CN109422814B - NK (natural killer) cells modified by anti-La/SSB chimeric antigen, preparation method and application thereof - Google Patents

NK (natural killer) cells modified by anti-La/SSB chimeric antigen, preparation method and application thereof Download PDF

Info

Publication number
CN109422814B
CN109422814B CN201710756982.0A CN201710756982A CN109422814B CN 109422814 B CN109422814 B CN 109422814B CN 201710756982 A CN201710756982 A CN 201710756982A CN 109422814 B CN109422814 B CN 109422814B
Authority
CN
China
Prior art keywords
cells
laa
cell
nk92mi
caar
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710756982.0A
Other languages
Chinese (zh)
Other versions
CN109422814A (en
Inventor
杨林
金泽明
孟会敏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Persongen Biotherapeutics Suzhou Co ltd
Original Assignee
Persongen Biotherapeutics Suzhou Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Persongen Biotherapeutics Suzhou Co ltd filed Critical Persongen Biotherapeutics Suzhou Co ltd
Priority to CN201710756982.0A priority Critical patent/CN109422814B/en
Publication of CN109422814A publication Critical patent/CN109422814A/en
Application granted granted Critical
Publication of CN109422814B publication Critical patent/CN109422814B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0646—Natural killers cells [NK], NKT cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Abstract

The invention relates to an NK cell modified by an anti-La/SSB chimeric antigen, a preparation method and application thereof. Specifically, the invention provides a fusion protein modified by an anti-La/SSB chimeric antigen and NK cells expressing the fusion protein, wherein the fusion protein has an optimized structure shown in a formula I: x is X 1 ‑X 2 ‑L 1 ‑X 3 ‑X 4 ‑X 5 (I) In which the elements are e.g the specification is as follows. Experimental results show that the specific NK cells (such as LaA-CAARNK92MI cells) modified by the fusion protein provided by the invention can be used for targeted treatment of La/SSB autoantibody-positive autoimmune diseases, and have the advantages of good curative effect, small side effect, low production cost and the like.

Description

NK (natural killer) cells modified by anti-La/SSB chimeric antigen, preparation method and application thereof
Technical Field
The invention belongs to the field of biological medicine, and in particular relates to an NK cell modified by an anti-La/SSB chimeric antigen, a preparation method and application thereof.
Background
Autoimmune diseases are diseases caused by autoimmune diseases which are caused by autoimmune tissue damage due to immune reaction of an organism to autoantigens, and are most remarkable in that B cells excessively react to generate high-titer autoantibodies and systemic inflammatory reactions, which ultimately lead to lesions of various organs. Recently, it has been increasingly realized that B cells play an increasingly wide role in the development and progression of autoimmune diseases, which provides an exciting prospect for the targeted treatment of autoimmune diseases by B cells. Experiments in which CD20 targeted B cells deplete showed that 95% of Pemphigus (PV) patients developed short-term disease decline, but 81% of patients relapsed and developed fatal infections. The significant decrease in autoantibody titers in patient serum following CD 20-targeted B cell depletion suggests that short-lived plasma cells are the source of autoantibodies in pemphigus disease, and that CD 20-positive memory B cell precursors are targeted indirectly to kill autoantibody secreting plasma cells. In order to treat pemphigus without inducing extensive immunosuppression, the anti-Dsg 3B cell receptor is taken as an extracellular fragment, fused with a corresponding signal region, and the constructed anti-Dsg3 CAAR-T obtains better experimental results in a pemphigus mouse model.
However, the etiology of some other autoimmune diseases (such as lupus erythematosus) is very complex, and the immune system of the autoimmune disease patient itself is disturbed, T cells are dysfunctional, th cells are tolerant to control, B cells are hyper-responsive, and autoimmune potential cells (PAL) are mostly in an unactivated or active blocked state. Autologous Chimeric Antigen Receptor (CAR) T cell therapy is difficult and less than ideal, while allogeneic CAR-T cell transplantation is at risk of graft versus host reaction.
Therefore, there is an urgent need in the art to explore new strategies for targeted therapy of autoimmune diseases that do not elicit extensive immunosuppression while treating autoimmune diseases, with low risk of graft versus host response, and low production costs.
Disclosure of Invention
The invention aims to provide a La/SSB chimeric antigen modified fusion protein and NK cells expressing the fusion protein, which can treat autoimmune diseases in a targeted manner, and simultaneously have the advantages of no initiation of wide immunosuppression, low risk of graft versus host reaction and low production cost.
In a first aspect of the invention, there is provided a fusion protein having the structure of formula I:
X 1 -X 2 -L 1 -X 3 -X 4 -X 5 (I)，
Wherein,
X 1 is a none or signal peptide sequence;
X 2 LaA peptide;
L 1 is a no or a linked peptide sequence;
X 3 is a transmembrane domain;
X 4 is a co-stimulatory element;
X 5 is the cytoplasmic signaling sequence cd3ζ;
"-" means a connecting peptide or peptide bond connecting the above elements.
In another preferred embodiment, X 3 Is the transmembrane domain of CD 28.
In another preferred embodiment, X 4 Selected from the group consisting of: costimulatory element 4-1BB, costimulatory element CD28, or a combination thereof.
In another preferred embodiment, X 3 And X 4 Together composed of CD28 and 4-1BB containing transmembrane domains.
In another preferred embodiment, L 1 Is an Fc element.
In another preferred embodiment, the Fc element is an Fc element of a mammalian immunoglobulin, preferably an Fc element of a human immunoglobulin.
In another preferred embodiment, the Fc element is an Fc element of IgG, igA, igM, igD, igE, preferably an Fc element of IgG, more preferably an Fc element of IgG1 or IgG 2.
In another preferred embodiment, the Fc element is 200-250 amino acids, preferably 220-240 amino acids, more preferably about 230 amino acids in length.
In another preferred embodiment, the Fc element has the amino acid sequence as shown at positions 130-359 in SEQ ID NO. 1.
In another preferred embodiment, the amino acid sequence of the Fc element is as shown at positions 130-359 of SEQ ID NO. 1.
In another preferred embodiment, the polypeptide element X 1 Selected from the group consisting of:
(A) A polypeptide having the amino acid sequence set forth in positions 1-22 of SEQ ID No. 1;
(B) A polypeptide having 80% or more homology (preferably 90% or more homology; equal preferably 95% or more homology; more preferably 98% or more homology; most preferably 99% or more homology) to the amino acid sequence shown at positions 1 to 22 in SEQ ID NO. 1;
(C) A derivative polypeptide formed by substituting, deleting or adding 1-5 amino acid residues in the amino acid sequence shown in the 1 st-22 th positions of SEQ ID NO. 1.
In another preferred embodiment, the polypeptide element X 2 Selected from the group consisting of:
(A) A polypeptide having the amino acid sequence set forth in SEQ ID No. 1 at positions 23-129;
(B) A polypeptide having 80% or more homology (preferably 90% or more homology; equal preferably 95% or more homology; more preferably 98% or more homology; most preferably 99% or more homology) to the amino acid sequence shown at positions 23 to 129 in SEQ ID No. 1;
(C) A derivative polypeptide formed by substitution, deletion or addition of 1-5 amino acid residues of the amino acid sequence shown in the 23-129 th position in SEQ ID NO. 1.
In another preferred embodiment, the polypeptide element L 1 Selected from the group consisting of:
(A) A polypeptide having the amino acid sequence set forth in SEQ ID No. 1 at positions 130-359;
(B) A polypeptide having 80% or more homology (preferably 90% or more homology; equal preferably 95% or more homology; more preferably 98% or more homology; most preferably 99% or more homology) to the amino acid sequence shown at positions 130 to 359 in SEQ ID NO. 1;
(C) A derivative polypeptide formed by substitution, deletion or addition of 1-5 amino acid residues of the amino acid sequence shown in 130-359 th site in SEQ ID NO. 1.
In another preferred embodiment, the polypeptide element X 3 Selected from the group consisting of:
(A) A polypeptide having the amino acid sequence set forth in SEQ ID No. 1 at positions 360-427;
(B) A polypeptide having 80% or more homology (preferably 90% or more homology; equal preferably 95% or more homology; more preferably 98% or more homology; most preferably 99% or more homology) to the amino acid sequence shown at positions 360 to 427 in SEQ ID NO. 1;
(C) A derivative polypeptide formed by substituting, deleting or adding 1-5 amino acid residues of the amino acid sequence shown in 360-427 th position in SEQ ID NO. 1.
In another preferred embodiment, the polypeptide element X 4 Selected from the group consisting of:
(A) A polypeptide having the amino acid sequence set forth in SEQ ID No. 1 at positions 428-469;
(B) A polypeptide having 80% or more homology (preferably 90% or more homology; equal preferably 95% or more homology; more preferably 98% or more homology; most preferably 99% or more homology) to the amino acid sequence shown at positions 428 to 469 in SEQ ID No. 1;
(C) A derivative polypeptide formed by substitution, deletion or addition of 1-5 amino acid residues of the amino acid sequence shown in 428-469 th position in SEQ ID NO. 1.
In another preferred embodiment, the polypeptide element X 3 And X 4 Consists of the amino acid sequence indicated in SEQ ID NO. 1 at positions 360-469.
In another preferred embodiment, the polypeptide element X 3 And X 4 Together with an amino acid sequence having a homology of 80% or more (preferably 90% or more; preferably 95% or more; more preferably 98% or more; most preferably 99% or more) with the amino acid sequence shown at positions 360 to 469 in SEQ ID No. 1.
In another preferred embodiment, the polypeptide element X 3 And X 4 Is a polypeptide formed by substituting, deleting or adding 1-5 amino acid residues in the amino acid sequence shown in 360-469 th position in SEQ ID No. 1.
In another preferred embodiment, the polypeptide element X 5 Selected from the group consisting of:
(A) A polypeptide having the amino acid sequence set forth in SEQ ID No. 1 at positions 470-581;
(B) A polypeptide having 80% or more homology (preferably 90% or more homology; equal preferably 95% or more homology; more preferably 98% or more homology; most preferably 99% or more homology) to the amino acid sequence shown at positions 470 to 581 in SEQ ID NO. 1;
(C) A derivative polypeptide formed by substituting, deleting or adding 1-5 amino acid residues in the amino acid sequence shown in 470-581 positions in SEQ ID No. 1.
In another preferred embodiment, the fusion protein has the amino acid sequence as set forth in SEQ ID NO. 1.
In another preferred embodiment, the amino acid sequence of the fusion protein is set forth in SEQ ID NO. 1.
In another preferred embodiment, the fusion protein is a recombinant protein.
In another preferred embodiment, the fusion protein is capable of specifically binding to LaA-BCR protein.
In another preferred embodiment, the fusion protein is capable of specifically binding to an anti-La/SSB antibody.
In a second aspect of the invention there is provided a polynucleotide encoding a fusion protein according to the first aspect of the invention.
In another preferred embodiment, the polynucleotide is selected from the group consisting of:
(a) A polynucleotide encoding a polypeptide as set forth in SEQ ID No. 1;
(b) A polynucleotide having a sequence as set forth in SEQ ID NO. 2;
(c) A polynucleotide having a nucleotide sequence having a homology of not less than 75% (preferably not less than 80%) with the sequence shown in (b);
(d) A polynucleotide truncated or added at the 5 'and/or 3' end of the polynucleotide as shown in (b) by 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides;
(e) A polynucleotide complementary to the polynucleotide of any one of (a) - (d).
In another preferred embodiment, the polynucleotide sequence is set forth in SEQ ID NO. 2.
In a third aspect of the invention there is provided a vector comprising a polynucleotide according to the second aspect of the invention.
In another preferred embodiment, the vector comprises the pCDH-CMV-MCS-EF1-CopPuro plasmid as a backbone.
In another preferred embodiment, the vector is a viral vector.
In another preferred embodiment, the vector is a lentiviral vector.
In a fourth aspect of the invention, there is provided a host cell expressing the fusion protein of the first aspect of the invention; and/or
The host cell genome having integrated therein an exogenous polynucleotide of the second aspect of the invention; and/or
The host cell comprises a vector according to the third aspect of the invention.
In another preferred embodiment, the cell is a prokaryotic cell or a eukaryotic cell.
In another preferred embodiment, the host cell is a mammalian cell.
In another preferred embodiment, the host cell is a human cell.
In another preferred embodiment, the host cell is an NK cell, a T cell.
In another preferred embodiment, the host cell is an NK92 cell.
In another preferred embodiment, the host cell is an NK92MI cell.
In a fifth aspect of the present invention, there is provided a genetically engineered NK cell which is a mammalian NK cell and which has the fusion protein of the first aspect of the present invention expressed on the membrane of the NK cell.
In another preferred embodiment, the NK cells are ex vivo.
In another preferred embodiment, the NK cells are autologous or allogeneic.
In another preferred embodiment, the NK cells are from a primate.
In another preferred embodiment, the NK cell is a human cell.
In another preferred embodiment, the NK cells are NK92 cells.
In another preferred embodiment, the NK cells are NK92MI cells.
In a sixth aspect of the invention, there is provided a pharmaceutical composition comprising: the fusion protein according to the first aspect of the invention, the polynucleotide according to the second aspect of the invention, the vector according to the third aspect of the invention or the NK cell according to the fifth aspect of the invention, and a pharmaceutically acceptable carrier or excipient.
In another preferred embodiment, the pharmaceutical composition is a liquid formulation.
In another preferred embodiment, the pharmaceutical composition is an injection.
In another preferred embodiment, the concentration of said NK cells in said pharmaceutical composition is 1X 10 5 －1×10 8 Individual cells/ml, preferably 1X 10 6 －1×10 7 Individual cells/ml.
In a seventh aspect, the invention provides the use of a fusion protein according to the first aspect of the invention, a polynucleotide according to the second aspect of the invention, a vector according to the third aspect of the invention, or an NK cell according to the fifth aspect of the invention for the manufacture of a medicament or formulation for the treatment of autoimmune diseases.
In another preferred embodiment, the autoimmune disease is an autoimmune disease that is positively associated with La/SSB autoantibodies.
In another preferred embodiment, the autoimmune disease is selected from the group consisting of: systemic lupus erythematosus, sjogren's syndrome.
In a seventh aspect of the present invention, there is provided a method for preparing the NK cell of the fifth aspect of the present invention, the method comprising the steps of: transduction of the polynucleotide according to the second aspect of the present invention or the vector according to the third aspect of the present invention into NK cells to thereby obtain said NK cells.
It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.
Drawings
FIG. 1 shows purification of LaA-BCR protein and its affinity assay for LaA antigen. Wherein, FIG. 1A is LaA-BCR-pfuse-hIgG1-FC eukaryotic expression vector; FIG. 1B is a LaA-pET28a (+) prokaryotic expression vector; FIG. 1C is an SDS-PAGE electrophoresis of purified LaA; FIG. 1D is an SDS-PAGE electrophoresis of the purified LaA-BCR; FIG. 1E is a Western blot analysis of LaA-BCR affinity for LaA protein; FIG. 1F is an ELISA analysis of the LaA peptide by LaA-BCR.
FIG. 2 shows the structural features of LaA-CAAR NK92MI cells and their functional verification. FIG. 2A is a schematic diagram of a LaA-CAAR structure; FIG. 2B shows the expression of LaA-CAAR in NK92MI cells after stable transfection of NK92MI cells with LaA-CAAR lentivirus; FIG. 2C shows the flow cytometry detection of LaA-CAAR expression in NK92MI cells; FIG. 2D is an average fluorescence intensity analysis of NK92MI cells stably transfected with LaA-CAAR constructs.
FIG. 3 shows the functional verification of LaA-BCR-Jurkat, laA-BCR-Romas and LaA-BCR-Maver-1 cells. FIG. 3A is a schematic diagram of the structure of LaA-BCR; FIG. 3B shows the expression of LaA-BCR on Jurkat, romas and Maver-1 cells, respectively, by flow cytometry; FIGS. 3C, D, E are mean fluorescence intensity analyses of Jurkat, romas and Maver-1 cells stably transfected with LaA-BCR constructs, respectively.
FIG. 4 shows the flow cytometry analysis of CD19 and CD56 expression in NK92MI, laA-CAAR NK92MI, romas, laA-BCR-Romas, maver-1, laA-BCR-Maver-1 and CD3 and CD56 in Jurkat, laA-BCR-Jurkat cells.
FIG. 5 shows that LaA-CAAR-NK92MI cells can specifically eliminate LaA-BCR stably expressed lymphoma cell lines. FIGS. 5A, C show the toxic effects of NK92MI and LaA-CAAR NK92MI on Romas and LaA-BCR-Romas cells at E:T=1:1; FIGS. 5B, D show the toxic effects of NK92MI and LaA-CAAR NK92MI on Romas and LaA-BCR-Romas cells at E:T=2:1; FIGS. 5E, G show the toxic effects of NK92MI and LaA-CAAR NK92MI on Maver-1 and LaA-BCR-Maver-1 cells at E:T=1:1; FIG. 5F, H shows the toxic effects of NK92MI and LaA-CAAR NK92MI on Maver-1 and LaA-BCR-Maver-1 cells at E:T=2:1.
FIG. 6 shows that LaA-CAAR-NK92MI cells can specifically deplete LaA-BCR stably expressed T cell acute lymphoblastic leukemia cells. FIGS. 6A, C show the toxic effects of NK92MI and LaA-CAAR NK92MI on Jurkat and LaA-BCR-Jurkat cells at E:T=1:1; FIG. 6B, D shows the toxic effects of NK92MI and LaA-CAAR NK92MI on Jurkat and LaA-BCR-Jurkat cells at E:T=2:1.
FIG. 7 shows the proliferation response of NK92MI cells against LaA-BCR-Jurkat, laA-BCR-Romas and LaA-BCR-Maver-1 cells. Panels A, B show that Jurkat, laA-BCR-Jurkat cells failed to stimulate proliferation of NK92MI and LaA-CAAR-NK92MI cells; panel C, D shows that Romas, laA-BCR-Romas cells were unable to stimulate proliferation of NK92MI and LaA-CAAR-NK92MI cells; panel E, F shows that Maver-1, laA-BCR-Maver-1 cells failed to stimulate proliferation of NK92MI and LaA-CAAR-NK92MI cells.
FIG. 8 shows the detection of LaA-BCR expression in blood B cells of patients with autoimmune diseases by flow cytometry.
FIG. 9 shows a whole blood B cell depletion experiment in a patient sample with autoimmune disease. Panel A shows a whole blood B cell depletion assay procedure; panel B shows that NK92MI and LaA-CAAR NK92MI cells did not kill T cells in autoimmune patients; panel C shows that NK92MI has no killing effect on B cells in autoimmune patients; panel D shows that LaA-CAAR NK92MI cells have targeted killing effect on B cells of patients with autoimmune diseases.
FIG. 10 shows that NK92MI and LaA-CAAR NK92MI cells did not kill T and B cells in normal healthy humans. Panel A shows that after flow cytometry analysis of healthy human whole blood incubated with NK92MI and LaA-CAAR NK92MI cells for 24 hours, the survival rate of T and B cells was examined; panel B shows that NK92MI and LaA-CAAR NK92MI cells did not kill normal T cells; panel C shows that NK92MI and LaA-CAAR NK92MI cells did not kill normal B cells.
Detailed Description
Through extensive and intensive studies, the present inventors have unexpectedly obtained, through a large number of screens, a fusion protein modified by an anti-La/SSB chimeric antigen, which has an optimized structure represented by formula I, and NK cells expressing the fusion protein. Experimental results show that the specific NK cells (such as LaA-CAAR NK92MI cells) modified by the fusion protein provided by the invention can be used for targeted treatment of La/SSB autoantibody-positive autoimmune diseases, and have the advantages of good curative effect, small side effect, low production cost and the like. The present invention has been completed on the basis of this finding.
In autoimmune diseases where autoantibodies La/SSB are strongly positive, the surface of memory B cells that are hyper-responsive and pathogenic express anti-La/SSB B cell receptors. Therefore, the invention takes La/SSB as the extracellular region of the chimeric immune receptor, takes NK cells as effector cells, and targets cytotoxicity to B cells (La/SSB-BCR-B) which specifically express the anti-La/SSB B cell receptor without inhibiting the immune system of the whole organism, thus avoiding a series of side reactions and providing a powerful means for targeted treatment of autoimmune diseases with strong positive La/SSB autoantibodies. The targeted therapeutic strategy directly eliminates the excessive reaction B cells and memory B cells of which the membrane surface expresses the anti-La/SSB cell receptor, and indirectly eliminates the short-lived plasma cells secreting pathogenic La/SSB autoantibodies.
In the invention, aiming at a B cell specific receptor (LaA-BCR) of the antigen LaA, a chimeric antigen gene modified NK cell is used for targeting treatment of an autoimmune disease positive to an La/SSB autoantibody, the NK cell is combined with the B cell specific receptor, a novel strategy is provided for exploring the targeting treatment of the autoimmune disease, and a novel effective method and preparation are provided for clinical application of the CAR-NK for treating the autoimmune disease.
Terminology
La/SSB
The La/SSB gene is a housekeeping gene, expressed in the nucleus, and under the action of some physical and chemical factors, la/SSB antigen is released and recognized by B cells, thereby generating high-titer antibodies against La/SSB autoantigens, which are deposited throughout blood vessels and organs of the body, thereby causing damage to the body. La/SSB autoantigens are divided into three immune regions: laA (1-107 aa), laC (111-242 aa) and LaL2/3 (346-408 aa). Autoantibodies against the conserved aerofoil helical determinant LaA are of great significance, they occur almost one hundred percent in the serum positive for precipitant, and appear early in the anti-La/SSB autoantibodies, with a diagnostic effect before autoimmune disease occurs. In addition, after the La/SSB autoantigen is activated, the specific B cell epitope is only expressed on the overreacted B cells and memory B cells, thereby avoiding the possibility of off-target toxicity.
LaA
The LaA region is the most predominant functional region of La/SSB. According to the invention, a LaA antigen region is used as an extracellular fragment, a series of functional regions (FC, CD28,4-1BB and CD3 zeta) are connected at the back, a structure (CAAR) capable of specifically recognizing pathogenic B cells is constructed, and finally the structure is constructed on NK92MI cells, so that LaA-CAAR NK92MI effector cells with targeted pathogenic B cells (LaA-BCR-B cells) are obtained.
La/SSB antibodies
Autoantibodies against La/SSB, which are diagnostic marker antibodies to Systemic Lupus Erythematosus (SLE) and Sjogren's Syndrome (SS) in the serum of some autoimmune diseases, are present at high titers, and 97% of La/SSB antibody-positive patients show sjogren's syndrome.
Studies have shown that anti-La/SSB antibodies are produced earlier than the onset and diagnosis of SLE symptoms, and are also important participants in the pathogenesis of SLE. The targeted elimination of B cells and memory B cells that are resistant to La/SSB overreactions should be able to treat and alleviate the symptoms of autoimmune diseases that are strongly positive for La/SSB autoantibodies without the risk of the body being immunosuppressed.
NK cells
Natural Killer (NK) cells are a major class of immune effector cells, the body is protected from viral infection and tumor cell attack by non-antigen specific pathways. In autoimmune diseases, NK cell imbalance (reduction) is an important mechanism leading to the onset of autoimmune diseases, NK cell reduction leading to a decrease in their function of nonspecifically inhibiting B cell secretion of antibodies. NK92 cells are the only cell line approved by the FDA at present for clinical test, have strong cytotoxic ability, short survival time after killing tumor cells, are easy to expand in vitro, and most of patients receiving treatment do not reject NK92-MI cells and have no danger of graft versus host reaction. In the present invention, NK cells are selected as effector cells.
NK92MI cells
New functions may be obtained by genetically modified NK92MI (CAAR-NK 92 MI) cells, including the ability to specifically recognize tumor antigens and enhanced anti-tumor cytotoxicity. NK92MI cells have a strong cytotoxic effect against a wide variety of tumors, such as leukemia, lymphoma, myeloma, and some solid tumors. Several clinical trials have shown that high doses of NK92MI cell infusion is also highly safe.
CAAR-NK92MI also has the following advantages over autologous CAR-T cells, for example: (1) The perforin and the granzyme are released to directly kill tumor cells, and the perforin and granzyme have no killing effect on normal cells of the organism; (2) They release very small amounts of cytokines and thus reduce the risk of cytokine storms; (3) Is easy to expand and develop into a ready-made product in vitro. In addition, similar to CAR-T cell therapy, CAR-NK92 or CAR-NK92MI does not elicit immune tolerance.
Fc fragment
As used herein, the terms "Fc fragment", "Fc element" have the same meaning, and are not particularly limited, and are linker peptide fragments (or hinge domains) of the fusion proteins of the invention. In the present invention, the Fc fragment may be an Fc fragment of a mammalian immunoglobulin, preferably an Fc fragment of a human immunoglobulin. In a preferred example, the Fc fragment is an Fc fragment of IgG, igA, igM, igD, igE, preferably the Fc fragment is an Fc fragment of IgG, more preferably the Fc fragment is an Fc fragment of IgG1 or IgG 2. The length of the Fc fragment is 200-250 amino acids, preferably 220-240 amino acids, more preferably about 230 amino acids. In a preferred embodiment of the invention, the Fc fragment has the amino acid sequence as shown in SEQ ID NO. 1 at positions 130-359. In another preferred embodiment, the amino acid sequence of the Fc fragment is as set forth in SEQ ID NO. 1 at positions 130-359.
Fusion proteins
As used herein, the terms "LaA-CAAR", "fusion protein of the invention", "active polypeptide" and "polypeptide of the invention" have the same meaning and all have the structure according to the first aspect of the invention. The fusion protein of the present invention comprises: the sequence of the leader sequence, laA peptide capable of binding specifically to LaA-BCR, hinge domain (Fc), CD28 transmembrane domain (TM), two costimulatory domains (CD 28 and 4-1 BB) and CD3 zeta, among other signal regions, was defined as LaA-CAAR.
The fusion protein of the invention has the following characteristics:
a) After expression, the fusion protein of the invention passes through and locates on the cell membrane to form a membrane protein exposing LaA element outside the cell. In addition, the fusion proteins of the invention have co-stimulatory molecules (or elements) and cd3ζ located intracellular. Furthermore, the fusion proteins of the invention may contain optional signal peptides, linker peptide elements (linker), or other elements.
b) The fusion proteins of the invention are capable of very efficiently binding to LaA-BCR or LaA-TCR proteins on the surface of B cells (or other cells such as T cells) in patients with autoimmune diseases (such as humans).
c) The fusion protein of the invention can effectively neutralize, inhibit and clear the anti-La/SSB antibody in patients with autoimmune diseases.
The term "fusion protein" as used herein also includes variants of the sequence SEQ ID NO. 1 having the above-described activity. These variants include (but are not limited to): deletions, insertions and/or substitutions of 1-3 (typically 1-2, more preferably 1) amino acids, and additions or deletions of one or several (typically within 3, preferably within 2, more preferably within 1) amino acids at the C-terminus and/or N-terminus. For example, in the art, substitution with amino acids of similar or similar properties does not generally alter the function of the protein. As another example, the addition or deletion of one or more amino acids at the C-terminus and/or N-terminus generally does not alter the structure or function of the protein. Furthermore, the term also includes polypeptides of the invention in monomeric and multimeric form. The term also includes linear as well as non-linear polypeptides (e.g., cyclic peptides).
The invention also includes active fragments, derivatives and analogues of the fusion proteins. As used herein, the terms "fragment," "derivative," and "analog" refer to polypeptides that substantially retain the function or activity of the fusion proteins of the invention. The polypeptide fragment, derivative or analogue of the present invention may be (i) a polypeptide having one or several conserved or non-conserved amino acid residues, preferably conserved amino acid residues, substituted or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide formed by fusion of an antigenic peptide with another compound such as a compound which extends the half-life of the polypeptide, for example polyethylene glycol, or (iv) a polypeptide formed by fusion of an additional amino acid sequence to such a polypeptide sequence (fusion protein formed by fusion with a tag sequence such as a leader sequence, a secretory sequence or 6 His). Such fragments, derivatives and analogs are within the purview of one skilled in the art and would be well known in light of the teachings herein.
A preferred class of reactive derivatives refers to polypeptides in which up to 3, preferably up to 2, more preferably up to 1 amino acid is replaced by an amino acid of similar or similar nature, compared to the amino acid sequence of formula Ia or Ib. These conservatively variant polypeptides are preferably generated by amino acid substitutions according to Table A.
Table A
Initial residues Representative substitution Preferred substitution
Ala(A) Val；Leu；Ile Val
Arg(R) Lys；Gln；Asn Lys
Asn(N) Gln；His；Lys；Arg Gln
Asp(D) Glu Glu
Cys(C) Ser Ser
Gln(Q) Asn Asn
Glu(E) Asp Asp
Gly(G) Pro；Ala Ala
His(H) Asn；Gln；Lys；Arg Arg
Ile(I) Leu；Val；Met；Ala；Phe Leu
Leu(L) Ile；Val；Met；Ala；Phe Ile
Lys(K) Arg；Gln；Asn Arg
Met(M) Leu；Phe；Ile Leu
Phe(F) Leu；Val；Ile；Ala；Tyr Leu
Pro(P) Ala Ala
Ser(S) Thr Thr
Thr(T) Ser Ser
Trp(W) Tyr；Phe Tyr
Tyr(Y) Trp；Phe；Thr；Ser Phe
Val(V) Ile；Leu；Met；Phe；Ala Leu
The invention also provides analogs of the fusion proteins of the invention. These analogs may differ from the polypeptide shown in SEQ ID No. 1 by the amino acid sequence, by modified forms that do not affect the sequence, or by both. Analogs also include analogs having residues other than the natural L-amino acid (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.
Modified (typically without altering the primary structure) forms include: chemically derivatized forms of polypeptides such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications during synthesis and processing of the polypeptide or during further processing steps. Such modification may be accomplished by exposing the polypeptide to an enzyme that performs glycosylation (e.g., mammalian glycosylase or deglycosylase). Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides modified to improve their proteolytic resistance or to optimize solubility.
In one embodiment of the invention, the amino acid sequence of the fusion protein is shown in SEQ ID NO. 1.
MLLLVTSLLLCELPHPAFLLIPMAENGDNEKMAALEAKICHQIEYYFGDFNLPRDKFLKEQIKLDEGWVPLEIMIKFNRLNRLTTDFNVIVEALSKSKAELMEISEDKTKIRRSPSKPLPEVTDEYKNDESKYGPPCPPCPAPEFLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSQEDPEVQFNWYVDGVEVHNAKTKPREEQFNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKGLPSSIEKTISKAKGQPREPQVYTLPPSQEEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSRLTVDKSRWQEGNVFSCSVMHEALHNHYTQKSLSLSLGKMFWVLVVVGGVLACYSLLVTVAFIIFWVRSKRSRGGHSDYMNMTPRRPGPTRKHYQPYAPPRDFAAYRSKRGRKKLLYIFKQPFMRPVQTTQEEDGCSCRFPEEEEGGCELRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPR(SEQ ID No.:1)。
Wherein, in SEQ ID No. 1, the 1 st to 22 nd positions are signal peptides; laA peptide at positions 23-129; connecting peptide (Fc) at 130-359; the transmembrane domain (CD 28) at positions 360-427; the 428-469 th sites are co-stimulatory elements (4-1 BB); positions 470-581 are CD3 zeta.
Coding sequence
The invention also relates to polynucleotides encoding fusion proteins according to the invention.
The polynucleotides of the invention may be in the form of DNA or RNA. The DNA may be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide may be identical to the sequence encoding the polypeptide set forth in SEQ ID NO. 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence that encodes a polypeptide having the sequence set forth in SEQ ID NO. 1, but differs in the sequence of the corresponding coding region.
In a preferred embodiment of the invention, the polynucleotide has the sequence shown in SEQ ID NO. 2.
The full-length nucleotide sequence or a fragment thereof of the present invention can be usually obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. At present, it is entirely possible to obtain DNA sequences encoding the polypeptides of the invention (or fragments or derivatives thereof) by chemical synthesis. The DNA sequence can then be introduced into a variety of existing DNA molecules (or vectors, for example) and cells known in the art.
The invention also relates to vectors comprising the polynucleotides of the invention, and host cells genetically engineered with the vectors or polypeptide coding sequences of the invention. The polynucleotide, vector or host cell described above may be isolated.
As used herein, "isolated" refers to a substance that is separated from its original environment (i.e., the natural environment if it is a natural substance). If the polynucleotides and polypeptides in the native state in living cells are not isolated or purified, the same polynucleotides or polypeptides are isolated or purified if they are separated from other substances that are present in the native state.
The polynucleotides of the invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.
The invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the invention. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, without substantially altering the function of the fusion protein of the invention encoded thereby.
The full-length nucleotide sequence of the polypeptide of the present invention or a fragment thereof can be generally obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order.
In one embodiment of the invention, the polynucleotide sequence encoding the fusion protein is shown in SEQ ID NO. 2.
ATGCTGCTCCTGGTGACCTCCCTGCTGCTGTGTGAACTCCCCCACCCCGCTTTCCTGCTGATCCCCATGGCTGAAAATGGTGATAATGAAAAGATGGCTGCCCTGGAGGCCAAAATCTGTCATCAAATTGAGTATTATTTTGGCGACTTCAATTTGCCACGGGACAAGTTTCTAAAGGAACAGATAAAACTGGATGAAGGCTGGGTACCTTTGGAGATAATGATAAAATTCAACAGGTTGAACCGTCTAACAACAGACTTTAATGTAATTGTGGAAGCATTGAGCAAATCCAAGGCAGAACTCATGGAAATCAGTGAAGATAAAACTAAAATCAGAAGGTCTCCAAGCAAACCCCTACCTGAAGTGACTGATGAGTATAAAAATGATGAGAGCAAGTACGGCCCTCCCTGCCCCCCTTGCCCTGCCCCCGAGTTCCTGGGCGGACCCAGCGTGTTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCCGGACCCCCGAGGTGACCTGTGTGGTGGTGGACGTGTCCCAGGAGGACCCCGAGGTCCAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCCCGGGAGGAGCAGTTCAATAGCACCTACCGGGTGGTGTCCGTGCTGACCGTGCTGCACCAGGACTGGCTGAACGGCAAGGAATACAAGTGTAAGGTGTCCAACAAGGGCCTGCCCAGCAGCATCGAGAAAACCATCAGCAAGGCCAAGGGCCAGCCTCGGGAGCCCCAGGTGTACACCCTGCCCCCTAGCCAAGAGGAGATGACCAAGAATCAGGTGTCCCTGACCTGCCTGGTGAAGGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCTGTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAGGCTGACCGTGGACAAGAGCCGGTGGCAGGAGGGCAACGTCTTTAGCTGCTCCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGTCCCTGAGCCTGGGCAAGATGTTCTGGGTGCTGGTCGTGGTGGGTGGCGTGCTGGCCTGCTACAGCCTGCTGGTGACAGTGGCCTTCATCATCTTTTGGGTGAGGAGCAAGCGGAGCAGAGGCGGCCACAGCGACTACATGAACATGACCCCCCGGAGGCCTGGCCCCACCCGGAAGCACTACCAGCCCTACGCCCCTCCCAGGGACTTCGCCGCCTACCGGAGCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGCGGGTGAAGTTCAGCCGGAGCGCCGACGCCCCTGCCTACCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACCTGGGCCGGAGGGAGGAGTACGACGTGCTGGACAAGCGGAGAGGCCGGGACCCTGAGATGGGCGGCAAGCCCCGGAGAAAGAACCCTCAGGAGGGCCTGTATAACGAACTGCAGAAAGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGCGGCGGAGGGGCAAGGGCCACGACGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGATACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCCAGATGA(SEQ ID No.:2)。
Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.
Furthermore, the sequences concerned, in particular fragments of short length, can also be synthesized by artificial synthesis. In general, fragments of very long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.
Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining the genes of the present invention. Primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.
The invention also relates to vectors comprising the polynucleotides of the invention, host cells genetically engineered with the vectors or protein coding sequences of the invention, and methods for expressing the fusion proteins of the invention on NK cells by recombinant techniques.
NK cells expressing the fusion proteins of the present invention can be obtained by conventional recombinant DNA techniques using the polynucleotide sequences of the present invention. Generally comprising the steps of: transduction of the polynucleotide according to the second aspect of the present invention or the vector according to the third aspect of the present invention into NK cells to thereby obtain said NK cells.
Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequences for the enzymes of the invention and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.
In addition, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.
Vectors comprising the appropriate DNA sequences as described above, as well as appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.
The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: bacterial cells of the genus escherichia coli, bacillus subtilis, streptomyces; fungal cells such as pichia pastoris cells; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, NS0, COS7, or 293 cells. In a preferred embodiment of the invention, NK cells are selected as host cells.
Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E.coli, competent cells, which can take up DNA, can be obtained after the exponential growth phase and then treated with CaCl 2 The method is carried out by the steps ofAs is well known in the art. Another approach is to use MgCl 2 . Transformation can also be performed by electroporation, if desired. When the host is eukaryotic, the following DNA transfection methods may be used: calcium phosphate co-precipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.
The transformant obtained can be cultured by a conventional method to express the protein encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culture is carried out under conditions suitable for the growth of the host cell. After the host cells have grown to the appropriate cell density, the selected promoters are induced by suitable means (e.g., temperature switching or chemical induction) and the cells are cultured for an additional period of time.
The protein in the above method may be expressed in the cell, or on the cell membrane, or secreted outside the cell. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. Such methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic sterilization, super-treatment, super-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations of these methods.
Preparation method
The fusion protein (polypeptide) of the invention may be a recombinant polypeptide or a synthetic polypeptide. The polypeptides of the invention may be chemically synthesized, or recombinant. Accordingly, the polypeptides of the invention may be synthesized synthetically by conventional methods or produced recombinantly. The present invention employs conventional recombinant DNA techniques to express or produce the fusion proteins of the present invention using the polynucleotides of the present invention.
The present invention provides a method of preparing LaA-CAAR NK cells, said method comprising transducing the polynucleotide or vector of the present invention into NK cells, thereby obtaining said LaA-CAAR NK cells.
Generally, there are the following steps:
(1) Transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a fusion protein of the invention, or with a recombinant expression vector comprising the polynucleotide;
(2) Host cells cultured in a suitable medium.
Pharmaceutical compositions and methods of administration
The LaA-CAAR NK cells can target and eliminate pathogenic B cells (memory B cells) with LaA specific BCR, indirectly inhibit the secretion of La/SSB autoantibodies by plasma cells, and thus realize the treatment effect.
In another aspect, the present invention also provides a pharmaceutical (including vaccine) composition comprising (a) a safe and effective amount of LaA-CAAR NK cells of the present invention; and (b) a pharmaceutically acceptable carrier or excipient.
The "active ingredient" in the pharmaceutical composition of the invention refers to LaA-CAAR NK cells of the invention.
The "active ingredients" and pharmaceutical compositions of the present invention are useful for the treatment of autoimmune diseases.
"safe and effective amount" means: the amount of active ingredient is sufficient to significantly improve the condition without causing serious side effects.
Typically, the pharmaceutical compositions contain 1-2000mg of active ingredient per dose, more preferably 10-200mg of active ingredient per dose. Preferably, the "one dose" is a tablet or an injection.
"pharmaceutically acceptable carrier" means: one or more compatible solid or liquid filler or gel materials which are suitable for human use and must be of sufficient purity and sufficiently low toxicity.
"compatibility" as used herein means that the components of the composition are capable of blending with and between the active ingredients of the present invention without significantly reducing the efficacy of the active ingredients.
Examples of pharmaceutically acceptable carrier moieties are cellulose and its derivatives (e.g. sodium carboxymethylcellulose, sodium ethylcellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (e.g. stearic acid, magnesium stearate ) Calcium sulfate, vegetable oil (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyalcohol (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), and emulsifying agentWetting agents (e.g., sodium lauryl sulfate), coloring agents, flavoring agents, stabilizing agents, antioxidants, preservatives, pyrogen-free water, and the like.
The mode of administration of the active ingredient or pharmaceutical composition of the present invention is not particularly limited, and representative modes of administration include, but are not limited to: oral, intratumoral, rectal, parenteral (intravenous, intramuscular, or subcutaneous), and the like.
Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules.
In these solid dosage forms, the active ingredient is admixed with at least one conventional inert excipient or carrier, such as sodium citrate or dicalcium phosphate, or with one or more of the following:
(a) Fillers or compatibilizers, for example, starch, lactose, sucrose, glucose, mannitol and silicic acid; (b) Binders, for example, hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose and acacia; (c) humectants, e.g., glycerin; (d) Disintegrants, for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) a slow solvent, such as paraffin; (f) an absorption accelerator, e.g., a quaternary amine compound; (g) Wetting agents, such as cetyl alcohol and glycerol monostearate; (h) an adsorbent, for example, kaolin; and/or (i) a lubricant, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, or mixtures thereof.
In capsules, tablets and pills, the dosage forms may also comprise buffering agents.
The solid dosage forms may also be prepared using coatings and shells, such as enteric coatings and other materials known in the art. They may contain opacifying agents and the release of the active ingredient in such a composition may be released in a delayed manner in a certain part of the digestive tract. Examples of embedding components that can be used are polymeric substances and waxes.
Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butylene glycol, dimethylformamide and oils, in particular, cottonseed, groundnut, corn germ, olive, castor and sesame oils or mixtures of these substances and the like. In addition to these inert diluents, the compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.
Suspensions, in addition to the active ingredient, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar or mixtures of these substances, and the like.
Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and nonaqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof. In general, the therapeutic compositions may be formulated as an injectable, such as a liquid solution or suspension; it can also be made into a solid form suitable for incorporation into a solution or suspension, and a liquid carrier prior to injection.
When the pharmaceutical composition of the present invention is used for actual treatment, various different dosage forms of the pharmaceutical composition, preferably injection or liquid preparation, may be employed depending on the use condition.
When a pharmaceutical composition is used, a safe and effective amount of the compound of the present invention is applied to a mammal (e.g., a human) in need of treatment, wherein the dose at the time of administration is a pharmaceutically effective dose, and the daily dose is usually 1 to 2000mg, preferably 20 to 500mg, for a human having a body weight of 60 kg. Of course, the particular dosage should also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner.
The pharmaceutical compositions of the invention may be administered alone or in combination (e.g., formulated in the same pharmaceutical composition) with other therapeutic agents.
The pharmaceutical compositions of the present invention may also be used in combination with other drugs known to treat or ameliorate similar conditions. When administered in combination, the mode of administration and dosage of the original drug remains unchanged, while the pharmaceutical composition of the present invention is administered simultaneously or subsequently. Drug combinations also include administration of the pharmaceutical compositions of the present invention with one or more other known drugs over overlapping time periods. When the pharmaceutical composition of the present invention is used in combination with one or more other drugs, the dosage of the pharmaceutical composition of the present invention or the known drug may be lower than when they are administered alone.
The main advantages of the invention
(1) The LaA-CAAR NK92MI provided by the invention can specifically kill pathogenic B cells (memory B cells) expressing LaA-BCR, indirectly kill plasma cells secreting anti-LaA autoantibodies, thereby alleviating the damage of the autoantibodies to the body, relieving the symptoms of autoimmune diseases, simultaneously not inducing extensive immunosuppression, having no obvious killing effect on normal T cells and B cells, not affecting the normal immune function of the body and having no side reaction.
(2) The LaA-CAAR NK cell provided by the invention has the advantages of strong cytotoxic capability, short survival time after killing tumor cells, easy in vitro amplification, low production cost and no danger of graft versus host reaction.
(3) The LaA-CAAR NK cells provided by the invention have a very strong cytolytic effect on LaA-BCR-Jurkat, and provide a research foundation for further exploring the CAAR-NK cell specificity to kill autoreactive T cell lymphocytes in the future.
(4) After La/SSB autoantigens are activated, specific B cell epitopes are only expressed on overreacted B cells and memory B cells, so that the LaA-CAAR NK92MI provided by the invention has low possibility of off-target toxicity in targeted treatment.
The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods, in which specific conditions are not noted in the following examples, are generally conducted under conventional conditions or under conditions recommended by the manufacturer. Percentages and parts are by weight unless otherwise indicated.
General method
1. Cell line and blood sample
Human T cell acute lymphoblastic leukemia Jurkat cells were cultured with human lymphoma cell lines Maver-1 and Romas cells using RPMI-1640 medium containing 10% fetal bovine serum. HEK293T cells were cultured using DMEM medium containing 10% fetal bovine serum. NK92MI is an IL-2 independent natural killer cell line derived from the stable expression of IL-2 in NK92 cell lines by stable transfection. MEM-alpha medium containing 0.2mM inositol, 0.1mM beta-mercaptoethanol, 0.02mM folic acid, and 12.5% horse serum was used for cultivation. These cell lines were all from ATCC, 100U/ml penicillin and 100. Mu.g/ml streptomycin were added to the medium, 37℃containing 5% CO 2 Is cultured in an incubator of (a).
The blood samples of La/SSB autoantibodies strongly positive patients and healthy persons were collected after the approval of the principal to participate in the study, and also passed the approval of the university of soviet committee for ethics.
2. Statistical analysis
Statistical analysis was done by GraphPad Prism software version 5.0. The Paired-T test was used to compare the differences between groups, and P <0.05 was considered statistically significant.
EXAMPLE 1 purification of LaA protein and LaA-BCR protein
1.1 Induction and purification of LaA proteins
To induce expression of soluble LaA protein, the cDNA encoding LaA protein was subcloned into a pET28a prokaryotic expression vector (LaA-pET 28 a) containing 6×HIS (FIG. 1B), and the 6×HIS tag was used for protein purification. The LaA-pET28a plasmid was then transformed into E.coli BL21 (DE 3) strain for cultivation.
LaA protein is induced and purified according to the following steps: the LaA-pET28a monoclonal was picked and cultured overnight at 37℃in 3mL of LB medium containing 100. Mu.g/mL kanamycin. Then, the culture was continued in fresh medium containing 100. Mu.g/mL kanamycin at a ratio of 1:100, and 0.5mM isopropyless-D-1-thiohinging (IPTG, sangon Biotech) was added at 37℃for induction of 2.5-3 hours at the early log phase of the bacteria (OD=0.6-0.8). The LaA protein was then purified by Ni-NTA agaros (GE Healthcare Life Sciences) according to the reagent instructions. Imidazole was removed by dialysis overnight against PBS4 ℃. The molecular weight and purity of the protein were measured using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and the protein concentration was measured using BCA assay kit (Beyotime). A non-LaA protein was also purified as a negative control.
After purification of LaA soluble protein by His La/SSB tags, SDS-PAGE gel Coomassie blue staining showed a single band around 15kd (FIG. 1C).
1.2 construction, expression, purification and characterization of LaA-BCR proteins
Gene LaA-BCR was synthesized by ligating a tandem signal domain comprising the Signal Peptide (SP), the heavy chain (VH) variable region of LaA-BCR, the G4S linker and the light chain (VL) variable region of LaA-BCR into a pfuse-hIgG1-Fc eukaryotic expression vector (available from Invivogen) and designated LaA-BCR-pfuse-hIgG1-Fc after construction (FIG. 1A). LaA-BCR-pfuse-hIgG1-Fc vector was transformed into plasmid: HEK293T cells were transfected at a ratio of liposome=1:2. Transfected cell supernatants were collected 48h after transfection. Cell supernatants collected after transfection were centrifuged at 13000rpm for 15 minutes, respectively. Adding 10 Xsodium acetate solution into cell supernatant, adding 10 Xsodium acetate according to cell supernatant: 10 x sodium acetate = 9:1 and adjusting the pH to 5.0. The above cell supernatants with sodium acetate added were purified using Protein G according to the reagent instructions. The purified LaA-BCR protein is detected by using FC antibody Western blot, and the protein concentration is detected by using BCA detection kit (Beyotime). A non-LaA-BCR protein was also purified as a negative control.
After purification and concentration of LaA-BCR soluble protein by protein G column, SDS-PAGE gel coomassie blue staining showed a single band around 55kd (FIG. 1D).
Example 2 affinity assay of LaA-BCR protein with LaA antigen
The purified LaA antigen added to 5 XSDS-PAGE loading buffer (P0015L, beyotidme, shanghai, china) and non-LaA protein as a negative control were used as samples, the proteins on SDS-PAGE were separated by 12% SDS-PAGE, transferred to PDVF membranes (IPVH 00010, millipore, mass.), and incubated overnight at 4℃using purified LaA-BCR protein after 5% skim milk was blocked for 1 hour (Guangming, shanghai, china), followed by three washes using PBST containing 0.1% Tween-20, and then the PVDF membranes were incubated with horseradish peroxidase-conjugated anti-mouse IgG (H+L) secondary antibodies (A10677, life Technologies, CA). After three PBST washes, the PDVF membrane was visualized by chemiluminescence using an enhanced chemiluminescence kit (WBKLS 0500, millipore Corporation, MA).
Purified LaA protein coated ELISA microwell plates overnight at 4 ℃. The plate was washed three times with PBS, a series of diluted LaA-BCR protein and non-LaA-BCR protein as a negative control were added to the plate, and then washed three times with PBST containing 0.1% Tween-20, horseradish peroxidase-conjugated anti-mouse IgG (H+L) secondary antibody (A10677, life Technologies, CA) was incubated. Finally, 3', 5' -tetramethylbenzidine (TMB, WBKLS0500, millipore Corporation, MA) was used for color development. ELISA titers were determined using ELISA microplate reader (IVD 10, spectremax) at 450 nm.
The results are shown in fig. 1E and 1F, respectively, and the results indicate that: laA antigen has good affinity with LaA-BCR protein, and can be specifically combined with the LaA-BCR protein, so that the LaA-CAAR NK92MI provided by the invention can kill LaA-BCR positive tumor cell strains in vitro.
EXAMPLE 3 construction, characterization and functional verification of LaA-CAAR NK92MI cells
3.1 structural design of LaA-CAAR and lentiviral transfection
The molecular structure design of LaA-CAAR includes: a CD8 transmembrane signal peptide directs LaA-CAAR to express on NK92MI cell surface, laA antigen fragment as extracellular fragment, F C The ligation fragment, CD28 molecule (comprising the transmembrane region), 4-1BB costimulatory factor, and CD3ζ signaling region are ligated to form a fusion protein (FIG. 2A). LaA-CAAR fusion proteins comprise: leader sequence, LaA peptide, hinge domain (FC), CD28 transmembrane domain (TM), two costimulatory domains (CD 28 and 4-1 BB) and CD3 zeta intracellular signaling domain.
The SP-LaA-Fc-CD28/TM-4-1BB-CD3 zeta fusion gene sequence is synthesized and then constructed into pCDH-CMV-MCS-EF1-CopPuro (System Biosciences) lentiviral expression vector. 293T cells were plated, and the packaging plasmid DeltaR 6.5. Mu.g, V-VSG 3.5. Mu.g, rev 2.5. Mu.g and the desired plasmid 10. Mu.g were isolated in CaCl 2 Under the action of (2) transfecting 293T cells; fresh medium was changed after 12 hours; then collecting viruses once in 24 hours and 48 hours respectively; finally, the virus was concentrated by ultracentrifugation at 25000 rpm. NK92MI cell count (1X 10) 6 ) After incubation with lentiviral supernatant (moi=30) for 4-6 hours at 37 degrees, the viral supernatant was removed and the culture was continued in MEM-a medium containing 12.5% horse serum.
3.2 detection of LaA-CAAR expression in NK92MI cells
Three days after lentiviral transfection of NK92MI cells, the transfected NK92MI cells were analyzed for FC positive cell ratios using FACSCalibur (BD), where the control group was NK92MI plus FC antibody, which did not stain non-specifically. Cells were washed three times with PBS and flow-detected after application of PBS to be resuspended. LaA-CAAR positive NK92MI cells were enriched by flow cytometer (BD) and screened with 1. Mu.g/ml puromycin to allow stable expression of CAAR on the NK92MI cell surface for 4-6 months. The expression of LaA-CAAR in NK92MI cells was also analyzed by Western blotting. NK92MI and LaA-CAAR NK92MI cells were lysed, separated by SDS-PAGE under reducing and non-reducing conditions, and finally the expression of CD3 zeta was detected using murine monoclonal antibodies.
The results are shown in FIGS. 2B-2D. As can be seen from FIG. 2C, the streaming assay LaA-CAAR expressed over 90% of the NK92MI cell surface. As shown in FIG. 2D, the average fluorescence intensity of LaA-CAAR NK92MI was 200 times that of the control group NK92 MI. As can be seen from FIG. 2B, the expression of endogenous CD3 ζ was detected in both NK92MI (lane 1) and LaA-CAAR NK92 (lane 2) cells under reducing conditions, approximately 16kDa. The band around 65kDa only appears in LaA-CAAR NK92MI cells (lane 2). Under non-reducing conditions, other series of bands were present in LaA-CAAR NK92MI cells (lane 4) and not in parallel control NK92MI cells (lane 3), indicating homodimers formed between LaA-CAARs and heterodimers formed by LaA-CAARs with endogenous CD3 ζ. Both monomeric and homodimeric CD3 zeta were detected in NK92MI and LaA-CAAR NK92MI cells. The results indicate that LaA-CAAR is capable of stably expressing the LaA-CAAR structure in the constructed LaA-CAAR NK92MI cells.
EXAMPLE 4 construction of LaA-BCR stable tumor cell lines
In order to simulate the killing effect of NK92MI cells on deadly overactivated B cells in vitro, the invention constructs a tumor cell strain with a stable membrane expression LaA-BCR structure as a target cell. To more effectively evaluate the killing effect on lethal B cells, laA-BCR stable membranes were expressed on B cell-derived tumor cell lines (Rmoas and Maver-1) with B cell characteristics. In addition, laA-BCR stabilizing membrane is expressed on a T cell-derived tumor cell strain (Jurkat) with T cell characteristics, and whether LaA-CAAR has killing effect on the T cell-derived tumor cells or not is verified. The structure of LaA-BCR includes: signal peptide, laA-BCR heavy and light chain variable regions, FC fragment and transmembrane fragment that direct LaA-BCR stable membrane expression (fig. 3A). LaA-BCR is connected into PCDH-CMV-MCS-EF1 lentiviral expression vector, after virus packaging and concentration, romas, maver-1 and Jurkat tumor cells are stably transfected, after flow sorting and puromycin pressurized screening, tumor cell lines (comprising LaA-BCR-Romas, laA-BCR-Maver-1 and LaA-BCR-Jurkat) with stable membrane expression are obtained, and FC flow antibody is used for detecting LaA-BCR expression on Romas, maver-1 and Jurkat tumor cells.
As can be seen from FIG. 3B, the stable expression rate of LaA-BCR in Romas, maver-1 and Jurkat tumor cells is over 90 percent. The average fluorescence intensity of LaA-BCR-Romas, laA-BCR-Maver-1 and LaA-BCR-Jurkat was 100-600 times that of the control group (FIG. 3C-E).
Example 5 LaA-CAAR NK92MI has very potent cytotoxicity against LaA-BCR positive tumor cells
5.1LaA-CAAR NK92MI and selection of tumor cell markers
In examples 3 and 4, the LaA-CAAR was constructed to have 90% or more expression on NK92MI cells, and LaA-BCR was constructed to have 90% or more expression on Romas, maver-1 and Jurkat. This example demonstrates that CD56 is expressed by more than 90% on NK92MI cell surfaces, but not on Romas, maver-1 and Jurkat; CD19 and CD3 were expressed at 90% or more on the surface of Romas, maver-1 and Jurkat cells, respectively, but not on NK92MI cells, where the control group was cells without antibody staining (FIG. 4).
Thus, CD56 was selected as a marker for NK92MI cells, CD19 as a marker for Romas and Maver-1 cells, and CD3 as a marker for Jurkat cells.
5.2LaA cytotoxic Effect of CAAR NK92MI on LaA-BCR-positive tumor cells
To assess the cytotoxic effect of LaA-CAAR NK92MI on LaA-BCR positive tumor cells, tumor cells were co-cultured with LaA-CAAR NK92 MI. After LaA-BCR positive tumor cells and NK92MI cells were co-cultured for 6 hours, CD56, CD3 and CD19 flow antibodies were used for 30min-1hr, and CD3 antibodies were used for detecting the survival rate of Jurkat cells, and CD19 antibodies were used for detecting the survival rates of Romas and Maver-1 cells, so that the death rate of tumor cells was indirectly calculated.
The results show that the effective target ratio E, t=1: 1, after LaA-CAAR NK92MI cells were co-cultured with B cell-derived tumor cells LaA-BCR-Romas and LaA-BCR-Maver-1 for 6 hours, laA-CAAR NK92MI killed approximately 60% of LaA-BCR-Romas cells (FIGS. 5A, C); the killing ratio of LaA-BCR-Maver-1 cells was about 70% (FIGS. 5E, F). When the effective target ratio E: t=2:1 was increased, laA-CAAR NK92MI killed approximately 90% of LaA-BCR-Romas to LaA-BCR-Maver-1 cells (fig. 5b, d versus fig. 5g, h), showing a stronger cytotoxic effect. LaA-CAAR NK92MI cells were co-cultured with T cell-derived tumor cells LaA-BCR-Jurkat for 6-8h and tested, E: T=1: 1, laA-CAAR NK92MI killed approximately 70% of the tumor cells (FIGS. 6A, C); e, t=2: 1, about 80% of the cells were killed (fig. 6b, d). It can be seen that LaA-CAAR NK92MI has a stronger cytotoxic effect on LaA-BCR-expressed tumor cells, and that the cytotoxic effect is more pronounced with increasing effective target ratio.
5.2 proliferation of LaA-CAAR NK92MI cells
In addition, when NK92MI, laA-CAAR NK92MI andwhen the tumor cells are co-cultured, proliferation of NK92MI and LaA-CAAR NK92MI cells is detected simultaneously. Will be 1X 10 6 NK92MI cells of LaA-CAAR NK92MI cells were seeded in six well plates (Costar). NK92MI and LaA-CAAR NK92MI were stained with CFSE, jurakt, laA-BCR-Jurkat, maver-1, laA-BCR-Maver-1, romas and LaA-BCR-Romas at E:T=2: 1 were co-cultured with NK92MI and LaA-CAAR-NK92MI cells. Four days later, the relative proliferation level (mean fluorescence intensity MFI) of NK92MI and LaA-CAAR NK92MI was examined by flow technique.
As can be seen from FIG. 7, the in vitro tumor cell line did not stimulate proliferation of NK92 and LaA-CAAR NK92MI cells. The LaA-CAAR NK92MI cells are proved to have good safety, and a powerful safety basis is provided for later clinical tests.
EXAMPLE 6 LaA-CAAR NK92MI specific targeting and killing of B cells of autoimmune patients strongly positive with primary LaA antibodies
In the embodiment, the loss condition of the LaA-CAAR NK92MI on the whole blood B cells of the autoimmune disease patient is detected in vitro by adopting an autologous whole blood B cell loss measurement method, so that the killing effect of the LaA-CAAR NK92MI on the B cells expressing LaA-BCR is evaluated. Three examples of blood samples from autoimmune disease patients with strong positivity of autoantibodies La/SSB were collected and the proportion of LaA-BCR positive B cells in the blood of autoimmune disease patients was detected to be 11.5%,14% and 13.4% respectively using LaA-HIS antigen (FIG. 8).
After CFSE staining of NK92MI and LaA-CAAR NK92MI, fresh blood from patients strongly positive with 200ul of anti-La/SSB autoantibodies contained 5% CO 2 After co-incubation in an incubator at 37 ℃ for 24 hours, erythrocytes were lysed using bd red blood cell lysates by incubation with CD3, CD45, and CD19 antibodies for 30 min. Collection of 1X 10 4 Individual lymphocytes (CFSE-/cd45+), data were analyzed using flow analysis software FlowJo.
The percentage of B cell depletion due to LaA-CAAR-NK92MI was defined as the cytotoxicity index (CTI) calculated using the following formula:
LaA-CAAR-NK92MI CTI= [ (100/B cells: T cell ratio in samples without LaA-CAAR-NK92MI cells) × (B cells: T cell ratio in samples with LaA-CAAR-NK92MI cells) ].
The control group was not added with NK92MI and LaA-BCR-NK92MI samples, and the B cell loss percentage of the control group was set to 0.
The results showed that LaA-CAAR NK92MI experimental group caused about 25% of B cells missing compared with NK92MI experimental group (FIGS. 9A, D), which showed that LaA-CAAR NK92MI could specifically kill memory B cells expressing LaA-BCR, indirectly kill plasma cells secreting anti-La/SSB autoantibodies, thereby alleviating destruction of the body by autoantibodies and alleviating symptoms of autoimmune diseases.
NK92MI and LaA-CAAR NK92MI had no killing effect on normal T cells in the patient's blood (FIG. 9B); NK92MI also had no significant killing effect on normal B cells in the patient's blood compared to the control group (fig. 9C).
In addition, blood samples of 3 healthy patients were collected at the same time, and the experimental method was the same as above. The results show that NK92MI and LaA-CAAR NK92MI for healthy patients normal T and B cells do not have killing effect (fig. 10).
Discussion of the invention
In recent years, CAR therapy has become a very promising approach to treat various hematological malignancies. To date, great progress has been made in the treatment of various B cell-derived malignancies using CD19 CARs, which have been validated by clinical trials and have significant efficacy. However, autoimmune diseases are complex and refractory diseases which destroy the body due to the fact that the body recognizes autoantigens and secretes high-titer autoantibodies, and at present, no good treatment standard exists and an effective treatment scheme is lacking. Few CARs have been used in attempts to treat autoimmune diseases.
Currently, the treatment of autoimmune diseases is increasingly focused on the function of B cells. The most representative is the CD20 monoclonal antibody (Rituximad) targeted B cell deletion experiment, which has certain curative effects in Systemic Lupus Erythematosus (SLE), rheumatoid Arthritis (RA) and Pemphigus Vulgaris (PV), but CD20 monoclonal antibody damages the inherent immune system of the organism while killing diseased B cells, and a series of side reactions such as fatal infection and the like appear.
The article reports that the CAR-T technology is applied to treat pemphigus vulgaris, and certain effects are obtained in vitro and in a pemphigus vulgaris mouse model. However, in autoimmune diseases, the immune system of the whole body is disturbed, and T, B cells function abnormally. Studies have shown an increase in Th helper cell (cd4+) number, a decrease in Treg cell number, and an increase in memory B cell number with the ability to differentiate into plasma cells in SLE. In addition, the number and activity of cd8+ that exert cytotoxic effects decreased with the increase in follicular helper T cells (TFH). Thus, the use of autologous CAR-T cells to treat autoimmune diseases is not an ideal option, whereas allogeneic CAR-T cell therapy cannot avoid graft versus host response (GvDH).
In autoimmune diseases mediated by autoantibodies, autoantigen-based chimeric immune receptors can be directed to NK92MI cells to kill excessively responsive B cells, depending on the specificity of the B Cell Receptor (BCR). The invention reedits NK92MI cells to express an anti-chimeric antibody modified structure (CAAR), this structure includes the autoimmune disease autoantigen La/SSB and CD28-4-1BB-CD3 zeta signaling domain. La/SSB chimeric antigen modified NK92MI (La/SSB-CAAR NK92 MI) cells were able to specifically and effectively kill B cell-derived tumor cells (LaA-BCR-Romas, laA-BCR-Maver-1) and T cell-derived tumor cells (LaA-BCR-Jurkat) that specifically expressed anti-La/SSB B cell receptor (La/SSB-BCR). In addition, la/SSB chimeric antigen-modified NK92 cells (La/SSB-CAAR NK92 MI) were also able to cause B cell depletion in blood samples of patients with autoimmune diseases that were strongly positive for La/SSB autoantibodies, indicating that La/SSB chimeric antigen-modified NK92 cells (La/SSB-CAAR NK92 MI) were able to directly kill B cells expressing anti-La/SSB BCR hyper-responses (La/SSB-BCR-B) and indirectly kill plasma cells secreting La/SSB autoantibodies.
CAAR treatment is capable of exerting the greatest cytolytic effect, one of the most important factors being the specific binding of antigen and antibody and the verification of their functionality. The invention firstly verifies that LaA antigen can be specifically combined with LaA-BCR sequence and has better affinity. After that, it was verified that LaA-CAAR NK92MI cells had a strong cytolytic effect on LaA-BCR-Romas and LaA-BCR-Maver-1 tumor cells (E: T=2:1). Immune injury mechanisms of autoimmune diseases include, in addition to autoimmune diseases caused by autoantibodies, autoimmune diseases mediated by autoreactive T lymphocytes, such as (insulin dependent diabetes mellitus, IDDM). Therefore, the invention also selects the tumor cell line LaA-BCR-Jurkat from T cells as target cells, and the result shows that LaA-CAAR NK92MI cells have strong cytolytic effect on LaA-BCR-Jurkat. This provides a basis for future further exploration of CAAR NK92 MI-specific killing of autoreactive T cell lymphocytes. According to the invention, the blood of a patient with systemic lupus erythematosus or Sjogren syndrome, which is strongly positive by La/SSB autoantibodies, is collected, the expression condition of LaA-BCR in B cells is detected first, and then the cells are co-cultured with LaA-CAAR NK92MI overnight, so that LaA-CAAR NK92MI has strong cytolysis on LaA-BCR-B cells, but has no killing effect on T and B cells with normal functions.
Overall, laA-CAAR NK92MI effector cells were targeted only to eliminate pathogenic B cells (memory B cells) with LaA-specific BCR, indirectly inhibiting plasma cell secretion of anti-La/SSB autoantibodies. The pathogenesis of autoimmune diseases is not known, and the variety of autoantibodies in the body is vast. A novel target treatment strategy with high clinical application feasibility is explored, and an important research basis is provided for the combined targeting treatment of autoimmune diseases caused by various antibodies by various CAARs. Therefore, CAAR NK cell therapy is an innovative targeted therapeutic approach, avoiding the risk of the body being immunosuppressed.
All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.
Sequence listing
<110> Bosheng Ji medicine technology (Suzhou) Co., ltd
<120> an anti-La/SSB chimeric antigen-modified NK cell, a method for preparing the same and use thereof
<130> P2017-1227
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 581
<212> PRT
<213> Artificial sequence (artificial sequence)
<400> 1
Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro
1 5 10 15
Ala Phe Leu Leu Ile Pro Met Ala Glu Asn Gly Asp Asn Glu Lys Met
20 25 30
Ala Ala Leu Glu Ala Lys Ile Cys His Gln Ile Glu Tyr Tyr Phe Gly
35 40 45
Asp Phe Asn Leu Pro Arg Asp Lys Phe Leu Lys Glu Gln Ile Lys Leu
50 55 60
Asp Glu Gly Trp Val Pro Leu Glu Ile Met Ile Lys Phe Asn Arg Leu
65 70 75 80
Asn Arg Leu Thr Thr Asp Phe Asn Val Ile Val Glu Ala Leu Ser Lys
85 90 95
Ser Lys Ala Glu Leu Met Glu Ile Ser Glu Asp Lys Thr Lys Ile Arg
100 105 110
Arg Ser Pro Ser Lys Pro Leu Pro Glu Val Thr Asp Glu Tyr Lys Asn
115 120 125
Asp Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu
130 135 140
Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp
145 150 155 160
Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp
165 170 175
Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly
180 185 190
Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn
195 200 205
Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp
210 215 220
Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro
225 230 235 240
Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu
245 250 255
Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn
260 265 270
Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile
275 280 285
Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr
290 295 300
Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg
305 310 315 320
Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys
325 330 335
Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu
340 345 350
Ser Leu Ser Leu Gly Lys Met Phe Trp Val Leu Val Val Val Gly Gly
355 360 365
Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe
370 375 380
Trp Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn
385 390 395 400
Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr
405 410 415
Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Lys Arg Gly Arg Lys
420 425 430
Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr
435 440 445
Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu
450 455 460
Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro
465 470 475 480
Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly
485 490 495
Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro
500 505 510
Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr
515 520 525
Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly
530 535 540
Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln
545 550 555 560
Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln
565 570 575
Ala Leu Pro Pro Arg
580
<210> 2
<211> 1746
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 2
atgctgctcc tggtgacctc cctgctgctg tgtgaactcc cccaccccgc tttcctgctg 60
atccccatgg ctgaaaatgg tgataatgaa aagatggctg ccctggaggc caaaatctgt 120
catcaaattg agtattattt tggcgacttc aatttgccac gggacaagtt tctaaaggaa 180
cagataaaac tggatgaagg ctgggtacct ttggagataa tgataaaatt caacaggttg 240
aaccgtctaa caacagactt taatgtaatt gtggaagcat tgagcaaatc caaggcagaa 300
ctcatggaaa tcagtgaaga taaaactaaa atcagaaggt ctccaagcaa acccctacct 360
gaagtgactg atgagtataa aaatgatgag agcaagtacg gccctccctg ccccccttgc 420
cctgcccccg agttcctggg cggacccagc gtgttcctgt tcccccccaa gcccaaggac 480
accctgatga tcagccggac ccccgaggtg acctgtgtgg tggtggacgt gtcccaggag 540
gaccccgagg tccagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 600
aagccccggg aggagcagtt caatagcacc taccgggtgg tgtccgtgct gaccgtgctg 660
caccaggact ggctgaacgg caaggaatac aagtgtaagg tgtccaacaa gggcctgccc 720
agcagcatcg agaaaaccat cagcaaggcc aagggccagc ctcgggagcc ccaggtgtac 780
accctgcccc ctagccaaga ggagatgacc aagaatcagg tgtccctgac ctgcctggtg 840
aagggcttct accccagcga catcgccgtg gagtgggaga gcaacggcca gcccgagaac 900
aactacaaga ccaccccccc tgtgctggac agcgacggca gcttcttcct gtacagcagg 960
ctgaccgtgg acaagagccg gtggcaggag ggcaacgtct ttagctgctc cgtgatgcac 1020
gaggccctgc acaaccacta cacccagaag agcctgtccc tgagcctggg caagatgttc 1080
tgggtgctgg tcgtggtggg tggcgtgctg gcctgctaca gcctgctggt gacagtggcc 1140
ttcatcatct tttgggtgag gagcaagcgg agcagaggcg gccacagcga ctacatgaac 1200
atgacccccc ggaggcctgg ccccacccgg aagcactacc agccctacgc ccctcccagg 1260
gacttcgccg cctaccggag caaacggggc agaaagaaac tcctgtatat attcaaacaa 1320
ccatttatga gaccagtaca aactactcaa gaggaagatg gctgtagctg ccgatttcca 1380
gaagaagaag aaggaggatg tgaactgcgg gtgaagttca gccggagcgc cgacgcccct 1440
gcctaccagc agggccagaa ccagctgtac aacgagctga acctgggccg gagggaggag 1500
tacgacgtgc tggacaagcg gagaggccgg gaccctgaga tgggcggcaa gccccggaga 1560
aagaaccctc aggagggcct gtataacgaa ctgcagaaag acaagatggc cgaggcctac 1620
agcgagatcg gcatgaaggg cgagcggcgg aggggcaagg gccacgacgg cctgtaccag 1680
ggcctgagca ccgccaccaa ggatacctac gacgccctgc acatgcaggc cctgcccccc 1740
agatga 1746

Claims (10)

1. A polynucleotide encoding a fusion protein having the amino acid sequence set forth in SEQ ID No. 1.
2. A vector comprising the polynucleotide of claim 1.
3. A genetically engineered NK cell, wherein said NK cell is a mammalian NK cell and wherein said NK cell has expressed on its cell membrane a fusion protein encoded by the polynucleotide of claim 1.
4. The NK cell of claim 3 wherein the NK cell is an NK92 cell.
5. A pharmaceutical composition comprising the NK cells of claim 3, and a pharmaceutically acceptable carrier or excipient.
6. The pharmaceutical composition of claim 5, wherein the pharmaceutical composition is an injection.
7. Use of the polynucleotide of claim 1, the vector of claim 2, or the NK cell of claim 3 for the preparation of a medicament or formulation for the treatment of autoimmune diseases.
8. The use according to claim 7, wherein the autoimmune disease is an autoimmune disease positively associated with La/SSB autoantibodies.
9. The use according to claim 7, wherein the autoimmune disease is selected from the group consisting of: systemic lupus erythematosus, sjogren's syndrome.
10. A method of preparing the NK cell of claim 3, comprising the steps of: transduction of a polynucleotide according to claim 1 or a vector according to claim 2 into NK cells, thereby obtaining the NK cells.
CN201710756982.0A 2017-08-29 2017-08-29 NK (natural killer) cells modified by anti-La/SSB chimeric antigen, preparation method and application thereof Active CN109422814B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710756982.0A CN109422814B (en) 2017-08-29 2017-08-29 NK (natural killer) cells modified by anti-La/SSB chimeric antigen, preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710756982.0A CN109422814B (en) 2017-08-29 2017-08-29 NK (natural killer) cells modified by anti-La/SSB chimeric antigen, preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN109422814A CN109422814A (en) 2019-03-05
CN109422814B true CN109422814B (en) 2024-02-06

Family

ID=65502028

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710756982.0A Active CN109422814B (en) 2017-08-29 2017-08-29 NK (natural killer) cells modified by anti-La/SSB chimeric antigen, preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN109422814B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114304061B (en) * 2020-09-30 2023-08-18 复旦大学 Method for establishing NK/T lymphoma mouse model
CN114921416B (en) * 2022-05-12 2023-05-23 广东普罗凯融生物医药科技有限公司 NK cell and preparation method thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986004093A1 (en) * 1984-12-31 1986-07-17 Duke University Methods and compositions useful in the diagnosis and treatment of autoimmune diseases

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986004093A1 (en) * 1984-12-31 1986-07-17 Duke University Methods and compositions useful in the diagnosis and treatment of autoimmune diseases

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Huimin Meng等.La/SSB chimeric autoantibody receptor modified NK92MI cells for targeted therapy of autoimmune disease.Clinical Immunology.2018,第第192卷卷第40-49页. *
John G. Routsias等.Idiotype–anti-idiotype circuit in non-autoimmune mice after immunization with the epitope and complementary epitope 289–308aa of La/SSB: implications for the maintenance and perpetuation of the anti-La/SSB response.Journal of Autoimmunity.2003,第第21卷卷(第第21卷期),第17-26页. *

Also Published As

Publication number Publication date
CN109422814A (en) 2019-03-05

Similar Documents

Publication Publication Date Title
CN110818802B (en) Chimeric T cell receptor STAR and application thereof
CN109777784B (en) Construction method and application of chimeric antigen receptor vector for enhancing migration to tumor part
US20180072789A1 (en) Methods and compositions for treating cancer
CN106749620B (en) T cell receptor for recognizing MAGE-A1 antigen short peptide
CN109306016B (en) NKG2D-CAR-T cells co-expressing cytokine IL-7 and uses thereof
WO2022032864A1 (en) Chimeric antigen receptor for recognizing fc fragment and application thereof
CN108276495B (en) NK92MI cell and T cell modified by targeted CSF1R chimeric antigen receptor and preparation method and application thereof
CN111065407A (en) Fibronectin binding domain chimeric antigen receptors and methods of use thereof
CN114667294B (en) Antibodies that specifically bind to B cell maturation antigens and uses thereof
WO2021087183A1 (en) Methods and compositions for chimeric antigen receptor targeting cancer cells
CN109575121B (en) T cell receptor recognizing AFP antigen short peptides
CN109422814B (en) NK (natural killer) cells modified by anti-La/SSB chimeric antigen, preparation method and application thereof
CN109777783B (en) CXCR 2-expressing CAR-NK92 cell, preparation method and application thereof
WO2020248486A1 (en) Method for preparing car-t that uses tcm as main effective ingredient and use thereof
CN109867725B (en) PD-1-Fc fusion protein and preparation method and application thereof
CN113321726A (en) T cell receptor for identifying HPV
CN116814664B (en) Preparation and application of CEA chimeric antigen receptor T cells for expanding tumor recognition epitope
CN109251244B (en) TCR (T cell receptor) for recognizing LMP1 antigen derived from EBV (Epstein-Barr Virus) membrane protein
TW202144401A (en) T cell receptor recognizing AFP
TW202144399A (en) T cell receptor for identifying HPV antigen and coding sequence thereof
CN109251243B (en) T cell receptor for recognizing SAGE1 antigen and nucleic acid for encoding receptor
CN105985444B (en) Chimeric antigen receptor, and method and application for rapidly constructing chimeric antigen receptor
CN108659114B (en) TCR for recognizing PASD1 antigen short peptide
CN113105554A (en) Anti-tumor fusion protein and preparation method and application thereof
CN113088495A (en) Engineered T cells, their preparation and use

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant