CN110438262B - Hepatitis B virus typing and drug-resistant gene detection kit - Google Patents

Hepatitis B virus typing and drug-resistant gene detection kit Download PDF

Info

Publication number
CN110438262B
CN110438262B CN201910692625.1A CN201910692625A CN110438262B CN 110438262 B CN110438262 B CN 110438262B CN 201910692625 A CN201910692625 A CN 201910692625A CN 110438262 B CN110438262 B CN 110438262B
Authority
CN
China
Prior art keywords
seq
artificial sequence
primer
hepatitis
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910692625.1A
Other languages
Chinese (zh)
Other versions
CN110438262A (en
Inventor
黄桃生
蒋析文
李欣钰
郑若楠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Da'an Gene Co ltd
Original Assignee
Guangzhou Da'an Gene Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Da'an Gene Co ltd filed Critical Guangzhou Da'an Gene Co ltd
Priority to CN201910692625.1A priority Critical patent/CN110438262B/en
Publication of CN110438262A publication Critical patent/CN110438262A/en
Application granted granted Critical
Publication of CN110438262B publication Critical patent/CN110438262B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/706—Specific hybridization probes for hepatitis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The application provides a hepatitis B virus typing and drug-resistant gene detection kit, in particular discloses a detection kit and a detection method for detecting the type of the hepatitis B virus and the correlation of drug-resistant sites by utilizing a multiple asymmetric PCR technology and an electrochemical gene sensor method, and experimental results show that the detection method and the kit have the advantages of good detection accuracy, high specificity, simplicity and automation in operation and higher flux, and can provide important references for the administration of patients with hepatitis B.

Description

Hepatitis B virus typing and drug-resistant gene detection kit
Technical Field
The application belongs to the technical field of biology, and particularly relates to a hepatitis B virus typing and drug-resistant gene detection kit.
Background
Hepatitis B Virus (HBV) is a DNA virus which causes lesions in human liver and is the main cause of liver cirrhosis, liver cancer and chronic hepatitis. It is a serious global health problem. It is estimated by WHO that there are 2.5 million people infected with hepatitis b virus worldwide (positive for hepatitis b surface antigen), and hepatitis b in 2015 causes 88.7 ten thousand deaths.
Currently, clinically used nucleoside (nucleotide) analogue drugs for treating hepatitis b virus are mainly Lamivudine (LAM), adefovir (ADV), entecavir (ETV) and telbivudine (LdT), and viral load is reduced by inhibiting viral replication with these drugs. None of these drugs can completely cure hepatitis b virus and patients need to take the drugs for a long period of time to maintain the therapy. HBV viruses can undergo various degrees of drug resistance mutations due to prolonged use of anti-HBV therapeutic drugs by patients. In the treatment of hepatitis B, once the drug resistance occurs, the virus replication inhibition capability of the original effective antiviral drug is greatly reduced. Meanwhile, drug resistance can lead to adverse consequences such as repeated illness state, disease progression and the like, and cross drug resistance among drugs can also bring great difficulty to the selection of subsequent treatment. The inspection of hepatitis B virus drug resistance mainly includes inspection of whether the hepatitis B virus of the organism generates variation and drug resistance, and through inspection of the variation of the hepatitis B virus drug resistance, people can know the quantity, replication condition, infectivity intensity, and suitability for taking which type of drugs are more effective, etc. Thereby laying a solid foundation for the treatment and rehabilitation of hepatitis B. Therefore, the clinical detection of the hepatitis B virus drug-resistant mutation site has important guiding significance for timely adjusting the treatment scheme, guiding clinical medication and monitoring the curative effect of the antiviral drug in real time.
The current common typing and SNP mutation site detection methods include a real-time fluorescence PCR method, a PCR-Sanger sequencing method, a chip method, a PCR-high resolution dissolution curve (HRM) method and the like.
The real-time fluorescence PCR method has high sensitivity, accurate typing, simple and quick operation, easy popularization of the used instrument and easy popularization and use. However, the method has low flux, high probe cost, and the detection cost of a single site is related to the sample size, and the smaller the sample size is, the higher the cost is.
The PCR-Sanger sequencing method belongs to qualitative detection, and has the advantages of longer sequencing length and capability of finding new mutation sites. The main disadvantages are: the sensitivity is not high, and especially when the mutation rate of target genes in tissues is lower than 20% in tumor tissue somatic mutation detection, false negative results can occur; special requirements on reagents and instruments are met, and the popularization is not easy; complex operation, relatively high cost, low speed and low flux.
The chip method is mainly a reverse spot hybridization technology, and the method uses simple instruments, but the hybridization process is long in time consumption, complex in operation and low in sensitivity;
the PCR-high resolution melting curve (HRM) method has the advantages of simple and quick operation, large flux, low use cost and accurate result, is favorable for realizing closed tube operation, and can determine the methylation degree according to the melting curve when methylation detection is carried out. The disadvantages of this method are: the newly occurring genetic variation in the nucleic acid to be tested cannot be excluded; since single base mutation causes very small changes in DNA melting temperature, the method has high requirements on the sensitivity and resolution of the instrument.
Therefore, those skilled in the art are working to develop a novel molecular diagnostic method with high accuracy and simple operation, which can detect various genotypes and drug-resistant sites simultaneously, so as to guide clinical medication.
Disclosure of Invention
The application aims to provide a hepatitis B virus typing and drug-resistant gene detection kit.
In a first aspect of the application, there is provided a set of PCR primer pairs for Hepatitis B Virus (HBV) typing and drug resistance gene detection, the set of primer pairs comprising a first primer pair comprising a forward primer as shown in SEQ ID NO. 1; and, a reverse primer as set forth in SEQ ID NO. 2.
In another preferred embodiment, the primer pair set further comprises a second primer pair comprising a forward primer as set forth in SEQ ID NO. 3; and, a reverse primer as set forth in SEQ ID NO. 4.
In another preferred embodiment, the primer pair set further comprises a third primer pair comprising a forward primer as set forth in SEQ ID NO. 5; and, a reverse primer as set forth in SEQ ID NO. 6.
In another preferred embodiment, the primer pair set further comprises a fourth primer pair comprising a forward primer as set forth in SEQ ID NO. 7; and, a reverse primer as set forth in SEQ ID NO. 8.
In another preferred embodiment, the primer pair set further comprises a fifth primer pair comprising a forward primer as set forth in SEQ ID NO. 9; and, a reverse primer as set forth in SEQ ID NO. 10.
In another preferred embodiment, the primer pair set further comprises a sixth primer pair comprising a forward primer set forth in SEQ ID NO. 54; and a reverse primer as set forth in SEQ ID NO. 55.
In a second aspect of the present application, there is provided a signaling probe set for Hepatitis B Virus (HBV) typing and drug resistance gene detection, the signaling probe set comprising one or more signaling probes selected from the group consisting of:
173WSP：TATGGGAGTGGGCCTCA，SEQ ID NO.:11；
173MSP：TATGGGATTGGGCCT，SEQ ID NO.:12；
180MSP：GTTTCTCATGGCTCA，SEQ ID NO.:13；
180WSP1：CGTTTCTCTTGGCTCAG，SEQ ID NO.:14；
180WSP2：GTTTCTCCTGGCTCAGT，SEQ ID NO.:15；
181MSP1：TTCTCATGGTTCAGTTTAC，SEQ ID NO.:16；
181MSP2：TTTCTCCTGACTCAGTTTA，SEQ ID NO.:17；
194WSP1：CGTAGGGCATTCCC，SEQ ID NO.:56；
194WSP2：CGCCGGGCTTTC，SEQ ID NO.:57；
194MSP：CGCCGGACTTTCC，SEQ ID NO.:58；
204WSP：TTCAGTTATATGGATGATG，SEQ ID NO.:18；
204MSP1：TCAGTTATGTGGATGAT，SEQ ID NO.:19；
204MSP2：CAGTTATATAGATGATGTG，SEQ ID NO.:20；
204MSP3：CAGTTATATTGATGATGTG，SEQ ID NO.:21；
204MSP4：CAGTTATATCGATGATGTG，SEQ ID NO.:22；
236WSP1：ACATTTGAACCCTAATA，SEQ ID NO.:23；
236WSP2：ACATTTGAATCCTCATA，SEQ ID NO.:24；
236MSP：ACATTTAACCCCTCACA，SEQ ID NO.:25；
250WSP：AAATTTCATGGGTTATGT，SEQ ID NO.:26；
250MSP：TTAATTTCGTGGGATAT，SEQ ID NO.:27；
B-SP：TCCCAAATCTCCAGTCA，SEQ ID NO.:28；
C-SP: GAGCACCCACGT, SEQ ID NO. 29; and, a step of, in the first embodiment,
D-SP：ATCTTTCCACCAGCAAT，SEQ ID NO.:30。
in another preferred embodiment, the signaling probe set further comprises signaling probes:
NB-SP：GCATCTTCAAACTCAAA，SEQ ID NO.:31。
in a third aspect of the present application, there is provided a capture probe set for Hepatitis B Virus (HBV) typing and drug resistance gene detection, the capture probe set comprising one or more capture probes selected from the group consisting of:
173CP：TGGGCTTTCGCAAGATTCCTAT，SEQ ID NO.:32
180CP：ATGGGAGTGGGCCTCAGT，SEQ ID NO.:33
194CP：AGTGCCATTTGTTCAGTGGTT，SEQ ID NO.:59
204CP：TTCCCCCACTGTCTGGCTTT，SEQ ID NO.:34
236CP：TTTCTTTTGTCTTTGGGTAT，SEQ ID NO.:35
250CP：ACGTTGGGGCTACTCCCT，SEQ ID NO.:36
B-Cp：TGTCTTGGCCAAAATTCGCAG，SEQ ID NO.:37
C-Cp: TGGACTTCTCTCAATTTTCTAGG, SEQ ID NO.38, and
D-Cp：AGCTACAGCATGGGGCAGA，SEQ ID NO.:39。
in another preferred embodiment, the capture probe set further comprises capture probes:
NB-CP：ATCTATTGCTTACATTTGCTT，SEQ ID NO.:40。
in a fourth aspect of the present application, there is provided a kit for Hepatitis B Virus (HBV) typing and drug resistance gene detection, the kit comprising a PCR primer pair set according to the first aspect of the present application.
In another preferred embodiment, the kit further comprises a signaling probe set according to the second aspect of the application.
In another preferred embodiment, the kit further comprises a capture probe set according to the third aspect of the application.
In another preferred embodiment, the kit further comprises one or more components selected from the group consisting of:
thermal start Taq enzyme, UDG enzyme, dNTPs, tris-HCl and MgCl 2 、(NH 4 ) 2 SO 4 And Tween-20.
In another preferred embodiment, the kit further comprises a negative quality control.
In another preferred embodiment, the kit further comprises an internal standard quality control.
In a fourth aspect of the present application, there is provided a method for Hepatitis B Virus (HBV) typing and drug resistance gene detection, the method comprising the steps of:
(1) Providing a sample to be detected, and extracting virus nucleic acid from the sample to be detected;
(2) Adding the viral nucleic acid extracted in the step (1) into a PCR reaction solution for multiplex asymmetric PCR amplification to respectively obtain PCR amplification products;
wherein the PCR reaction liquid comprises the primer pair group of the first aspect of the application;
(3) PCR product hybridization detection
And mixing the PCR amplification product with the electrochemical hybridization solution, adding the mixture to an electrochemical gene chip, and detecting in the electrochemical gene chip.
In another preferred embodiment, in step (2), the first primer pair, the forward primer set forth in SEQ ID NO.1 and the reverse primer set forth in SEQ ID NO.2 are used in a ratio of 0.15:0.75.
in another preferred embodiment, in step (2), the second primer pair has an application ratio of the forward primer set forth in SEQ ID NO.3 to the reverse primer set forth in SEQ ID NO.4 of 0.25:1.25.
in another preferred embodiment, in step (2), the third primer pair, the forward primer set forth in SEQ ID NO.5 and the reverse primer set forth in SEQ ID NO.6 are used in a ratio of 0.15:1.0.
in another preferred embodiment, in step (2), the fourth primer pair, the forward primer set forth in SEQ ID NO.7 and the reverse primer set forth in SEQ ID NO.8 are used in a ratio of 0.1:0.5.
in another preferred embodiment, in step (2), the fifth primer pair has an application ratio of the forward primer set forth in SEQ ID NO.9 to the reverse primer set forth in SEQ ID NO.10 of 0.1:0.5.
in another preferred embodiment, in step (2), the forward primer set forth in SEQ ID NO. 61 and the reverse primer set forth in SEQ ID NO. 62 are used in a ratio of 0.1:0.5.
in another preferred embodiment, the PCR amplification conditions are: 50 ℃ for 3 minutes, 95 ℃ for 15 minutes, then according to 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 30 seconds amplification 45 cycles, and finally 72 ℃ extension 7 minutes.
In another preferred embodiment, the electrochemical hybridization solution comprises the signaling probe set according to the second aspect of the present application.
In another preferred embodiment, the electrochemical hybridization solution includes: electrochemical hybridization buffer I, NBS, and NaClO 4 Wherein the electrochemical hybridization solution I comprises the signaling probe set according to the second aspect of the application and MES buffer.
In another preferred embodiment, the concentration of each signaling probe in the electrochemical hybridization solution I is 0.2. Mu.M.
In another preferred embodiment, the electrochemical gene chip comprises a set of capture probes according to the third aspect of the application.
In another preferred embodiment, the method is for non-diagnostic purposes.
In a fifth aspect of the present application, there is provided the use of a primer set according to the first aspect of the present application and a probe set according to the second aspect of the present application for the preparation of a detection kit for the detection of Hepatitis B Virus (HBV) typing and drug resistance gene detection.
It is understood that within the scope of the present application, the above-described technical features of the present application and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.
Drawings
Fig. 1 shows the negative sample detection results.
FIG. 2 shows the results of type B sample testing.
Figure 3 shows the results of type C sample testing.
Fig. 4 shows the results of the type D sample detection.
FIG. 5 shows the B/C type sample detection results.
FIG. 6 shows the results of rtL180M and rtM204V mutant sample detection.
FIG. 7 shows the results of rtA181T/V mutation sample detection.
FIG. 8 shows the change of the signal value of each position of the primer pair 1 in proportion.
FIG. 9 shows the signal value change at each position in a multiplex system for different pairs of C-type primers.
FIG. 10 shows the signal value change of each amplified locus of different primer pair 1.
Detailed Description
The inventor obtains a detection kit and a detection method for detecting the correlation between the type of the hepatitis B virus and the drug-resistant site by utilizing a multiple asymmetric PCR technology and an electrochemical gene sensor method through extensive and intensive research, and experimental results show that the detection method and the kit have the advantages of good detection accuracy, high specificity, simplicity and automation in operation and higher flux, and can provide important reference for the administration of the drugs to patients with the hepatitis B. The kit and the detection method can be widely applied to a plurality of fields such as window-period detection, clinical diagnosis, scientific research, curative effect tracking and the like of hepatitis B caused by HBV virus.
Before describing the present application, it is to be understood that this application is not limited to the particular methodology and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, as the scope of the present application will be limited only by the appended claims.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. As used herein, when used in reference to a specifically recited value, the term "about" means that the value can vary no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described herein.
Electrochemical gene chip method
The electrochemical gene chip method (CN201310166271.X, CN 201210590669.1) detects current values (signal values) through an electrochemical gene chip analysis system, and judges the signal values of all points, so that the medium flux detection can be easily completed. In addition, the device has low price, simple and small equipment, simple operation and quick and accurate test. In the application, a novel molecular diagnosis method for simultaneously detecting the genotype of the hepatitis B virus and related drug-resistant mutant genes based on a multiple asymmetric PCR-electrochemical gene chip method is established, and a kit thereof is developed, so that the kit has important significance for typing the hepatitis B virus and guiding clinical medication.
The electrochemical gene sensor chip uses a printed circuit board treated by a special chemical method as a carrier, various probes or target fragments are fixed on the surface of the printed circuit board in a chemical bond combination mode, and ferrocene derivatives are used as electrochemical indicators to form a microarray chip which can be used for hybridization reaction or antigen-antibody reaction.
Multiplex asymmetric PCR
Multiplex PCR (multiplex PCR), also called multiplex primer PCR or multiplex PCR, is a PCR reaction in which more than two pairs of primers are added in the same PCR reaction system and simultaneously a plurality of nucleic acid fragments are amplified, and the reaction principle, reaction reagents and operation process are the same as those of the general PCR.
Asymmetric PCR (asymmetric PCR) is a primer pair that produces large amounts of single stranded DNA (ssDNA) after PCR amplification with unequal amounts of the primer pair. The pair of primers are referred to as non-limiting primer and limiting primer, respectively, and the ratio is preferably 5-20:1. During the first 10-15 cycles of the PCR reaction, the amplified product is mainly double stranded DNA, but when the restriction primer (low concentration primer) is consumed, the non-restriction primer (high concentration primer) directed PCR will produce a large amount of single stranded DNA. The key to asymmetric PCR is to control the absolute amount of restriction primers, and to optimize the ratio of the two primers multiple times. Still another method is to prepare double-stranded DNA by PCR amplification with equal concentration of primers, (dsDNA), then use this dsDNA as template and then use one of the primers for a second PCR to prepare ssDNA. ssDNA prepared by asymmetric PCR is mainly used for nucleic acid sequence determination.
There are many factors that affect multiplex asymmetric PCR reactions, such as:
(1) The imbalance of the reaction system results in rapid amplification of certain advantageous primers and templates thereof in the previous rounds of reaction, resulting in large amounts of amplified products which are also good inhibitors of DNA polymerase. Therefore, with the large amount of amplified products, the polymerization ability of the polymerase is more and more strongly inhibited, and therefore, the primer and its template, which are at a disadvantage in the early stage, are more difficult to react, eventually resulting in an amount of amplified products that is too small to be detected.
(2) Primer specificity, if the primer binds more strongly to other non-target gene fragments in the system, the ability of the target gene to bind the primer is contended, resulting in a decrease in amplification efficiency.
(3) The optimal annealing temperatures are not uniform, and a plurality of pairs of primers are placed in a system for amplification, so that the optimal annealing temperature of each pair of primers is required to be close because the annealing temperatures for carrying out PCR reactions are the same.
(4) Primer dimers, including dimers between primers and hairpin structures formed by the primers themselves, are also third party DNA mediated polymers, which, like non-specific primers, interfere with the competition of primers with the target binding sites, affecting amplification efficiency.
Although several factors affecting amplification efficiency are mentioned above, more factors are not yet clear. To date, there is no effective method by which amplification efficiency can be predicted explicitly.
The inventor performs deep comparison analysis on the genotype of the hepatitis B virus and related drug-resistant sites, designs primers and probes, optimally selects and verifies the designed primers and probes, and finally determines primer and probe sequences which can be used for multiplex asymmetric PCR amplification, thereby providing a PCR-electrochemical gene chip method detection kit for the hepatitis B virus typing and drug-resistant mutant genes.
In the research process, the inventor designs and experimentally verifies PCR amplification primers of the genotype of the hepatitis B virus and related drug-resistant sites. The results show that the HBV genotype and the related drug resistance sites can be detected simultaneously by using a tube system. The DNA electrochemical gene sensor biochip is a new method which combines the nucleic acid hybridization technology and the electrochemical sensor technology and can simply, quickly, accurately and cheaply help to diagnose the disease of patients. The technology is characterized in that a large number of ssDNA probes are regularly arranged and fixed on a support (electrode) to form a two-dimensional ssDNA probe array, and the two-dimensional ssDNA probe array is combined with an electrochemical technology for use, so that a large number of DNAs can be detected and analyzed at the same time, and the technology has the advantages of simple operation, high detection efficiency and high automation degree.
The application provides a kit for detecting hepatitis B virus type and drug-resistant mutant genes, which is convenient to operate and high in detection efficiency, and can detect three types of B, C, D and 6 drug-resistant sites in rt173, rt180, rt181, rt194, rt204, rt236 and rt250 at one time. Wherein, the mutation of the rt173 drug-resistant site is that of the rtV173L, rt, the mutation of the rtL180M, rt181 drug-resistant site is that of the rtA181T/V, rt194 drug-resistant site is that of the rtA194T, rt, the mutation of the rtM204V/I, rt236 drug-resistant site is that of the rtN236T, rt250 drug-resistant site is that of the rtM250V. For each drug-resistant mutation reference can be made to: leandro R, et al, peptides B virus resistance substitutions: long-term analysis by next-generation sequencing [ J ]. Arch Virol,2016,161 (10): 2885-2891. Zhang Xu, et al, analysis of HBV P gene region mutation after treatment of 147 cases of chronic hepatitis B with nucleoside or glycosidic drugs [ J ].2015,12,019.
In a preferred embodiment of the present application, there is provided a kit for detecting hepatitis B virus type and drug-resistant mutant gene based on multiplex asymmetric PCR-electrochemical gene sensor method, comprising reaction solution A, enzyme system, hybridization solution I, NBS, naClO 4 The method comprises the steps of carrying out a first treatment on the surface of the Specific instituteThe PCR primers are shown in Table 1:
TABLE 1 characterization of primers
The PCR primers effectively solve the difficult problems of invalid, low-efficiency or non-specific amplification of the PCR amplification of the sequences with high GC content, and have good applicability to the PCR amplification of the sequences with non-high GC content.
The hybridization solution I contains a group of oligonucleotide signal probes which are specifically combined with PCR products, and the sequences of the oligonucleotide signal probes are shown in the table 2:
TABLE 2 Signal Probe characterization Table
Remarks: "W" represents wild type, "M" represents mutant type;
the application relates to a kit for detecting hepatitis B virus typing and drug resistance gene detection based on a multiple asymmetric PCR-electrochemical gene sensor method, which also comprises a group of oligonucleotide capture probes which can be fixed on the surface of a special printed circuit board gold electrode in a covalent bond mode, and the sequences of the oligonucleotide capture probes are shown in Table 3:
TABLE 3 Capture Probe characterization Table
CP Probe name CP probe sequence (5 '-3') SEQ ID NO.:
173CP TGGGCTTTCGCAAGATTCCTAT 32
180CP ATGGGAGTGGGCCTCAGT 33
194CP AGTGCCATTTGTTCAGTGGTT 59
204CP TTCCCCCACTGTCTGGCTTT 34
236CP TTTCTTTTGTCTTTGGGTAT 35
250CP ACGTTGGGGCTACTCCCT 36
B-Cp TGTCTTGGCCAAAATTCGCAG 37
C-Cp TGGACTTCTCTCAATTTTCTAGG 38
D-Cp AGCTACAGCATGGGGCAGA 39
NB-CP ATCTATTGCTTACATTTGCTT 40
The 3' end of the capture probe is marked with C6S-S, and is fixed on the surface of a special printed circuit board metal electrode in a covalent bond mode, so as to capture PCR products; the 5' end of the signal probe is marked by different ferrocene markers, the signal probe is hybridized with the captured PCR product specifically, alternating voltage is applied to the electrode, the ferrocene undergoes oxidation-reduction reaction, and the result is judged to be negative and positive by detecting the current value. The hybridization mode of the PCR product and the double probes ensures the good specificity of the electrochemical gene chip method.
In a preferred embodiment of the present application, the above-mentioned hepatitis b virus typing and drug resistance gene detection kit according to the present application has specific components and amounts as shown in table 4 below:
TABLE 4PCR reaction liquid formulation
The application also provides a method for detecting the hepatitis B virus typing and drug-resistant mutant gene by a PCR-electrochemical gene sensor method, which specifically comprises the following steps:
(1) Sample collection and genome nucleic acid extraction by using a recommended extraction kit;
(2) Adding 20 μl of the extracted sample genome DNA into a PCR reaction solution to perform multiplex asymmetric PCR amplification, wherein the PCR reaction conditions are as follows: pre-denaturing at 50℃for 3 min, 95℃for 15 min, then amplifying for 45 cycles at 94℃for 30 sec to 55℃for 30 sec to 72℃for 30 sec, and finally extending at 72℃for 7 min;
(3) 70. Mu.l of hybridization solution I, 10. Mu.l of NBS and 20. Mu.l of NaClO were added to the PCR amplification product 4 And (3) fully and uniformly mixing, transferring into a tube of the electrochemical sensor, and compacting a tube cover. And then inserting the sensor into an electrochemical instrument for detection, and obtaining a result.
The application has the main advantages that:
the kit for detecting the hepatitis B virus typing and drug-resistant mutation gene detection based on the multiple asymmetric PCR-electrochemical gene sensor method has the advantages of good detection accuracy, high specificity, simplicity and automation in operation and higher flux, and provides an important reference for guiding the medication of hepatitis B patients.
The present application will be described in further detail with reference to the following examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. The following examples are not to be construed as limiting the details of the experimental procedure, and are generally carried out under conventional conditions such as those described in the guidelines for molecular cloning laboratory, sambrook.J.et al, (Huang Peitang et al, beijing: scientific Press, 2002), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise indicated. The experimental materials and reagents used in the following examples were obtained from commercial sources unless otherwise specified.
The application establishes a rapid detection method for the HBV B, C, D genotype and the rt173, rt180, rt181, rt194, rt204, rt236 and rt250 locus drug-resistant mutant genes by a multiple asymmetric PCR-electrochemical gene sensor method.
Example 1 optimization and determination of hepatitis B Virus typing and drug-resistant mutant Gene detection kit
1.1 design and optimization of primers:
primers were designed and a number of screening studies were performed using NCBI database query and downloaded sequences, and finally each PCR primer and multiplex PCR reaction system in Table 1 was determined.
Optimization of primer concentration: using orthogonal design experiments, agarose gel electrophoresis and PCR reaction tests were performed in a 50. Mu.l reaction system at an upstream-downstream primer amount ratio of 1/5 to 5/50, and the optimal working concentrations of each primer were finally determined by repeated experiments as shown in Table 4.
1.2 reaction system optimization:
optimization of the amount of the hot start Taq enzyme: by using orthogonal design experiment, PCR reaction is carried out in 50 μl reaction system by using enzyme dosage/reaction with concentration gradient from 5U (enzyme unit) to 15U, and the optimal Taq enzyme dosage is finally determined to be 10U/reaction through repeated experiments.
Optimization of the amount of UDG enzyme: PCR reactions were performed using enzyme amounts/reaction in a concentration gradient from 0.05U (enzyme units) to 1U in a 50. Mu.l reaction system using orthogonal design experiments, and repeated experiments were performed to finally determine that the optimal UDG enzyme amount was 0.75U/reaction.
Optimization of dNTPs concentration: by using orthogonal design experiment, PCR reaction is carried out in 50 μl reaction system by using dNTPs with concentration gradient from 0.1mmol/L to 1mmol/L respectively, and the optimal dNTPs concentration is finally determined to be 0.334mmol/L through repeated experiments.
Optimizing template sample addition: under the condition that other components in the reaction system are unchanged, the sample adding amount with the gradient from 10 mu l to 20 mu l is respectively tested, the PCR reaction is carried out, and the optimal sample adding amount is finally determined to be 20 mu l through repeated tests.
Optimization of reaction temperature: according to the activity of the enzyme and the length of the oligonucleotide, the annealing temperature and the extension time are mainly optimized, and the optimal reaction temperature and time are finally determined through repeated experiments: pre-denaturation at 50℃for 3 min and 95℃for 15 min; then 94 ℃ for 30 seconds, 55 ℃ for 30 seconds, 72 ℃ for 30 seconds, 45 cycles; finally, the extension was carried out at 72℃for 7 minutes.
1.3 determination of detection limit of kit:
the selection has been calibrated to 1 x 10 6 IU/mL of hepatitis B virus B, C, D type nucleic acid is diluted to 1 x 10 in a gradient manner 5 IU/mL、1*10 4 IU/mL、1*10 3 IU/mL、1*10 2 IU/mL、1*10 1 IU/mL, each concentration is repeated 10 times respectively, after multiplex asymmetric PCR qualitative amplification is carried out, hybridization detection is carried out in an electrochemical gene sensor detection system, and the detection result shows that when the concentration of virus nucleic acid is 1 x 10 1 At IU/mL, part of sites have no signal; and when the DNA concentration is 1 x 10 2 IU/mL to 1 x 10 5 At IU/mL, detection results of each site were correct by Sanger sequencing. Therefore, the detection limit of the kit is determined to be 1 x 10 2 IU/mL。
Example 2 clinical sample detection materials and methods
2.1 viral DNA nucleic acid extraction
Sample requirements:
(1) The method is applicable to the types of specimens: serum and plasma samples of patients positive for hepatitis B virus nucleic acid are identified.
(2) Sample collection: (1) serum: drawing 2mL of venous blood of a subject by using a disposable sterile syringe, injecting the venous blood into a sterile dry glass tube, standing for 30-60 minutes at room temperature (22-25 ℃), and allowing a blood sample to spontaneously and completely coagulate to separate out serum, or directly using a horizontal centrifuge for 5 minutes at 4000 rpm; sucking the upper serum, and transferring to a 1.5mL sterilizing centrifuge tube; (2) plasma: 2mL of venous blood of a subject is extracted by a disposable sterile injector, a glass tube containing EDTA (disodium ethylenediamine tetraacetate) or sodium citrate anticoagulant is injected, the glass tube is immediately and gently inverted and mixed for 5-10 times, the anticoagulant and the venous blood are fully and uniformly mixed, and plasma can be separated after 5-10 minutes and transferred to a 1.5mL sterilization centrifuge tube.
(3) Specimen preservation and transport: the specimen can be immediately used for testing; keeping the temperature at-20+ -5deg.C for 12 months; if long-term storage is required, the storage is required to be carried out at-80+/-5 ℃; the specimen should be prevented from repeated freezing and thawing. The specimen is transported in a sealing way by adding ice into a curling pot or adding ice into a foam box, and the transportation time is not longer than 4 days.
The operation steps are as follows:
the method is characterized in that 60 cases of hepatitis B patient plasma samples are collected, and a nucleic acid extraction kit (such as a nucleic acid extraction and purification kit (a centrifugal column method) and a nucleic acid extraction and purification kit (a magnetic bead method)) produced by Daan gene Co., ltd. In Zhongshan university is recommended to be adopted for extracting genome DNA, and specific operation steps are carried out according to the instruction of the kit specification.
2.2 multiplex asymmetric PCR amplification and electrochemical hybridization detection
Adding the extracted sample genome DNA into 25 mul of the reaction liquid respectively to carry out multiplex asymmetric PCR amplification, wherein the PCR reaction conditions are as follows: pre-denaturing at 50℃for 3 min, 95℃for 15 min, then amplifying for 45 cycles at 94℃for 30 sec to 55℃for 30 sec to 72℃for 30 sec, and finally extending at 72℃for 7 min; to the PCR amplification product, 70. Mu.l of a signal probe mixture, 10. Mu.l of NBS, 20. Mu.l of NaClO were added in this order 4 Fully and uniformly mixing, transferring into an electrochemical sensor, and compacting a pipe cover. And then inserting the sensor into an electrochemical instrument for detection, and obtaining a result.
2.3 analysis of electrochemical results
The detection kit for the hepatitis B virus typing and drug-resistant mutant genes established by the application is used for detecting 50 cases of clinical samples of hepatitis B virus patients, and the detection kit for the sequencing method produced by Daan gene Co., ltd. In Zhongshan university is used for contrast verification, so that the result shows that the positive detection rate is 100% in 50 cases of samples of hepatitis B patients, and the consistency of the two methods is high, so that the result has statistical significance.
Specifically, the kit comprises 17 cases of B type, 29 cases of C type and 4 cases of D type with different types and drug resistant sites, wherein 1 case of rt173 site, 5 cases of rt180 site, 2 cases of rt181 site, 8 cases of rt204 site, 1 case of rt236 site and 1 case of rt250 site, no mutation of the rt194 site is detected, and no omission condition occurs.
Fig. 1 shows the negative sample detection results. Type B sample detection results are shown in figure 2. Figure 3 shows the results of type C sample testing. Fig. 4 shows the results of the type D sample detection. FIG. 5 shows the B/C type sample detection results. FIG. 6 shows the results of rtL180M and rtM204V mutant sample detection. FIG. 7 shows the results of rtA181T/V mutation sample detection.
Comparative example 1
After the present inventors have performed in-depth alignment analysis of three genotypes of hepatitis b virus B, C, D and 7 drug-resistant sites in rt173, rt180, rt181, rt194, rt204, rt236, and rt250, tens of pairs of primers and tens of probes were designed for each target sequence, and it was difficult to obtain effective multiplex asymmetric PCR amplification primers and probe sequences due to imbalance of reaction systems, differences in primer specificity, inconsistent annealing temperatures, primer dimers, and the like.
Through a large number of experiments, the inventor performs optimal selection and verification on the designed primers and probes, and finally determines the primers, probe sequences and combinations thereof which can be used for multiplex asymmetric PCR amplification.
Even in the case where the primer pair and the probe sequence for each target nucleic acid have been basically determined, there is a difference in effect by adding different ratios of primer rows for multiplex amplification, and hence optimization of the forward and reverse primer ratios is required.
FIG. 8 shows the change of the signal value of each position of the primer pair 1 in proportion.
For example, in the multiplex asymmetric PCR step, the ratio of forward and reverse primers of primer pair 1 was adjusted to 0.15:1, and the signal values at positions 236 and 250 of primer pair 2 were detected with a significant trend.
Comparative example 2C primer probe optimization
The present inventors designed tens of pairs of primers and tens of probes for each target sequence, and this comparative example showed primers and probes with partial unsatisfactory effects by taking C-type as an example.
Control primer pair 1:
2F-1：CAAGAGCTACAGCATGGGA，SEQ ID NO.:41；
2R-1：GTGATCCTTGTTGGGGTT，SEQ ID NO.:42；
control primer pair 2:
2F-2：CAAGAGCTACAGCATGGGA，SEQ ID NO.:41；
2R-2：CTGTTGTCAAAATGCCCTG，SEQ ID NO.:43；
control primer pair 3:
2F-3：TCGCAGAAGATCTAAATCTCGG，SEQ ID NO.:44；
2R-3：ACAAACCAGATTGGGACT，SEQ ID NO.:45；
control primer pair 4:
2F-4：TCGCAGAAGATCTAAATCTCGG，SEQ ID NO.:44；
2R-4：TCAGGGCATACTACAAAC，SEQ ID NO.:46；
control primer pair 5:
2F-5：TCGCAGAAGATCTAAATCTCGG，SEQ ID NO.:44；
2R-5：CTGTTGTCAATATGCCCTG，SEQ ID NO.:47；
FIG. 9 shows the signal value change at each position in a multiplex system for different pairs of C-type primers. The signal values of the primers are low, and the primers added into a multiplex system have inhibition effect on the signal values of other primers, so that the requirements of clinical application cannot be met
Primer optimization of comparative example 3 primer pair 1
The present inventors designed several tens of pairs of primers and several tens of probes for each target sequence, and this comparative example showed primers with partial unsatisfactory effects by taking primer pair 1 as an example.
Control primer pair 1':
3F-1：ACTTGTATTCCCATCCCAT，SEQ ID NO.:48；
3R-1：GACTCAAGATGTTGTACAGACTTGG，SEQ ID NO.:49；
control primer pair 2':
3F-2：ACCTCTATGTTTCCCTCATGTTGCT，SEQ ID NO.:50；
3R-2：GACTCAAGATGTTGTACAGACTTGG，SEQ ID NO.:49；
control primer pair 3':
3F-3：ACTTGTATTCCCATCCCAT，SEQ ID NO.:48；
3R-3：CGGCATAAAGGGACTCAAGATGT，SEQ ID NO.:51；
control primer pair 4':
3F-4：ACCTCTATGTTTCCCTCATGTTGCT，SEQ ID NO.:50；
3R-4：CGGCATAAAGGGACTCAAGATGT，SEQ ID NO.:51；
control primer pair 5':
3F-5：TTCGCAARATTCCTATGGGAGT，SEQ ID NO.:52；
3R-5：GAACCACTGAACAAATGGCAC，SEQ ID NO.:53；
FIG. 10 shows the signal value change of each amplified locus of different primer pair 1. The signal values of the primer pairs are between 10 and 20, the PCR amplification effect is poor, and the requirements of clinical application cannot be met.
All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.
Sequence listing
<110> university of Zhongshan da An Gene Co., ltd
<120> hepatitis B virus typing and drug-resistant gene detection kit
<130> 000032
<160> 59
<170> PatentIn version 3.5
<210> 1
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
catgcgtgga acctttg 17
<210> 2
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
atccagttgg cagcaca 17
<210> 3
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
ttaccaattt tcttttgtct ttg 23
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
tgacatactt tccaatcaat ag 22
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
ctagactcgt ggtggacttc 20
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
acgggcaaca taccttgata g 21
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
acatagcgcc tcattttgtg 20
<210> 8
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
gaaggctgga tccaactg 18
<210> 9
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 9
gaagtccaac tcctaagcca gt 22
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 10
cctcaccacc aacttcatcc 20
<210> 11
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 11
tatgggagtg ggcctca 17
<210> 12
<211> 15
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 12
tatgggattg ggcct 15
<210> 13
<211> 15
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 13
gtttctcatg gctca 15
<210> 14
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 14
cgtttctctt ggctcag 17
<210> 15
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 15
gtttctcctg gctcagt 17
<210> 16
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 16
ttctcatggt tcagtttac 19
<210> 17
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 17
tttctcctga ctcagttta 19
<210> 18
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 18
ttcagttata tggatgatg 19
<210> 19
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 19
tcagttatgt ggatgat 17
<210> 20
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 20
cagttatata gatgatgtg 19
<210> 21
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 21
cagttatatt gatgatgtg 19
<210> 22
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 22
cagttatatc gatgatgtg 19
<210> 23
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 23
acatttgaac cctaata 17
<210> 24
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 24
acatttgaat cctcata 17
<210> 25
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 25
acatttaacc cctcaca 17
<210> 26
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 26
aaatttcatg ggttatgt 18
<210> 27
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 27
ttaatttcgt gggatat 17
<210> 28
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 28
tcccaaatct ccagtca 17
<210> 29
<211> 12
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 29
gagcacccac gt 12
<210> 30
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 30
atctttccac cagcaat 17
<210> 31
<211> 17
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 31
gcatcttcaa actcaaa 17
<210> 32
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 32
tgggctttcg caagattcct at 22
<210> 33
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 33
atgggagtgg gcctcagt 18
<210> 34
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 34
ttcccccact gtctggcttt 20
<210> 35
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 35
tttcttttgt ctttgggtat 20
<210> 36
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 36
acgttggggc tactccct 18
<210> 37
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 37
tgtcttggcc aaaattcgca g 21
<210> 38
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 38
tggacttctc tcaattttct agg 23
<210> 39
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 39
agctacagca tggggcaga 19
<210> 40
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 40
atctattgct tacatttgct t 21
<210> 41
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 41
caagagctac agcatggga 19
<210> 42
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 42
gtgatccttg ttggggtt 18
<210> 43
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 43
ctgttgtcaa aatgccctg 19
<210> 44
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 44
tcgcagaaga tctaaatctc gg 22
<210> 45
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 45
acaaaccaga ttgggact 18
<210> 46
<211> 18
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 46
tcagggcata ctacaaac 18
<210> 47
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 47
ctgttgtcaa tatgccctg 19
<210> 48
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 48
acttgtattc ccatcccat 19
<210> 49
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 49
gactcaagat gttgtacaga cttgg 25
<210> 50
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 50
acctctatgt ttccctcatg ttgct 25
<210> 51
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 51
cggcataaag ggactcaaga tgt 23
<210> 52
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 52
ttcgcaarat tcctatggga gt 22
<210> 53
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 53
gaaccactga acaaatggca c 21
<210> 54
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 54
aggcggggtt tttcttgtt 19
<210> 55
<211> 19
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 55
gcagacacat ccagcgata 19
<210> 56
<211> 14
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 56
cgtagggcat tccc 14
<210> 57
<211> 12
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 57
cgccgggctt tc 12
<210> 58
<211> 13
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 58
cgccggactt tcc 13
<210> 59
<211> 21
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 59
agtgccattt gttcagtggt t 21

Claims (4)

1. A multiplex asymmetric PCR kit for hepatitis B virus typing and drug resistance gene detection, characterized in that the kit comprises a PCR primer pair group, a signal probe group and a capture probe group;
wherein, the primer pair group consists of the following primer pairs:
a first primer pair, wherein the first primer pair is a forward primer shown as SEQ ID NO.1 and a reverse primer shown as SEQ ID NO. 2; the second primer pair is a forward primer shown as SEQ ID NO.3 and a reverse primer shown as SEQ ID NO. 4; a third primer pair, wherein the third primer pair is a forward primer shown as SEQ ID NO.5 and a reverse primer shown as SEQ ID NO. 6; a fourth primer pair, which is a forward primer shown as SEQ ID NO.7 and a reverse primer shown as SEQ ID NO. 8; a sixth primer pair, the sixth primer pair being a forward primer as shown in SEQ ID NO.54 and a reverse primer as shown in SEQ ID NO. 55; a fifth primer pair, which is a forward primer shown as SEQ ID NO.9 and a reverse primer shown as SEQ ID NO. 10;
the signal probe group consists of signal probes shown by SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.56, SEQ ID NO.57 and SEQ ID NO. 58;
the capture probe group consists of capture probes shown in SEQ ID No.32, SEQ ID No.33, SEQ ID No.34, SEQ ID No.35, SEQ ID No.36, SEQ ID No.37, SEQ ID No.38, SEQ ID No.39, SEQ ID No.40 and SEQ ID No. 59.
2. The kit of claim 1, further comprising one or more components selected from the group consisting of:
thermal start Taq enzyme, UDG enzyme, dNTPs, tris-HCl and MgCl 2 、(NH 4 ) 2 SO 4 And Tween-20.
3. The kit of claim 2, further comprising a negative quality control.
4. The kit of claim 2, further comprising an internal standard quality control.
CN201910692625.1A 2019-07-30 2019-07-30 Hepatitis B virus typing and drug-resistant gene detection kit Active CN110438262B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910692625.1A CN110438262B (en) 2019-07-30 2019-07-30 Hepatitis B virus typing and drug-resistant gene detection kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910692625.1A CN110438262B (en) 2019-07-30 2019-07-30 Hepatitis B virus typing and drug-resistant gene detection kit

Publications (2)

Publication Number Publication Date
CN110438262A CN110438262A (en) 2019-11-12
CN110438262B true CN110438262B (en) 2023-12-05

Family

ID=68432229

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910692625.1A Active CN110438262B (en) 2019-07-30 2019-07-30 Hepatitis B virus typing and drug-resistant gene detection kit

Country Status (1)

Country Link
CN (1) CN110438262B (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050075475A (en) * 2004-01-15 2005-07-21 바이오코아 주식회사 Dna chip for analyzing hepatitis virus b drug resistance mutants
CN104483362A (en) * 2014-12-30 2015-04-01 中国人民解放军第三军医大学第二附属医院 Capture probe and signal probe modified electrode as well as preparation method and application thereof
CN105316403A (en) * 2015-05-12 2016-02-10 深圳市瀚海基因生物科技有限公司 Primer, method and application based on next-generation sequencing technology to detect HBV drug-resistant mutation site
CN105441584A (en) * 2014-09-29 2016-03-30 博奥生物集团有限公司 Detection kit of hepatitis B virus resistance to drug and hepatitis B virus genotype and detection method using the same
CN106367528A (en) * 2016-08-26 2017-02-01 厦门大学 Detection method of hepatitis B virus drug-resistant mutation
CN109554477A (en) * 2019-01-04 2019-04-02 中山大学达安基因股份有限公司 A kind of kit of Multiple detection chemotherapeutics toxicity related gene parting
CN109593886A (en) * 2018-12-29 2019-04-09 中山大学达安基因股份有限公司 A kind of hbv nucleic acid immue quantitative detection reagent box

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9045803B2 (en) * 2012-02-29 2015-06-02 Abbott Molecular Inc. Hepatitis B virus typing and resistance assay

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050075475A (en) * 2004-01-15 2005-07-21 바이오코아 주식회사 Dna chip for analyzing hepatitis virus b drug resistance mutants
CN105441584A (en) * 2014-09-29 2016-03-30 博奥生物集团有限公司 Detection kit of hepatitis B virus resistance to drug and hepatitis B virus genotype and detection method using the same
CN104483362A (en) * 2014-12-30 2015-04-01 中国人民解放军第三军医大学第二附属医院 Capture probe and signal probe modified electrode as well as preparation method and application thereof
CN105316403A (en) * 2015-05-12 2016-02-10 深圳市瀚海基因生物科技有限公司 Primer, method and application based on next-generation sequencing technology to detect HBV drug-resistant mutation site
CN106367528A (en) * 2016-08-26 2017-02-01 厦门大学 Detection method of hepatitis B virus drug-resistant mutation
CN109593886A (en) * 2018-12-29 2019-04-09 中山大学达安基因股份有限公司 A kind of hbv nucleic acid immue quantitative detection reagent box
CN109554477A (en) * 2019-01-04 2019-04-02 中山大学达安基因股份有限公司 A kind of kit of Multiple detection chemotherapeutics toxicity related gene parting

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
不对称PCR杂交显色方法的建立及其对HBV DNA的检测;郭晏海等;第四军医大学学报;第20卷(第9期);96-98 *
分子信标用于不对称PCR检测乙型肝炎病毒;孔德明等;《分析测试学报》;第2卷;第1-4页 *
新型多重不对称PCR⁃电化学芯片法检测甲型流感病毒;蒋析文等;《分子诊断与治疗杂志》;第10卷(第3期);摘要，第159页-第160页 *

Also Published As

Publication number Publication date
CN110438262A (en) 2019-11-12

Similar Documents

Publication Publication Date Title
CN105506118B (en) Primer pair, fluorescence probe, kit and method for detecting CYP2C19 Genotypings
CN103667514B (en) A kind of human interleukin 2 8B gene pleiomorphism fluorescence PCR detection reagent kits
CN110387408A (en) For detecting primer combination of probe object, reagent, kit and the detection method of people&#39;s CYP2C19 Genotyping
Besse et al. Genotyping and resistance profile of hepatitis C (HCV) genotypes 1–6 by sequencing the NS3 protease region using a single optimized sensitive method
WO2008018305A1 (en) Method of detecting variation and kit to be used therein
CN107513578A (en) A kind of nucleic acid Mass Spectrometry detection method early sieved for lung cancer driving gene and tumor susceptibility gene
JP2005058234A (en) Pcr primer set for detecting hepatitis b, and method for detecting hepatitis b and using the primer set
KR20110138289A (en) Probe set for identification of nucleotide mutation, and method for identification of nucleotide mutation
CN101812537B (en) Method and reagent kit for simultaneously detecting resistance site of three nucleotide analogues of hepatitis B virus
CN113584161A (en) Detection kit for fentanyl metabolic marker, detection method and application thereof
CN108913766A (en) A kind of specific primer and probe and kit detecting depressed individuals chemical drug object therapeutic gene multisite mutation
CN110241264B (en) Quantitative detection kit for Hepatitis B Virus (HBV) DNA
CN110438262B (en) Hepatitis B virus typing and drug-resistant gene detection kit
JP5845489B2 (en) Oligonucleotide set for detecting hepatitis B virus group and evaluating genetic diversity, and method using the same
CN109402249A (en) A kind of method and kit detecting CYP2C19 gene pleiomorphism
CN105316349A (en) Mycobacterium tuberculosis KatG mutant gene and application thereof
CN112251515B (en) Primer and kit for detecting thyroid cancer targeted medication related gene variation
CN107151707A (en) A kind of kit for detecting lung cancer related gene hot spot mutation and its application
CN106811537A (en) One kind detection epidermal growth factor receptor gene T790M low frequencies mutant primer and its application
CN107034312B (en) Nucleotide composition, kit and application thereof
JP5787337B2 (en) Marker group, test method and test kit for predicting therapeutic effect of hepatitis C
CN111118150A (en) Method, kit, primer pair and probe for detecting IL28B gene
US20120141977A1 (en) Hepatitis b virus mutation strain with resistance to adefovir dipivoxil and the uses thereof
US20160289778A1 (en) Hcv genotyping algorithm
CN102304589B (en) Hepatitis B virus Adefovir dipivoxil drug-resistance nucleic acid quantitative detection reagent kit, detection method, primers and probes thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information

Address after: 510665 No. 19 incense Hill Road, hi tech Industrial Development Zone, Guangdong, Guangzhou

Applicant after: Guangzhou Da'an gene Co.,Ltd.

Address before: 510665 No. 19 incense Hill Road, hi tech Industrial Development Zone, Guangdong, Guangzhou

Applicant before: DAAN GENE CO., LTD. OF SUN YAT-SEN University

CB02 Change of applicant information
CB03 Change of inventor or designer information

Inventor after: Huang Taosheng

Inventor after: Jiang Xiwen

Inventor after: Li Xinyu

Inventor after: Zheng Ruonan

Inventor before: Jiang Xiwen

Inventor before: Huang Taosheng

Inventor before: Li Xinyu

Inventor before: Zheng Ruonan

CB03 Change of inventor or designer information
GR01 Patent grant
GR01 Patent grant