain reliable and accurate result.The present invention not only can accurately detect the CYP2C19*2 in human genome； CYP2C19*3；CYP2C19*17 and PAR-1 gene, while applying also for other gene mutations and SNP detection.

One, experimental method:

1. obtaining sample to be tested: the extracting of human gene group DNA in blood takes 500 μ L of human blood, is extracted and is tried with blood DNA The extracting of agent box measures 260nm light absorption value to calculate DNA concentration, and is diluted to 10ng/ μ L concentration.

2. the design of primer: referring to (GenBank:NCBI Reference Sequence:CYP2C19* in human genome 2:rs4244285；CYP2C19*3:rs4986893；CYP2C19*17:rs12248560 and PAR1:rs168753) SNP site Based on nucleotide sequence between the 200-300bp of two sides, designs corresponding primer pair and carry out the amplification of DNA target fragment, be shown in Table 5:

The design of 5 sequencing analysis primer of table

3. carrying out thiophosphorylation modification to the end that every primer 3 ' is held simultaneously.

4. people CYP2C19*2；CYP2C19*3；CYP2C19*17；Clone and sequencing with PAR-1 genomic DNA fragment:

4.1. design of primers: referring to (GenBank:NCBI Reference Sequence:CYP2C19* in human genome 2:rs4244285；CYP2C19*3:rs4986893；And CYP2C19*17:rs12248560；And PAR-1:rs168753) SNP Based on nucleotide sequence between the 100-200 of site two sides, designs corresponding primer pair and carry out the amplification of DNA target fragment；

Primer sequence is shown in Table 5:

The sequence of acquisition is respectively following:

CYP2C19*2:rs4244285 (SEQ ID NO.17):

AGATATGCAATAATTTTCCCACTATCATTGATTATTTCCC(G/A) GGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGA ATCGATGGACATCAACAACCCTCGGGACTTTAT

CYP2C19*3:rs4986893 (SEQ ID NO.18):

GATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTG(A/G) ATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTTTTTTTCTGGGAAATCCAAAATTCTATA TTG

CYP2C19*17rs12248560(SEQ ID NO.19):

AATGTGGTATATATTCAGAATAACTAATGTTTGGAAGTTGTTTTGTTTTGCTAAAACAAAGTTTTAGCAAACGATTT TTTTTTTCAAATTTGTGTCTTCTGTTCTCAAAG(C/T)ATCTCTGATGTAAGAGATAATGCGCCACGATGGGCATCA GAAGA

PAR1:rs1687537(SEQ ID NO.20)

ATAAACAAAAGTAAAATATGCTCTCTGCTTGTCGCTTTTGCCTTGTTGATGCGTTCACTTTTTACATTTAAAATTTT TTT(A/T)ATTTTATTTTTCAGAATCAAAAGCAACAAATGCCACCTTAGATCCCCGGTCATTTCTTCT

4.2.PCR amplified reaction: following PCR reaction system is used.

Following reagent is added in a 200 μ L trace P CR reaction tubes:

Deionization aqua sterilisa is added to final volume 50uL.

PCR reaction condition be 94 DEG C 5 minutes, 94 DEG C 30 seconds, 54 DEG C 1 minute, 72 DEG C 1 minute, 40 circulation, then 72 DEG C Extend 10 minutes.

4.3.PCR product cloning: the PCR fragment amplified is recycled through PCR product QIAquick Gel Extraction Kit, then poly- with T4DNA The filling-in end synthase (T4DNA polymerase), then through agarose gel electrophoresis, target fragment plastic recovery kit is returned Purifying is received, is then inserted into the site EcoRV on pBluesecript II SK (+) carrier, method is shown in document (Sambrooks, molecular cloning handbook), connection product is transformed into DH5 bacterial strain, with PCR method screening positive clone.

4.4. positive colony is subjected to determined dna sequence, sequencing result and GenBank sequences are than more consistent.

5. the foundation of positive control:

To contain CYP2C19*2；CYP2C19*3；CYP2C19*17；With the plasmid of PAR-1 genomic DNA fragment

Two, interpretations of result:

1.CYP2C19*2；CYP2C19*3；Distribution of the CYP2C19*17 and PAR-1 in Chinese han population

The present invention detects CYP2C19*2；CYP2C19*3；With CYP2C19*17 and PAR-1SNP combination in Chinese population Respectively such as table 6:

Table 6

From two methods crowd distribution percentage relatively from (be shown in Table 4), detection method proposed by the present invention High consistency is presented with both sequencing detection method results.Therefore real-time fluorescence quantitative PCR proposed by the present invention Taqman method detects reliability with higher and accuracy, so as to which for screening object to be measured, whether to belong to medication susceptible Crowd carries out the guidance and adjustment of clinical application scheme, provides foundation for clinic personalized treatment.

Embodiment 3

Present embodiments provide a kind of human-cytochrome P450CYP2C19*2；CYP2C19*3；CYP2C19*17；With PAR1:rs168753 genome single nucleotide polymorphism (SNP) real-time fluorescence quantitative PCR Taqman detection kit.

This kit can be to the CYP2C19*2 in human genome；CYP2C19*3；CYP2C19*17；And PAR1: The site rs168753 carries out identification detection, the parting suitable for combination S NP analysis.Kit uses fluorescence probe Hydrolyze method The principle of (Taqman method), the primer concentration including being most suitable for real-time fluorescence quantitative PCR reaction, concentration and probe concentration, and use Thermal starting Taq archaeal dna polymerase and most matched buffer is reacted with multiple real time fluorescence quantifying and primer combines, it can be effective Ground inhibits nonspecific PCR amplification, achievees the purpose that highly sensitive, high-throughput real-time fluorescence quantitative PCR amplified reaction.It carries out real When testing, the preparation of PCR reaction solution is very convenient simple.It can be to human genome CYP2C19*2；CYP2C19*3；CYP2C19*17； It is accurately analyzed with PAR1:rs 168753.

The composition of 7 kit of table

Reaction solution reagent A: 2 × PCR Master of the DNA of Taq containing thermal starting polymerase

Reaction solution reagent B:CYP2C19*2；Two sets of primers of CYP2C19*3 and corresponding 4 SNP probes

Reaction solution reagent D: CYP2C19*17；With two sets of primers of PAR1:rs168753 and corresponding 4 SNP probes

Working standard 1: CYP2C19*2 containing people；4 DNA clones in the site CYP2C19*3SNP

Working standard 2: CYP2C19*17 containing people；With 4 DNA clones in the site PAR-1:rs168753SNP

The present embodiment is using this kit to human genome CYP2C19*2；CYP2C19*3；CYP2C19*17；And PAR1: Rs168753SNP carries out identification detection, and the Real Time PCR amplification instrument being applicable in includes:

Thermal CyclerReal Time System

SmartSystem/SmartII System(Cepheid)

Applied Biosystems 7900HT/7300/7500Real-Time PCR System、7500 Fast Real-Time PCR System、StepOnePlus^TM Real-Time PCR System(Applied Biosystems)

(Roche Diagnostics)

Mx3000P^TM(Stratagene)

The transport of this kit can carry out under 2~8 DEG C of environment.When storage, -20 DEG C of preservations must be set.

Validity period: this kit validity period is 12 months, is used before the deadline.

This kit has used thermal starting Taq archaeal dna polymerase to carry out PCR amplification, glimmering by specificity in monitoring reaction solution Light achievees the purpose that detect PCR product.With the CYP2C19*2 in human gene group DNA；CYP2C19*3；CYP2C19*17；With For the purpose of PAR1:rs168753 gene carries out PCR amplification, by under the thermal denaturation of DNA chain, primer annealing, archaeal dna polymerase effect Three step cycles of primer extend it is reciprocal, can expand in a short time to human genome CYP2C19*2；CYP2C19*3； CYP2C19*17；With PAR1:rs168753 genomic DNA fragment.

Archaeal dna polymerase in kit is due to having used thermal starting Taq archaeal dna polymerase, to inhibit production when primer annealing Raw primer dimer and its caused non-specific amplification, greatly improves the accuracy rate of PCR amplification.

Using this kit using fluorescence probe detection method in human genome to human genome CYP2C19*2； CYP2C19*3；CYP2C19*17；Identification detection is carried out with PAR1:rs168753SNP, passes through the fluorescence in detection PCR reaction solution Signal strength can accurately detect SNP.

This kit is reacted suitable for Real-time PCR, can be quickly and accurately to human genome CYP2C19*2； CYP2C19*3；CYP2C19*17；It detected, analyzed with PAR1:rs168753SNP.

It is mixed with primer in reaction solution in advance, when PCR reaction solution is prepared, DNA profiling, sterile distilled water need to only be added can be into Row Real Time PCR reaction, it is simple to operate.

Archaeal dna polymerase has used thermal starting archaeal dna polymerase, and solely self-developed multiplex PCR Laemmli buffer system Laemmli is mutually tied with company It closes, there is the characteristics of high amplification efficiency, height amplification sensitivity, high specific amplification.

Using this kit the following steps are included:

1, the human gene group DNA of extracting is diluted to 0.5-15ng/ μ L with nucleic acid dilution buffer.

2, the 2 diluted sample DNAs of μ L are respectively taken, are separately added into 2 PCR reacting holes.

3, each 8 μ L of reaction tube B and C in kit is taken, is separately added into 2 reacting holes.

4,10 μ L reagents in reaction tube A is taken to be separately added into reacting hole.

5, negative control is handled respectively according to above-mentioned same method；Working standard 1；Working standard 2；

6, good reaction solution made above is mixed, is then centrifuged 3 minutes under 5000rpm revolving speed.

7, reaction tube real-time fluorescent PCR amplification instrument is put into carry out amplification reaction.

8, loop parameter is set: 95 DEG C of 10min；95 DEG C 20 seconds；62 DEG C 60 seconds；40 circulations.

Using the kit to the CYP2C19*2 of normal Chinese Chinese Han Population healthy person；CYP2C19*3；CYP2C19*17； Detection has been carried out with PAR-1:rs168753SNP and has compared (table 6), and testing result is as described above in Example.It can be seen that this hair Bright kit cannot be only used for the CYP2C19*2 in normal population；CYP2C19*3；CYP2C19*17；And PAR-1: Rs168753SNP distribution and disease associated research, and can be used for screening whether object to be measured belongs to medication Susceptible population, The guidance and adjustment of clinical application scheme are carried out, provides foundation for clinic personalized treatment.

Using the kit in the present embodiment, SNP detection is carried out for the sample of 500 patients randomly selected.Then Medication guide is carried out based on following principle:

(a) when detecting PAR-1:rs168753 loci gene type is AA, it is proposed that aspirin for treatment is applied alone；

(b) when detecting that mutation occurs in 168753 site PAR-1:rs (genotype is AT or TT), it is proposed that clopidogrel It is combined with aspirin；

(c) when detecting single mutation (genotype GA) or double mutation occur by CYP2C19*2:rs4244285 (genotype is When AA), it is not recommended that use clopidogrel；

(d) when detecting single mutation (genotype GA) or double mutation occur by CYP2C19*3:rs4986893 (genotype is When AA), it is not recommended that use clopidogrel；

(e) when detecting that single mutation (genotype CT) or double mutation (genotype occurs in CYP2C19*17:rs12248560 When for TT), clopidogrel is used with caution.

Part detects as shown in the table the case where there are the typical patients of SNP.

Table 8

Note: "-- " indicate that there is no mutation (i.e. wild type) in the site；" -+" indicates the site there are single mutation (miscellaneous It closes)；" ++ " indicates that the site has double mutation (homozygosis).

For example, for PAR-1:rs16875, "-- " indicate AA；" -+" indicates AT；"++"TT.CYP2C19*2； CYP2C19*3；Expression of CYP2C19*17 and so on.

To 3-1 patient (similar patient totally 52), when routinely aspirin is administered, therapeutic effect is unobvious.Afterwards more The combination of aspirin and clopidogrel is changed, therapeutic effect is obvious.

Aspirin is applied to 3-2a patient (similar patient totally 63), effect is not significant, increases dosage (for routine 2 times of dosage) after, therapeutic effect has improvement.

Aspirin is applied to 3-2b patient (similar patient totally 62), effect is not significant；After use instead aspirin and Clopidogrel combination, therapeutic effect are obvious.

To 3-3 patient (similar patient totally 21), it is not recommended that application clopidogrel.

To 3-4 patient (similar patient totally 1), it is not recommended that application clopidogrel.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Sequence table

<110>Baijing Tiantan Hospital

<120>a kind of human-cytochrome CYP2C19 and PAR1 gene polymorphism sites detection kit and purposes

<130> P2017-0172

<160> 23

<170> PatentIn version 3.5

<210> 1

<211> 26

<212> DNA

<213>artificial sequence

<400> 1

agatatgcaa taattttccc actatc 26

<210> 2

<211> 24

<212> DNA

<213>artificial sequence

<400> 2

ataaagtccc gagggttgtt gatg 24

<210> 3

<211> 26

<212> DNA

<213>artificial sequence

<400> 3

gatggaaaaa ttgaatgaaa acatca 26

<210> 4

<211> 25

<212> DNA

<213>artificial sequence

<400> 4

ctgggaaatc caaaattcta tattg 25

<210> 5

<211> 25

<212> DNA

<213>artificial sequence

<400> 5

ctgggaaatc caaaattcta tattg 25

<210> 6

<211> 26

<212> DNA

<213>artificial sequence

<400> 6

tagttattct gaatatatac cacatt 26

<210> 7

<211> 24

<212> DNA

<213>artificial sequence

<400> 7

cttttgcctt gttgatgcgt tcac 24

<210> 8

<211> 21

<212> DNA

<213>artificial sequence

<400> 8

caacaaatgc caccttagat c 21

<210> 9

<211> 21

<212> DNA

<213>artificial sequence

<400> 9

tatgggttcc ccgggaaata a 21

<210> 10

<211> 21

<212> DNA

<213>artificial sequence

<400> 10

tatgggttcc ctgggaaata a 21

<210> 11

<211> 19

<212> DNA

<213>artificial sequence

<400> 11

ttacctggat tcagggggt 19

<210> 12

<211> 19

<212> DNA

<213>artificial sequence

<400> 12

ttacctggat ccagggggt 19

<210> 13

<211> 21

<212> DNA

<213>artificial sequence

<400> 13

ttctcaaagc atctctgatg t 21

<210> 14

<211> 21

<212> DNA

<213>artificial sequence

<400> 14

ttctcaaagt atctctgatg t 21

<210> 15

<211> 26

<212> DNA

<213>artificial sequence

<400> 15

ctgaaaaata aaattaaaaa aatttt 26

<210> 16

<211> 26

<212> DNA

<213>artificial sequence

<400> 16

ctgaaaaata aaataaaaaa aatttt 26

<210> 17

<211> 151

<212> DNA

<213>people

<220>

<221> misc_feature

<222> (41)..(41)

<223>n=g or a

<400> 17

agatatgcaa taattttccc actatcattg attatttccc nggaacccat aacaaattac 60

ttaaaaacct tgcttttatg gaaagtgata ttttggagaa agtaaaagaa caccaagaat 120

cgatggacat caacaaccct cgggacttta t 151

<210> 18

<211> 126

<212> DNA

<213>people

<220>

<221> misc_feature

<222> (46)..(46)

<223>n=a or/g

<400> 18

gatggaaaaa ttgaatgaaa acatcaggat tgtaagcacc ccctgnatcc aggtaaggcc 60

aagttttttg cttcctgaga aaccacttac agtctttttt tctgggaaat ccaaaattct 120

atattg 126

<210> 19

<211> 155

<212> DNA

<213>people

<220>

<221> misc_feature

<222> (111)..(111)

<223>n=c or t

<400> 19

aatgtggtat atattcagaa taactaatgt ttggaagttg ttttgttttg ctaaaacaaa 60

gttttagcaa acgatttttt ttttcaaatt tgtgtcttct gttctcaaag natctctgat 120

gtaagagata atgcgccacg atgggcatca gaaga 155

<210> 20

<211> 141

<212> DNA

<213>people

<220>

<221> misc_feature

<222> (81)..(81)

<223> n=a/t

<400> 20

ataaacaaaa gtaaaatatg ctctctgctt gtcgcttttg ccttgttgat gcgttcactt 60

tttacattta aaattttttt nattttattt ttcagaatca aaagcaacaa atgccacctt 120

agatccccgg tcatttcttc t 141

<210> 21

<211> 22

<212> DNA

<213>artificial sequence

<400> 21

ataagtggtt ctatttaatg tg 22

<210> 22

<211> 28

<212> DNA

<213>artificial sequence

<400> 22

ccactttcat cctgggctgt gctccctg 28

<210> 23

<211> 23

<212> DNA

<213>artificial sequence

<400> 23

tcttattttt tctcatgagc atc 23

Claims (10)

1.PAR-1:rs168753 the purposes of gene loci and/or its detection reagent, which is characterized in that be used to prepare reagent or examination Agent box, the reagent or kit are for detecting detected object to the sensibility of antiplatelet drug.

2. purposes as described in claim 1, which is characterized in that the reagent or kit further include detection selected from the group below one The detection reagent of a or multiple gene locis: CYP2C19*2:rs4244285 gene loci, CYP2C19*3:rs4986893 base Because of site and CYP2C19*17:rs12248560 gene loci.

3. purposes as described in claim 1, which is characterized in that if the detected object is said in following gene mutation The bright object is sensitive to antiplatelet drug clopidogrel:

PAR-1:rs168753 A→T。

4. a kind of kit, which is characterized in that the kit includes PAR1:rs168753 gene loci detection reagent.

5. kit as claimed in claim 4, which is characterized in that the kit further include detection it is selected from the group below one or The detection reagent of multiple gene locis: CYP2C19*2:rs4244285 gene loci, CYP2C19*3:rs4986893 gene position Point and CYP2C19*17:rs12248560 gene loci.

6. kit as claimed in claim 5, which is characterized in that the kit contains one or more selected from the group below Reagent:

(A) it is used for the specific primer of genetic test；

(B) it is used for the specific probe of genetic test；

(C) it is used for the chip of genetic test；

(D) for detecting the specific antibody of amino acid mutation corresponding to the gene of mutation；

Wherein, the specific primer, the specific probe, the chip pins are to gene loci selected from the group below: CYP2C19*2:rs4244285 gene loci, CYP2C19*3:rs4986893 gene loci, CYP2C19*17:rs12248560 Gene loci and PAR-1:rs168753 gene loci；

The gene of the mutation contains the gene loci of mutation selected from the group below:

CYP2C19*2:rs4244285 gene loci, CYP2C19*3:rs4986893 gene loci, CYP2C19*17: Rs12248560 gene loci and PAR1:rs168753 gene loci.

7. kit as claimed in claim 6, which is characterized in that the primer includes:

Primer pair 1, for CYP2C19*2:rs4244285 gene loci:

The sequence of upstream primer 5 ' -3 ' are as follows: AGATATGCAATAATTTTCCCACTATC (Seq ID No.1),

The sequence of downstream primer 5 ' -3 ' are as follows: ATAAAGTCCCGAGGGTTGTTGATG (Seq ID No.2)；

Primer pair 2, for CYP2C19*3:rs4986893 gene loci:

The sequence of upstream primer 5 ' -3 ' are as follows: GATGGAAAAATTGAATGAAAACATCA (Seq ID No.3),

The sequence of downstream primer 5 ' -3 ' are as follows: CTGGGAAATCCAAAATTCTATATTG (Seq ID No.4)；

Primer pair 3, for CYP2C19*17:rs12248560 gene loci:

The sequence of upstream primer 5 ' -3 ' are as follows: TCTTCTGATGCCCATCGTGGCGCATT (Seq ID No.5),

The sequence of downstream primer 5 ' -3 ' are as follows: TAGTTATTCTGAATATATACCACATT (Seq ID No.6)；

Primer pair 4, for PAR-1:rs168753 gene loci

The sequence of upstream primer 5 ' -3 ' are as follows: CTTTTGCCTTGTTGATGCGTTCAC (Seq ID No.7),

The sequence of downstream primer 5 ' -3 ' are as follows: CAACAAATGCCACCTTAGATC (Seq ID No.8).

8. kit as claimed in claim 7, which is characterized in that further include probe sequence selected from the group below in the kit Column:

Probe 1, for CYP2C19*2:rs4244285 gene loci:

P1:FAM-TATGGGTTCCCCGGGAAATAA-BHQ1 (SEQ ID NO.9)

P2:ROX-TATGGGTTCCCTGGGAAATAA-BHQ2(SEQ ID NO.10)；

Probe 2, for CYP2C19*3:rs4986893 gene loci:

P3:VIC-TTACCTGGATTCAGGGGGT-BHQ1 (SEQ ID NO.11)

P4:TAMRA-TTACCTGGATCCAGGGGGT-BHQ2 (SEQ ID NO.12)；

Probe 3, for CYP2C19*17 rs12248560 gene loci:

P5:FAM-TTCTCAAAGCATCTCTGATGT-BHQ1 (SEQ ID NO.13)

P6:ROX-TTCTCAAAGTATCTCTGATGT-BHQ2 (SEQ ID NO.14)；

Probe 4, for PAR1:rs168753 gene loci:

P13:FAM-CTGAAAAATAAAATTAAAAAAATTTT-BHQ1 (SEQ ID NO.15)

P14:ROX-CTGAAAAATAAAATAAAAAAAATTTT-BHQ2 (SEQ ID NO.16).

9. a kind of method that vitro detection sample whether there is single nucleotide variations, which is characterized in that comprising steps of

(a) polynucleotides for using primer amplified sample, obtain amplified production；With

(b) detecting whether there is following single nucleotide variations in amplified production:

PAR-1:rs168753 A→T；With

CYP2C19*2:rs4244285 G → A；

CYP2C19*3:rs4986893 G → A；

CYP2C19*17:rs12248560 C → T.

10. a kind of detection individual is to the method for the sensibility of antiplatelet drug, which is characterized in that it comprising steps of

(i) gene loci selected from the group below of the individual is detected, and with the presence or absence of base compared with corresponding normal gene site Because of mutation:

PAR-1:rs168753；

CYP2C19*2:rs4244285；

CYP2C19*3:rs4986893；With

CYP2C19*17:rs12248560.