CN109422814A

CN109422814A - A kind of NK cell, preparation method and its application of anti-La/SSB mosaic antigen modification

Info

Publication number: CN109422814A
Application number: CN201710756982.0A
Authority: CN
Inventors: 杨林; 金泽明; 孟会敏
Original assignee: PERSONGEN BIOMEDICINE (SUZHOU) CO Ltd
Current assignee: PERSONGEN BIOMEDICINE (SUZHOU) CO Ltd
Priority date: 2017-08-29
Filing date: 2017-08-29
Publication date: 2019-03-05
Anticipated expiration: 2037-08-29
Also published as: CN109422814B

Abstract

The present invention relates to NK cell, preparation method and its applications of a kind of anti-La/SSB mosaic antigen modification.Specifically, the present invention provides a kind of fusion proteins that anti-La/SSB mosaic antigen is modified and the NK cell for expressing the fusion protein, the fusion protein to have structure shown in the Formulas I of optimization: X₁‑X₂‑L₁‑X₃‑X₄‑X₅(I), wherein each element as used in the description.The experimental results showed that, the autoimmune disease of specific NK cell (such as LaA-CAARNK92MI cell) the energy targeted therapy La/SSB autoantibodies provided by the present invention modified through the fusion protein, and have many advantages, such as that good effect, Small side effects, production cost are low.

Description

anti-La/SSB chimera antigen-modified NK cell, and preparation method and application thereof

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to an anti-La/SSB chimeric antigen modified NK cell, a preparation method and application thereof.

Background

Autoimmune diseases refer to diseases caused by the damage of self tissues caused by the immune reaction of the body to self antigens, and the most remarkable characteristic of the autoimmune diseases is that B cells overreact, generate high-titer autoantibodies and systemic inflammatory reactions, and finally cause the pathological changes of various organs. Recently, it is becoming increasingly appreciated that B cells play an increasingly broader role in the development of autoimmune diseases, which provides an exciting prospect for targeted treatment of autoimmune diseases by B cells. Among them, CD20 targeted B cell depletion experiments showed that 95% of Pemphigus (PV) patients develop short-term disease regression, but 81% relapse and develop fatal infection. After depletion of CD 20-targeted B cells, there is a significant decrease in autoantibody titers in the patient's serum, suggesting that in pemphigus disease, short-lived plasma cells are the source of autoantibodies and targeting CD 20-positive memory B cell precursors indirectly kills autoantibody-secreting plasma cells. In order to be able to treat pemphigus without triggering extensive immunosuppression, the anti-Dsg 3B cell receptor was fused as an extracellular fragment to the corresponding signaling region, and the anti-Dsg3 CAAR-T constructed gave better experimental results in the pemphigus mouse model.

However, the etiology of some other autoimmune diseases (e.g., lupus erythematosus) is complex, and the autoimmune disease patient's own immune system is disturbed, T cell dysfunction, Th cell control tolerance, B cell hyperreactivity, and autoimmune potential cells (PALs) are mostly in an unactivated or actively blocked state. Autologous Chimeric Antigen Receptor (CAR) T cell therapy is difficult and less than ideal, and allogeneic CAR-T cell transplantation carries the risk of graft-versus-host reactions.

Therefore, there is an urgent need in the art to develop a new strategy for targeted therapy of autoimmune diseases, which can treat autoimmune diseases without inducing extensive immunosuppression, and has low risk of graft-versus-host reaction and low production cost.

Disclosure of Invention

The invention aims to provide a fusion protein modified by anti-La/SSB chimeric antigen and an NK cell expressing the fusion protein, which can treat autoimmune diseases in a targeted manner, and simultaneously do not cause wide immunosuppression, and have small graft-versus-host reaction risk and low production cost.

In a first aspect of the present invention, there is provided a fusion protein having the structure of formula I:

X₁-X₂-L₁-X₃-X₄-X₅(I)，

wherein,

X₁is a null or signal peptide sequence;

X₂is a LaA peptide;

L₁is a null or a linker peptide sequence;

X₃is a transmembrane domain;

X₄is a co-stimulation element;

X₅is a cytoplasmic signaling sequenceColumn CD3 ζ;

"-" denotes a linker peptide or peptide bond linking the above elements.

In another preferred embodiment, X₃Is the transmembrane domain of CD 28.

In another preferred embodiment, X₄Selected from the group consisting of: co-stimulatory element 4-1BB, co-stimulatory element CD28, or a combination thereof.

In another preferred embodiment, X₃And X₄Collectively consisting of CD28 containing the transmembrane domain and 4-1 BB.

In another preferred embodiment, L₁Is an Fc element.

In another preferred embodiment, the Fc element is an Fc element of a mammalian immunoglobulin, preferably an Fc element of a human immunoglobulin.

In another preferred embodiment, the Fc element is an IgG, IgA, IgM, IgD, IgE, preferably an IgG, more preferably an IgG1 or IgG 2.

In another preferred embodiment, the length of the Fc element is 200-250 amino acids, preferably 220-240 amino acids, and more preferably about 230 amino acids.

In another preferred embodiment, the Fc element has the amino acid sequence as shown in SEQ ID NO. 1 at positions 130-359.

In another preferred embodiment, the amino acid sequence of the Fc element is as shown in SEQ ID NO. 1 at positions 130-359.

In another preferred embodiment, said polypeptide element X₁Selected from the group consisting of:

(A) a polypeptide having an amino acid sequence as shown in positions 1-22 of SEQ ID No. 1;

(B) a polypeptide having at least 80% homology (preferably at least 90% homology; etc. preferably at least 95% homology; more preferably at least 98% homology; most preferably at least 99% homology) with the amino acid sequence shown at positions 1-22 in SEQ ID No. 1;

(C) 1, and 1-22 amino acid sequence is substituted, deleted or added by 1-5 amino acid residues to form derivative polypeptide.

In another preferred embodiment, said polypeptide element X₂Selected from the group consisting of:

(A) a polypeptide having the amino acid sequence shown in positions 23-129 of SEQ ID No. 1;

(B) a polypeptide having at least 80% homology (preferably at least 90% homology; etc. preferably at least 95% homology; more preferably at least 98% homology; most preferably at least 99% homology) with the amino acid sequence shown at positions 23-129 in SEQ ID No. 1;

(C) 1, and 1-129 amino acid sequence is substituted, deleted or added by 1-5 amino acid residues to form derivative polypeptide.

In another preferred embodiment, the polypeptide element L₁Selected from the group consisting of:

(A) a polypeptide having the amino acid sequence as shown in SEQ ID NO. 1 at positions 130-359;

(B) a polypeptide having a homology of 80% or more (preferably 90% or more; etc., preferably 95% or more; more preferably 98% or more; most preferably 99% or more) with the amino acid sequence shown at position 130-359 in SEQ ID No. 1;

(C) 1, and 1, the amino acid sequence shown in the 130-359 position of the sequence is substituted, deleted or added by 1-5 amino acid residues to form the derivative polypeptide.

In another preferred embodiment, said polypeptide element X₃Selected from the group consisting of:

(A) a polypeptide having the amino acid sequence shown in positions 360-427 of SEQ ID NO. 1;

(B) a polypeptide having at least 80% homology (preferably at least 90% homology; etc. preferably at least 95% homology; more preferably at least 98% homology; most preferably at least 99% homology) with the amino acid sequence shown in SEQ ID NO. 1 at position 360-427;

(C) a derivative polypeptide formed by substituting, deleting or adding 1-5 amino acid residues of the amino acid sequence shown in the position 360-427 in the SEQ ID NO. 1.

In another preferred embodiment, said polypeptide element X₄Selected from the group consisting of:

(A) a polypeptide having the amino acid sequence shown in positions 428 and 469 of SEQ ID NO. 1;

(B) a polypeptide having a homology of 80% or more (preferably 90% or more; etc., preferably 95% or more; more preferably 98% or more; most preferably 99% or more) with the amino acid sequence shown at position 428-469 in SEQ ID No. 1;

(C) 1, the derivative polypeptide formed by substituting, deleting or adding 1-5 amino acid residues of the amino acid sequence shown in the 428-th and 469 th positions in the SEQ ID NO. 1.

In another preferred embodiment, said polypeptide element X₃And X₄Consists of the amino acid sequences shown in the 360-th and 469-th positions in SEQ ID NO. 1.

In another preferred embodiment, said polypeptide element X₃And X₄Amino acid sequences which share at least 80% homology (preferably at least 90% homology; etc. preferably at least 95% homology; more preferably at least 98% homology; most preferably at least 99% homology) with the amino acid sequence shown in SEQ ID No. 1 at position 360-469.

In another preferred embodiment, said polypeptide element X₃And X₄The polypeptides are formed by substituting, deleting or adding 1-5 amino acid residues of the amino acid sequences shown in the 360-fold 469 site in the SEQ ID NO. 1.

In another preferred embodiment, the polypeptideElement X₅Selected from the group consisting of:

(A) a polypeptide having the amino acid sequence as shown in position 470-581 of SEQ ID NO. 1;

(B) a polypeptide having at least 80% homology (preferably at least 90% homology; etc. preferably at least 95% homology; more preferably at least 98% homology; most preferably at least 99% homology) with the amino acid sequence shown at position 470-581 in SEQ ID NO. 1;

(C) 1, the derivative polypeptide formed by substituting, deleting or adding 1-5 amino acid residues of the amino acid sequence shown in the 470-581 position in the SEQ ID NO. 1.

In another preferred embodiment, the fusion protein has an amino acid sequence as shown in SEQ ID No. 1.

In another preferred embodiment, the amino acid sequence of the fusion protein is shown in SEQ ID No. 1.

In another preferred embodiment, the fusion protein is a recombinant protein.

In another preferred embodiment, the fusion protein is capable of specifically binding to LaA-BCR protein.

In another preferred embodiment, the fusion protein is capable of specifically binding to an anti-La/SSB antibody.

In a second aspect of the invention, there is provided a polynucleotide encoding a fusion protein according to the first aspect of the invention.

In another preferred embodiment, the polynucleotide is selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide as set forth in SEQ ID No. 1;

(b) a polynucleotide having a sequence as set forth in SEQ ID No. 2;

(c) a polynucleotide having a nucleotide sequence having a homology of 75% or more (preferably 80% or more) to the sequence of (b);

(d) a polynucleotide in which 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides are truncated or added to the 5 'end and/or the 3' end of the polynucleotide shown in (b);

(e) a polynucleotide complementary to any one of the polynucleotides of (a) - (d).

In another preferred embodiment, the polynucleotide sequence is as shown in SEQ ID NO. 2.

In a third aspect of the invention, there is provided a vector comprising a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the vector is constructed from the pCDH-CMV-MCS-EF1-CopPuro plasmid.

In another preferred embodiment, the vector is a viral vector.

In another preferred embodiment, the vector is a lentiviral vector.

In a fourth aspect of the invention, there is provided a host cell expressing a fusion protein according to the first aspect of the invention; and/or

(ii) the host cell genome incorporates an exogenous polynucleotide according to the second aspect of the invention; and/or

The host cell comprises a vector according to the third aspect of the invention.

In another preferred embodiment, the cell is a prokaryotic cell or a eukaryotic cell.

In another preferred embodiment, the host cell is a mammalian cell.

In another preferred embodiment, the host cell is a human cell.

In another preferred embodiment, the host cell is an NK cell, a T cell.

In another preferred embodiment, the host cell is an NK92 cell.

In another preferred embodiment, the host cell is an NK92MI cell.

In a fifth aspect of the present invention, there is provided a genetically engineered NK cell, wherein the NK cell is a mammalian NK cell and the fusion protein of the first aspect of the present invention is expressed on the cell membrane of the NK cell.

In another preferred embodiment, the NK cells are ex vivo.

In another preferred embodiment, the NK cells are autologous or allogeneic.

In another preferred embodiment, the NK cells are from primates.

In another preferred embodiment, the NK cell is a human cell.

In another preferred example, the NK cells are NK92 cells.

In another preferred example, the NK cells are NK92MI cells.

In a sixth aspect of the present invention, there is provided a pharmaceutical composition comprising: a fusion protein according to the first aspect of the invention, a polynucleotide according to the second aspect of the invention, a vector according to the third aspect of the invention or an NK cell according to the fifth aspect of the invention, and a pharmaceutically acceptable carrier or excipient.

In another preferred embodiment, the pharmaceutical composition is a liquid formulation.

In another preferred embodiment, the pharmaceutical composition is an injection.

In another preferred embodiment, said NK cell concentration in said pharmaceutical composition is 1X 10⁵－1×10⁸Individual cells/ml, preferably 1X 10⁶－1×10⁷Individual cells/ml.

In a seventh aspect of the invention, there is provided a fusion protein according to the first aspect of the invention, a polynucleotide according to the second aspect of the invention, a vector according to the third aspect of the invention, or an NK cell according to the fifth aspect of the invention for use in the preparation of a medicament or formulation for the treatment of an autoimmune disease.

In another preferred example, the autoimmune disease is an autoimmune disease positively associated with La/SSB autoantibodies.

In another preferred embodiment, the autoimmune disease is selected from the group consisting of: systemic lupus erythematosus, sjogren's syndrome.

In a seventh aspect of the present invention, there is provided a method for producing the NK cell of the fifth aspect of the present invention, the method comprising the steps of: transferring the polynucleotide according to the second aspect of the present invention or the vector according to the third aspect of the present invention into an NK cell, thereby obtaining the NK cell.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows the purification of LaA-BCR protein and its affinity assay for LaA antigen. Wherein, FIG. 1A is LaA-BCR-pfuse-hIgG1-FC eukaryotic expression vector; FIG. 1B is a LaA-pET28a (+) prokaryotic expression vector; FIG. 1C is a SDS-PAGE electrophoresis of purified LaA; FIG. 1D is a SDS-PAGE electrophoresis of purified LaA-BCR; FIG. 1E is a Western blot analysis of the affinity of LaA-BCR for LaA protein; FIG. 1F is an ELISA analysis of LaA peptide by LaA-BCR.

FIG. 2 shows the structural features of LaA-CAAR NK92MI cells and their functional validation. FIG. 2A is a schematic structural diagram of LaA-CAAR; FIG. 2B shows the expression of LaA-CAAR in NK92MI cells detected by western blot after NK92MI cells were stably transfected by LaA-CAAR lentivirus; FIG. 2C is a flow cytometry analysis of LaA-CAAR expression in NK92MI cells; FIG. 2D is a mean fluorescence intensity analysis of NK92MI cells stably transfected with LaA-CAAR structures.

FIG. 3 shows functional validation of LaA-BCR-Jurkat, LaA-BCR-Romas, and LaA-BCR-Maver-1 cells. FIG. 3A is a schematic structural diagram of LaA-BCR; FIG. 3B is a flow cytometry analysis of LaA-BCR expression on Jurkat, Romas, and Maver-1 cells, respectively; FIGS. 3C, D, E are mean fluorescence intensity analyses of Jurkat, Romas and Maver-1 cells stably transfected with LaA-BCR construct, respectively.

FIG. 4 shows flow cytometry analysis of CD19 and CD56 expression in NK92MI, LaA-CAAR NK92MI, Romas, LaA-BCR-Romas, Maver-1, LaA-BCR-Maver-1, and CD3 and CD56 in Jurkat, LaA-BCR-Jurkat cells.

FIG. 5 shows that LaA-CAAR-NK92MI cells can specifically eliminate the LaA-BCR stably expressed lymphoma cell line. Fig. 5A, C show the toxic effect of NK92MI and LaA-CAAR NK92MI on Romas and LaA-BCR-Romas cells at E: T ═ 1: 1; fig. 5B, D shows the toxic effect of NK92MI and LaA-CAAR NK92MI on Romas and LaA-BCR-Romas cells at E: T ═ 2: 1; fig. 5E, G shows the toxic effect of NK92MI and LaA-CAAR NK92MI on Maver-1 and LaA-BCR-Maver-1 cells at E: T ═ 1: 1; fig. 5F, H shows the toxic effect of NK92MI and LaA-CAAR NK92MI on Maver-1 and LaA-BCR-Maver-1 cells at E: T ═ 2: 1.

FIG. 6 shows that LaA-CAAR-NK92MI cells can specifically eliminate LaA-BCR stably expressed T cell acute lymphoblastic leukemia cells. Fig. 6A, C show the toxic effect of NK92MI and LaA-CAAR NK92MI on Jurkat and LaA-BCR-Jurkat cells at E: T ═ 1: 1; fig. 6B, D show the toxic effect of NK92MI and LaA-CAAR NK92MI on Jurkat and LaA-BCR-Jurkat cells at E: T ═ 2: 1.

FIG. 7 shows the proliferative response of NK92MI cells to LaA-BCR-Jurkat, LaA-BCR-Romas, and LaA-BCR-Maver-1 cells. Panel A, B show that Jurkat, LaA-BCR-Jurkat cells were unable to stimulate proliferation of NK92MI and LaA-CAAR-NK92MI cells; panel C, D shows that Romas, LaA-BCR-Romas cells failed to stimulate proliferation of NK92MI and LaA-CAAR-NK92MI cells; panel E, F shows that Maver-1, LaA-BCR-Maver-1 cells failed to stimulate proliferation of NK92MI and LaA-CAAR-NK92MI cells.

FIG. 8 shows that LaA-BCR expression was detected by flow cytometry in blood B cells of patients with autoimmune diseases.

FIG. 9 shows a whole blood B cell depletion experiment of a sample from a patient with autoimmune disease. FIG. A shows the whole blood B cell depletion protocol; panel B shows that NK92MI and LaA-CAAR NK92MI cells did not kill T cells in autoimmune patients; panel C shows no killing effect of NK92MI on B cells of autoimmune patients; panel D shows that LaA-CAARNK92MI cells had targeted killing of B cells in patients with autoimmune disease.

FIG. 10 shows that NK92MI and LaA-CAAR NK92MI cells do not kill T and B cells in normal healthy humans. FIG. A shows the survival rate of T and B cells measured after the flow cytometry analysis of healthy human whole blood incubated with NK92MI and LaA-CAAR NK92MI cells for 24 h; panel B shows that NK92MI and LaA-CAAR NK92MI cells did not kill normal T cells; panel C shows that NK92MI and LaA-CAAR NK92MI cells did not kill normal B cells.

Detailed Description

The invention unexpectedly obtains a fusion protein modified by an anti-La/SSB chimeric antigen and NK cells expressing the fusion protein through extensive and intensive research and extensive screening, wherein the fusion protein has an optimized structure shown in formula I. Experimental results show that the specific NK cell (such as LaA-CAARNK92MI cell) modified by the fusion protein provided by the invention can be used for targeted therapy of La/SSB autoantibody positive autoimmune diseases, and has the advantages of good curative effect, small side effect, low production cost and the like. The present invention has been completed based on this finding.

In autoimmune diseases with strong positive autoantibody La/SSB, the memory B cells with overreaction and pathogenicity express anti-La/SSB cell receptors on the surface. Therefore, the La/SSB is used as the extracellular region of the chimeric immune receptor, the NK cell is used as the effector cell, cytotoxicity is targeted to the B cell (La/SSB-BCR-B) specifically expressing the anti-La/SSB cell receptor, the immune system of the whole body cannot be inhibited, a series of side reactions are avoided, and a powerful means is provided for targeted treatment of the autoimmune disease with the strong positive La/SSB autoantibody. The targeted therapy strategy directly eliminates membrane surface expressed anti-La/SSB cell receptor hyperreactive B cells and memory B cells, and indirectly eliminates short-lived plasma cells secreting pathogenic La/SSB autoantibodies.

In the invention, the B cell specific receptor (LaA-BCR) for resisting LaA is taken as a target, the NK cell modified by the chimeric antigen gene is used for targeted therapy of the La/SSB autoimmune disease with positive autoantibodies, the NK cell is combined with the B cell specific receptor, a new strategy is provided for exploring targeted therapy of the autoimmune disease, and a new effective method and a preparation are provided for clinical application of CAR-NK for therapy of the autoimmune disease.

Term(s) for

La/SSB

The La/SSB gene is a housekeeping gene, is expressed in nucleus, and under the action of some physical and chemical factors, La/SSB antigen is released and recognized by B cells, so that high-titer antibodies aiming at La/SSB self-antigen are generated, and the antibodies are deposited on blood vessels and organs of a body to cause damage to the body. The La/SSB autoantigen is divided into three immune regions: LaA (1-107aa), LaC (111-242aa) and LaL2/3(346-408 aa). Autoantibodies directed against the conserved airfoil helical determinant LaA are of great significance, appearing almost one hundred percent in precipitator positive serum and in early stages of anti-La/SSB autoantibodies, with some diagnostic effect prior to the appearance of autoimmune disease. In addition, after the La/SSB autoantigen is activated, specific B cell epitopes are only expressed on over-reacted B cells and memory B cells, thereby avoiding the possibility of off-target toxicity.

LaA

The LaA region is the most functional region of La/SSB. The invention takes an LaA antigen region as an extracellular segment, is connected with a series of functional regions (FC, CD28, 4-1BB and CD3 zeta) at the back, constructs a structure (CAAR) which can specifically recognize pathogenic B cells, and finally constructs the structure on NK92MI cells, thereby obtaining LaA-CAAR NK92MI effector cells which can target the pathogenic B cells (LaA-BCR-B cells).

La/SSB antibodies

Autoantibodies against La/SSB are present in high titers in the serum of some autoimmune diseases, especially in the serum of patients with Systemic Lupus Erythematosus (SLE) and Sjogren Syndrome (SS), and are diagnostic marker antibodies to SS, with 97% of the patients who are positive for La/SSB antibodies showing Sjogren syndrome.

Studies have shown that anti-La/SSB antibody production precedes the onset and diagnosis of SLE symptoms and is also an important participant in the pathogenesis of SLE. Targeted elimination of B cells and memory B cells that are overreactive against La/SSB should be able to treat and alleviate symptoms of autoimmune diseases that are strongly positive for La/SSB autoantibodies, without the risk of immunosuppression of the body.

NK cells

Natural Killer (NK) cells are a major class of immune effector cells that protect the body from viral infection and tumor cell invasion through non-antigen specific pathways. In autoimmune diseases, NK cell imbalance (depletion) is an important mechanism leading to the pathogenesis of autoimmune diseases, and NK cell depletion leads to a decrease in its function of non-specifically inhibiting B cell secretion of antibodies. However, NK92 cells are the only cell line approved by FDA clinical test at present, the cytotoxic ability is strong, the survival time after killing tumor cells is short, the cells are easy to expand in vitro, and most of patients receiving treatment do not reject NK92-MI cells and have no risk of graft-versus-host reaction. In the present invention, NK cells are selected as effector cells.

NK92MI cell

Novel functions including the ability to specifically recognize tumor antigens and enhanced anti-tumor cytotoxic effects may be obtained by genetically modified NK92MI (CAAR-NK92MI) cells. NK92MI cells have potent cytotoxic effects against a wide variety of tumors, such as leukemia, lymphoma, myeloma, and some solid tumors. Some clinical trials have shown that high doses of NK92MI cell transfusions are also of great safety.

CAAR-NK92MI also has advantages over autologous CAR-T cells, such as: (1) directly kills tumor cells by releasing perforin and granzyme, but has no killing effect on normal cells of an organism; (2) they release very small amounts of cytokines and thus reduce the risk of cytokine storm; (3) is easy to be amplified in vitro and can be developed into ready-made products. In addition, similar to CAR-T cell therapy, CAR-NK92 or CAR-NK92MI did not elicit immune tolerance.

Fc fragment

As used herein, the terms "Fc fragment", "Fc element" have the same meaning, without particular limitation, as the connecting peptide fragment (or hinge domain) of the fusion protein of the invention. In the present invention, the Fc fragment may be an Fc fragment of a mammalian immunoglobulin, preferably an Fc fragment of a human immunoglobulin. In a preferred embodiment, the Fc fragment is an Fc fragment of IgG, IgA, IgM, IgD, IgE, preferably an Fc fragment of IgG, more preferably an Fc fragment of IgG1 or IgG 2. The length of the Fc fragment is 200-250 amino acids, preferably 220-240 amino acids, and more preferably about 230 amino acids. In a preferred embodiment of the present invention, the Fc fragment has the amino acid sequence as shown in SEQ ID NO. 1 at positions 130-359. In another preferred embodiment, the amino acid sequence of the Fc fragment is shown in SEQ ID NO. 1 at positions 130-359.

Fusion proteins

As used herein, the terms "LaA-CAAR", "fusion protein of the invention", "active polypeptide" and "polypeptide of the invention" have the same meaning and all have the structure described in the first aspect of the invention. The fusion protein of the invention comprises: a series of signaling regions, leader sequence, LaA peptide capable of specific binding to LaA-BCR, hinge domain (Fc), CD28 transmembrane domain TM, two costimulatory domains (CD28 and 4-1BB) and CD3 ζ, which are defined as LaA-CAAR.

The fusion protein of the invention has the following characteristics:

a) after the fusion protein is expressed, the fusion protein can penetrate through a cell membrane and be positioned on the cell membrane to form a membrane protein which exposes an LaA element to the outside of the cell. In addition, the fusion protein of the present invention also has a costimulatory molecule (or element) and CD3 zeta, which are located intracellularly. In addition, the fusion protein of the present invention may also contain an optional signal peptide, a linker peptide element (linker), or other elements.

b) The fusion protein of the invention is capable of binding very efficiently to LaA-BCR or LaA-TCR proteins on the surface of B cells (or other cells such as T cells) in patients with autoimmune diseases (e.g., humans).

c) The fusion protein can effectively neutralize, inhibit and eliminate the anti-La/SSB antibody in patients with autoimmune diseases.

The term "fusion protein" as used herein also includes variants of the sequence of SEQ ID NO. 1 having the above-described activity. These variants include (but are not limited to): deletion, insertion and/or substitution of 1 to 3 (usually 1 to 2, more preferably 1) amino acids, and addition or deletion of one or several (usually up to 3, preferably up to 2, more preferably up to 1) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, the addition or deletion of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the structure and function of the protein. In addition, the term also includes monomeric and multimeric forms of the polypeptides of the invention. The term also includes linear as well as non-linear polypeptides (e.g., cyclic peptides).

The invention also includes active fragments, derivatives and analogs of the above fusion proteins. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that substantially retains the function or activity of a fusion protein of the invention. The polypeptide fragment, derivative or analogue of the present invention may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide in which an antigenic peptide is fused to another compound (such as a compound that increases the half-life of the polypeptide, e.g., polyethylene glycol), or (iv) a polypeptide in which an additional amino acid sequence is fused to the polypeptide sequence (a fusion protein in which a tag sequence such as a leader sequence, a secretory sequence or 6His is fused). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein.

A preferred class of reactive derivatives refers to polypeptides formed by the replacement of up to 3, preferably up to 2, more preferably up to 1 amino acid with an amino acid of similar or analogous nature as compared to the amino acid sequence of formula Ia or Ib. These conservative variants are preferably produced by amino acid substitutions according to Table A.

TABLE A

Initial residue(s)	Representative substitutions	Preferred substitutions
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The analogs can differ from the polypeptide set forth in SEQ ID No. 1 by amino acid sequence differences, by modifications that do not affect the sequence, or by both.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications in the synthesis and processing of the polypeptide or in further processing steps. Such modification may be accomplished by exposing the polypeptide to an enzyme that performs glycosylation, such as a mammalian glycosylase or deglycosylase. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides modified to increase their resistance to proteolysis or to optimize solubility.

In one embodiment of the invention, the amino acid sequence of the fusion protein is shown in SEQ ID No. 1.

MLLLVTSLLLCELPHPAFLLIPMAENGDNEKMAALEAKICHQIEYYFGDFNLPRDKFLKEQIKLDEGWVPLEIMIKFNRLNRLTTDFNVIVEALSKSKAELMEISEDKTKIRRSPSKPLPEVTDEYKNDESKYGPPCPPCPAPEFLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSQEDPEVQFNWYVDGVEVHNAKTKPREEQFNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKGLPSSIEKTISKAKGQPREPQVYTLPPSQEEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSRLTVDKSRWQEGNVFSCSVMHEALHNHYTQKSLSLSLGKMFWVLVVVGGVLACYSLLVTVAFIIFWVRSKRSRGGHSDYMNMTPRRPGPTRKHYQPYAPPRDFAAYRSKRGRKKLLYIFKQPFMRPVQTTQEEDGCSCRFPEEEEGGCELRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPR(SEQ ID No.:1)。

Wherein, the 1 st-22 nd position in SEQ ID No. 1 is a signal peptide; LaA at positions 23-129; the 130 th and 359 th positions are connecting peptide (Fc); position 360-427 is transmembrane domain (CD 28); position 428-469 is a costimulatory element (4-1 BB); 470-581 is CD3 ζ.

Coding sequence

The invention also relates to polynucleotides encoding the fusion proteins according to the invention.

The polynucleotide of the present invention may be in the form of DNA or RNA. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence encoding the polypeptide shown in SEQ ID No. 1 or a degenerate variant. As used herein, "degenerate variant" refers in the present invention to nucleic acid sequences which encode a polypeptide having the sequence shown in SEQ ID No. 1, but differ in the sequence of the corresponding coding region.

In a preferred embodiment of the invention, the sequence of the polynucleotide is as shown in SEQ ID No. 2.

The full-length nucleotide sequence or its fragment of the present invention can be obtained by PCR amplification, recombination, or artificial synthesis. At present, DNA sequences encoding the polypeptides of the present invention (or fragments or derivatives thereof) have been obtained entirely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art.

The invention also relates to vectors comprising the polynucleotides of the invention, and to genetically engineered host cells with the vector or polypeptide coding sequences of the invention. The polynucleotide, vector or host cell may be isolated.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in the natural state in the living cell is not isolated or purified, but the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in the natural state.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand.

The present invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the present invention. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polynucleotide encoding the fusion protein of the invention.

The full-length nucleotide sequence of the polypeptide of the present invention or a fragment thereof can be obtained by PCR amplification, recombination, or artificial synthesis. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and the sequences can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

In one embodiment of the invention, the polynucleotide sequence encoding the fusion protein is shown in SEQ ID No. 2.

ATGCTGCTCCTGGTGACCTCCCTGCTGCTGTGTGAACTCCCCCACCCCGCTTTCCTGCTGATCCCCATGGCTGAAAATGGTGATAATGAAAAGATGGCTGCCCTGGAGGCCAAAATCTGTCATCAAATTGAGTATTATTTTGGCGACTTCAATTTGCCACGGGACAAGTTTCTAAAGGAACAGATAAAACTGGATGAAGGCTGGGTACCTTTGGAGATAATGATAAAATTCAACAGGTTGAACCGTCTAACAACAGACTTTAATGTAATTGTGGAAGCATTGAGCAAATCCAAGGCAGAACTCATGGAAATCAGTGAAGATAAAACTAAAATCAGAAGGTCTCCAAGCAAACCCCTACCTGAAGTGACTGATGAGTATAAAAATGATGAGAGCAAGTACGGCCCTCCCTGCCCCCCTTGCCCTGCCCCCGAGTTCCTGGGCGGACCCAGCGTGTTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCCGGACCCCCGAGGTGACCTGTGTGGTGGTGGACGTGTCCCAGGAGGACCCCGAGGTCCAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCCCGGGAGGAGCAGTTCAATAGCACCTACCGGGTGGTGTCCGTGCTGACCGTGCTGCACCAGGACTGGCTGAACGGCAAGGAATACAAGTGTAAGGTGTCCAACAAGGGCCTGCCCAGCAGCATCGAGAAAACCATCAGCAAGGCCAAGGGCCAGCCTCGGGAGCCCCAGGTGTACACCCTGCCCCCTAGCCAAGAGGAGATGACCAAGAATCAGGTGTCCCTGACCTGCCTGGTGAAGGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCTGTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAGGCTGACCGTGGACAAGAGCCGGTGGCAGGAGGGCAACGTCTTTAGCTGCTCCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGAGCCTGTCCCTGAGCCTGGGCAAGATGTTCTGGGTGCTGGTCGTGGTGGGTGGCGTGCTGGCCTGCTACAGCCTGCTGGTGACAGTGGCCTTCATCATCTTTTGGGTGAGGAGCAAGCGGAGCAGAGGCGGCCACAGCGACTACATGAACATGACCCCCCGGAGGCCTGGCCCCACCCGGAAGCACTACCAGCCCTACGCCCCTCCCAGGGACTTCGCCGCCTACCGGAGCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGCGGGTGAAGTTCAGCCGGAGCGCCGACGCCCCTGCCTACCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACCTGGGCCGGAGGGAGGAGTACGACGTGCTGGACAAGCGGAGAGGCCGGGACCCTGAGATGGGCGGCAAGCCCCGGAGAAAGAACCCTCAGGAGGGCCTGTATAACGAACTGCAGAAAGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGCGGCGGAGGGGCAAGGGCCACGACGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGATACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCCAGATGA(SEQ ID No.:2)。

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

A method of amplifying DNA/RNA using PCR technology is preferably used to obtain the gene of the present invention. The primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The invention also relates to a vector comprising the polynucleotide of the invention, as well as a genetically engineered host cell with the vector or protein coding sequence of the invention, and a method for expressing the fusion protein of the invention on the NK cells by recombinant techniques.

NK cells expressing the fusion protein of the present invention can be obtained by using the polynucleotide sequence of the present invention by a conventional recombinant DNA technique. Generally comprising the steps of: transferring the polynucleotide according to the second aspect of the present invention or the vector according to the third aspect of the present invention into an NK cell, thereby obtaining the NK cell.

Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequences encoding the enzymes of the invention and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: bacterial cells of the genera escherichia coli, bacillus subtilis, streptomyces; fungal cells such as pichia, saccharomyces cerevisiae cells; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, NS0, COS7, or 293 cells. In a preferred embodiment of the invention, the NK cell is selected as a host cell.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The obtained transformant can be cultured by a conventional method to express the protein encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The protein in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

Preparation method

The fusion protein (polypeptide) of the present invention may be a recombinant polypeptide or a synthetic polypeptide. The polypeptides of the invention may be chemically synthesized, or recombinant. Accordingly, the polypeptides of the present invention can be artificially synthesized by a conventional method or can be produced by a recombinant method. The present invention uses conventional recombinant DNA techniques to express or produce the fusion proteins of the present invention using the polynucleotides of the present invention.

The present invention provides a method for preparing LaA-CAAR NK cells, the method comprising introducing the polynucleotide or vector of the present invention into NK cells, thereby obtaining the LaA-CAAR NK cells.

Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a fusion protein of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) a host cell cultured in a suitable medium.

Pharmaceutical compositions and methods of administration

The LaA-CAAR NK cell can eliminate the pathogenic B cell (memory B cell) with LaA specific BCR in a targeted manner, indirectly inhibits the plasma cell from secreting anti-La/SSB autoantibody, and accordingly achieves a treatment effect.

In another aspect, the invention provides a pharmaceutical (including vaccine) composition comprising (a) a safe and effective amount of the LaA-CAAR NK cells of the invention; and (b) a pharmaceutically acceptable carrier or excipient.

The "active ingredient" in the pharmaceutical composition of the present invention refers to LaA-CAAR NK cells of the present invention.

The "active ingredients" and pharmaceutical compositions of the invention are useful for treating autoimmune diseases.

"safe and effective amount" means: the amount of active ingredient is sufficient to significantly improve the condition without causing serious side effects.

Typically, the pharmaceutical composition contains 1-2000mg of active ingredient per dose, more preferably, 10-200mg of active ingredient per dose. Preferably, the dose is a tablet or an injection.

"pharmaceutically acceptable carrier" refers to: one or more compatible solid or liquid fillers or gel substances which are suitable for human use and must be of sufficient purity and sufficiently low toxicity.

By "compatible" is meant herein that the components of the composition are capable of being combined with the active ingredients of the present invention and with each other without significantly diminishing the efficacy of the active ingredient.

Examples of pharmaceutically acceptable carrier moieties are cellulose and its derivatives (e.g. sodium carboxymethylcellulose, sodium ethylcellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (e.g. stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g. soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (e.g. propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiersWetting agents (such as sodium lauryl sulfate), coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, and the like.

The mode of administration of the active ingredient or pharmaceutical composition of the present invention is not particularly limited, and representative modes of administration include, but are not limited to: oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous), and the like.

Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules.

In these solid dosage forms, the active ingredient is mixed with at least one conventional inert excipient or carrier, such as sodium citrate or dicalcium phosphate, or with one or more of the following:

(a) fillers or extenders, for example, starch, lactose, sucrose, glucose, mannitol and silicic acid; (b) binders, for example, hydroxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and acacia; (c) humectants, for example, glycerol; (d) disintegrating agents, for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) slow solvents, such as paraffin; (f) absorption accelerators, e.g., quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glycerol monostearate; (h) adsorbents, for example, kaolin; and/or (i) a lubricant, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, or mixtures thereof.

In capsules, tablets and pills, the dosage forms may also comprise buffering agents.

The solid dosage forms may also be prepared using coatings and shells, such as enteric coatings and other materials well known in the art. They may contain opacifying agents and the release of the active ingredient in such compositions may be delayed in a certain portion of the digestive tract. Examples of embedding components which can be used are polymeric substances and wax-like substances.

Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly employed in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butylene glycol, dimethylformamide and oils, especially cottonseed, groundnut, corn germ, olive, castor and sesame oils or mixtures of such materials and the like. In addition to these inert diluents, the compositions can also contain adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

Suspensions, in addition to the active ingredients, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these materials, and the like.

Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols and suitable mixtures thereof. Generally, the therapeutic compositions can be prepared as injectables, e.g., as liquid solutions or suspensions; solid forms suitable for constitution with a solution or suspension, or liquid carrier, before injection, may also be prepared.

When the pharmaceutical composition of the present invention is used for practical treatment, it may be in various dosage forms depending on the use case, preferably injection or liquid formulation.

When the pharmaceutical composition is used, a safe and effective amount of the compound of the present invention is suitable for mammals (such as human beings) to be treated, wherein the administration dose is a pharmaceutically-considered effective administration dose, and for a human body with a weight of 60kg, the daily administration dose is usually 1 to 2000mg, preferably 20 to 500 mg. Of course, the particular dosage will depend upon such factors as the route of administration, the health of the patient, and the like, and is within the skill of the skilled practitioner.

The pharmaceutical compositions of the invention may be administered alone or in combination with (e.g., formulated in the same pharmaceutical composition as) other therapeutic agents.

The pharmaceutical compositions of the present invention may also be combined with other agents known to treat or ameliorate similar conditions. When the combination is administered, the mode and dosage of administration of the original drug is maintained, while the pharmaceutical composition of the present invention is administered simultaneously or subsequently. The combination also includes administering the pharmaceutical composition of the present invention in an overlapping time period with one or more other known drugs. When the pharmaceutical composition of the present invention is administered in combination with one or more other drugs, the dosage of the pharmaceutical composition of the present invention or known drugs may be lower than the dosage when they are administered alone.

The main advantages of the invention

(1) The LaA-CAAR NK92MI provided by the invention can specifically kill the pathogenic B cells (memory B cells) expressing LaA-BCR, indirectly kill plasma cells secreting anti-LaA autoantibodies, thereby alleviating the damage of the autoantibodies to the organism, relieving the symptoms of autoimmune diseases, simultaneously not initiating wide immunosuppression, having no obvious killing effect on normal T cells and B cells, not influencing the normal immunologic function of the organism and having no side reaction.

(2) The LaA-CAAR NK provided by the invention has strong cytotoxic ability, short survival time after killing tumor cells, easy in-vitro amplification, low production cost and no risk of graft-versus-host reaction.

(3) The LaA-CAAR NK cell provided by the invention has strong cytolysis effect on LaA-BCR-Jurkat, and provides a research basis for further exploring CAAR-NK cell specificity killing autoreactive T cell lymphocyte in the future.

(4) After the La/SSB autoantigen is activated, the specific B cell epitope is only expressed on over-reacted B cells and memory B cells, so that the LaA-CAAR NK92MI provided by the invention has low off-target toxicity possibility in targeted therapy.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers. Unless otherwise indicated, percentages and parts are by weight.

General procedure

1. Cell lines and blood samples

Human T cell acute lymphoblastic leukemia Jurkat cell andhuman lymphoma cell lines Maver-1 and Romas cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum, HEK293T cells were cultured in DMEM medium containing 10% fetal bovine serum, NK92MI is an IL-2 independent natural killer cell line derived from stable expression of IL-2 in NK92 cell line by stable transfection method, MEM- α medium containing 0.2mM myo-inositol, 0.1mM β -mercaptoethanol, 0.02mM folic acid and 12.5% horse serum was used, these cell lines were all from ATCC, 100U/ml penicillin and 100. mu.g/ml streptomycin were added to the medium, and 37 ℃ medium containing 5% CO₂Cultured in an incubator.

Blood samples from patients and healthy persons who were strongly positive for La/SSB autoantibodies were collected after the consent of the applicant to participate in the study, also with the consent of the ethical committee of the university of suzhou.

2. Statistical analysis

Statistical analysis was done by GraphPad Prism software version 5.0. The Paired-T test was used to compare differences between groups, with P <0.05 considered statistically significant.

EXAMPLE 1 purification of 1LaA protein and LaA-BCR protein

1.1 Induction and purification of 1.1LaA protein

To induce expression of soluble LaA protein, the cDNA encoding the LaA protein was subcloned into the pET28a prokaryotic expression vector (LaA-pET28a) containing 6 × HIS (fig. 1B), and the 6 × HIS tag was used for protein purification. The LaA-pET28a plasmid was subsequently transformed into E.coli BL21(DE3) strain for culture.

LaA protein was induced and purified by picking LaA-pET28a monoclonal to grow overnight at 37 ℃ in 3mL LB medium containing 100. mu.g/mL kanamycin, then continuing the culture in fresh medium containing 100. mu.g/mL kanamycin, at the early log phase of the bacteria (OD 0.6-0.8) adding 0.5 mMisopropopy β -D-1-thiogalactopyraside (IPTG, Sangon Biotech) for 2.5-3 hours at 37 ℃, then LaA protein was purified by Ni-NTA agar (GE Healthcare Life Sciences PBS) according to the reagent instructions, imidazole was dialyzed overnight at 4 ℃ to remove the molecular weight and purity of the protein using sodium didecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) detection kit, and LaA protein was used as a negative control for detecting protein concentration (BCA. As a further test kit).

LaA soluble protein was purified by His La/SSB tag, and SDS-PAGE gel stained with Coomassie Brilliant blue showed a single band around 15kd (FIG. 1C).

1.2 construction, expression, purification and identification of 1.2LaA-BCR protein

The gene LaA-BCR was synthesized and a tandem signal domain comprising the Signal Peptide (SP), the heavy chain (VH) variable region of LaA-BCR, the G4S linker, and the light chain (VL) variable region of LaA-BCR was ligated into the pfuse-hIgG1-Fc eukaryotic expression vector (purchased from Invivogen) and constructed to be designated LaA-BCR-pfuse-hIgG1-Fc (FIG. 1A). LaA-BCR-pfuse-hIgG1-Fc vector was ligated following plasmid: HEK293T cells were transfected with the ratio of liposomes 1: 2. Transfected cell supernatants were collected 48h after transfection. Cell supernatants collected after transfection were centrifuged at 13000rpm for 15 min, respectively. The cell supernatant was added with 10 sodium acetate solution, 10 sodium acetate was added as per cell supernatant: 10 × sodium acetate ═ 9: 1, and adjusting the pH to 5.0. The cell supernatant with added sodium acetate was purified using Protein G according to the instructions of the reagents. The purified LaA-BCR protein is detected by using FC antibody Western blot, and the protein concentration is detected by using a BCA detection kit (Beyotime). A non-LaA-BCR protein was additionally purified as a negative control.

LaA-BCR soluble protein was purified and concentrated by protein G column, and SDS-PAGE gel stained with Coomassie blue showed a single band around 55kd (FIG. 1D).

Example 2 LaA-determination of the affinity of BCR protein for LaA antigen

Purified LaA antigen added to 5 xSDS-PAGE loading buffer (P0015L, Beyotime, Shanghai, China) and non-LaA protein as a negative control were used as samples, and after 12% SDS-PAGE separation, proteins on SDS-PAGE were transferred to PDVF membrane (IPVH00010, Millipore, MA), 5% skim milk was blocked at room temperature for 1 hour (Guingming, Shanghai, China), and then incubated overnight at 4 ℃ with purified LaA-BCR protein, followed by three washes with PBST containing 0.1% Tween-20, and PVDF membrane was incubated with a horseradish peroxidase-conjugated anti-mouse IgG (H + L) secondary antibody (A10677, Life Technologies, CA). After three PBST washes, PDVF membrane chemiluminescence was visualized by application of an enhanced chemiluminescence kit (WBKLS0500, Millipore Corporation, MA).

The purified LaA protein was coated onto ELISA plates overnight at 4 ℃. The plate was washed three times with PBS, a series of dilutions of LaA-BCR protein and non-LaA-BCR protein as a negative control were added to the plate, followed by three washes with PBST containing 0.1% Tween-20, and incubation with a horragraph peroxidase-conjugated anti-mouse IgG (H + L) secondary antibody (A10677, Life Technologies, Calif.). Finally, color development was performed using 3,3 ', 5, 5' -tetramethylbenzidine (TMB, WBKLS0500, Millipore Corporation, MA). ELISA titers were determined at 450nm using an ELISA microplate reader (IVD10, Spectremax).

The results are shown in fig. 1E and 1F, respectively, and indicate that: LaA antigen and LaA-BCR protein have good affinity, and the two proteins can be specifically combined, so that the LaA-CAAR NK92MI can kill LaA-BCR positive tumor cell strains in vitro.

Example 3 construction, characterization and functional validation of 3 LaA-CAAR NK92MI cells

3.1 structural design of 3.1LaA-CAAR and Lentiviral transfection

LaA-CAAR molecular structure design includes: a transmembrane signal peptide of CD8 is guided to LaA-CAAR to be expressed on the surface of NK92MI cell, LaA antigen fragment is used as an extracellular fragment, F_CThe linker fragment, CD28 molecule (comprising a transmembrane region), 4-1BB costimulatory factor, and CD3 zeta signalThe regions are joined to form a fusion protein (FIG. 2A). LaA-CAAR fusion proteins comprise: leader sequence, LaA peptide, hinge domain (FC), CD28 transmembrane domain TM, two costimulatory domains (CD28 and 4-1BB) and CD3 zeta intracellular signal domain.

SP-LaA-Fc-CD28/TM-4-1BB-CD3 zeta fusion gene sequence is synthesized by gene, and then the fusion gene sequence is constructed into pCDH-CMV-MCS-EF1-CopPuro (System biosciences) lentivirus expression vector, 293T cell plating, packaging plasmids △ R6.5 mu g, V-VSG3.5 mu g, Rev2.5 mu g and target plasmids 10 mu g in CaCl₂Under the action of (3), transfecting 293T cells; changing fresh culture medium after 12 hours; then, collecting the virus once in 24h and 48h respectively; finally, the virus was concentrated by ultracentrifugation at 25000 rpm. NK92MI cell count (1X 10)⁶) After incubation with lentivirus supernatant (MOI ═ 30) at 37 degrees for 4-6 hours, the virus supernatant was removed and culture was continued in MEM- α medium containing 12.5% horse serum.

3.2 detection of LaA-CAAR expression in NK92MI cells

Three days after lentiviral transfection of NK92MI cells, transfected NK92MI cells were analyzed for FC-positive cell rate using facscalibur (bd), with control NK92MI plus FC antibody, and no non-specific staining with FC antibody. Cells were washed three times with PBS and resuspended with PBS prior to flow detection. LaA-CAAR positive NK92MI cells were enriched by flow cytometric cell sorter (BD) and screened with puromycin at 1. mu.g/ml, so that CAAR was stably expressed on the surface of NK92MI cells for 4-6 months. Expression of LaA-CAAR in NK92MI cells was also analyzed by Western blot. NK92MI and LaA-CAAR NK92MI cells were lysed, separated by SDS-PAGE under reducing and non-reducing conditions, and finally tested for CD3 ζ expression using murine monoclonal antibodies.

The results are shown in FIGS. 2B-2D. As can be seen from FIG. 2C, the expression of LaA-CAAR on the surface of NK92MI cells was more than 90%. As shown in FIG. 2D, the mean fluorescence intensity of LaA-CAAR NK92MI was more than 200 times that of control NK92 MI. As can be seen in FIG. 2B, under reducing conditions, expression of endogenous CD3 ζ, approximately 16kDa, was detected in both NK92MI (lane 1) and LaA-CAAR NK92 (lane 2) cells. A band around 65kDa appeared only in LaA-CAAR NK92MI cells (lane 2). Under non-reducing conditions, an additional series of bands appeared in LaA-CAAR NK92MI cells (lane 4) and not in the parallel control NK92MI cells (lane 3), indicating homodimers between LaA-CAAR and heterodimers between LaA-CAAR and endogenous CD3 ζ. Both monomeric and homodimeric CD3 ζ were detected in NK92MI and LaA-CAAR NK92MI cells. The result shows that LaA-CAAR can stably express LaA-CAAR structure in the constructed LaA-CAAR NK92MI cell.

Example 4 construction of 4 LaA-BCR Stable tumor cell lines

In order to simulate the killing effect of NK92MI cells on B cells which are fatally and excessively activated in vitro, the invention constructs a tumor cell strain with a stable membrane expression LaA-BCR structure as a target cell. To more effectively evaluate the killing effect on lethal B cells, LaA-BCR stable membrane was expressed on B cell-derived tumor cell lines (Rmoas and Maver-1) with B cell characteristics. Moreover, LaA-BCR stable membrane was also expressed on T cell-derived tumor cell line (Jurkat) having T cell characteristics, and it was confirmed whether LaA-CAAR has the same killing effect on T cell-derived tumor cells. LaA-BCR has a structure comprising: signal peptide directing stable membrane expression of LaA-BCR, LaA-BCR heavy and light chain variable regions, FC fragment and transmembrane fragment (fig. 3A). LaA-BCR is connected into PCDH-CMV-MCS-EF1 slow virus expression vector, the virus is packaged and concentrated to stably transfect Romas, Maver-1 and Jurkat tumor cells, after flow sorting and puromycin pressure screening, tumor cell strains (comprising LaA-BCR-Romas, LaA-BCR-Maver-1 and LaA-BCR-Jurkat) with stable membrane expression are obtained, and FC flow antibody is used for detecting the expression of LaA-BCR on the Romas, Maver-1 and Jurkat tumor cells.

As can be seen from FIG. 3B, the expression rates of LaA-BCR on Romas, Maver-1 and Jurkat tumor cells were all more than 90%. The mean fluorescence intensities of LaA-BCR-Romas, LaA-BCR-Maver-1, and LaA-BCR-Jurkat were 600 times 100-fold higher than those of the control group (FIGS. 3C-E).

Example 5 LaA-CAAR NK92MI has potent cytotoxic effect on LaA-BCR positive tumor cells

5.1LaA-CAAR NK92MI and selection of tumor cell markers

In examples 3 and 4, the expression of constructed LaA-CAAR on NK92MI cells was more than 90%, and the expression of LaA-BCR on Romas, Maver-1 and Jurkat was also more than 90%. This example demonstrates that CD56 is more than 90% expressed on the surface of NK92MI cells, but not expressed on Romas, Maver-1 and Jurkat; CD19 and CD3 were expressed above 90% on the surface of Romas, Maver-1 and Jurkat cells, respectively, but not on NK92MI cells, where the control was cells without antibody staining (fig. 4).

Thus, CD56 was selected as a marker for NK92MI cells, CD19 as a marker for Romas and Maver-1 cells, and CD3 as a marker for Jurkat cells.

5.2 cytotoxic Effect of 5.2LaA-CAAR NK92MI on LaA-BCR-positive tumor cells

To evaluate the cytotoxic effect of LaA-CAAR NK92MI on LaA-BCR positive tumor cells, tumor cells were co-cultured with LaA-CAAR NK92 MI. LaA-BCR positive tumor cells and NK92MI cells are co-cultured for 6 hours, and then are incubated for 30min-1hr by using flow antibodies of CD56, CD3 and CD19, the survival rate of Jurkat cells is detected by using a CD3 antibody, and the survival rate of Romas and Maver-1 cells is detected by using a CD19 antibody, so that the death rate of the tumor cells is indirectly calculated.

The results show that the effective target ratio E: T ═ 1:1, after co-culturing LaA-CAAR NK92MI cells with B cell derived tumor cells LaA-BCR-Romas and LaA-BCR-Maver-1 for 6 hours, LaA-CAAR NK92MI killed approximately 60% of LaA-BCR-Romas cells (FIG. 5A, C); the killing rate of LaA-BCR-Maver-1 cells was approximately 70% (FIG. 5E, F). When the high target ratio E: T ═ 2:1 was increased, LaA-CAAR NK92MI killed LaA-BCR-Romas to LaA-BCR-Maver-1 cells at a rate approaching 90% (fig. 5B, D to fig. 5G, H), showing a stronger cytotoxic effect. LaA-CAAR NK92MI cells and T cell derived tumor cells LaA-BCR-Jurkat are co-cultured for 6-8h and then detected, wherein the ratio of E to T is 1: at 1, LaA-CAAR NK92MI killed approximately 70% of the tumor cells (FIG. 6A, C); e, T is 2:1, approximately 80% of the cells were killed (fig. 6B, D). It can be seen that LaA-CAAR NK92MI has stronger cytotoxic effect on LaA-BCR-expressing tumor cells, and the cytotoxic effect is more obvious along with the increase of the effective target ratio.

5.2 proliferation of 5.2LaA-CAAR NK92MI cells

In addition, when NK92MI, LaA-CAAR NK92MI were co-cultured with tumor cells, proliferation of NK92MI and LaA-CAAR NK92MI cells was simultaneously examined. Will be 1 × 10⁶The NK92MI cells and LaA-CAAR NK92MI cells were seeded in a six-well plate (Costar). NK92MI and LaA-CAAR NK92MI were stained with CFSE, Jurakt, LaA-BCR-Jurkat, Maver-1, LaA-BCR-Maver-1, Romas and LaA-BCR-Romas with a c: T ═ 2:1 in a ratio co-cultured with NK92MI and LaA-CAAR-NK92MI cells. Four days later, the relative proliferation levels (mean fluorescence intensity MFI) of NK92MI and LaA-CAAR NK92MI were examined using flow-through technology.

As can be seen in FIG. 7, the tumor cell lines in vitro did not stimulate the proliferation of NK92 and LaA-CAAR NK92MI cells. This shows that LaA-CAAR NK92MI cells have good safety, and provide powerful safety basis for clinical trials.

Example 6 LaA-CAAR NK92MI specific targeting and killing of B cells of a Primary LaA antibody Strong Positive autoimmune patient

In the embodiment, the deletion condition of LaA-CAAR NK92MI on the whole blood B cells of patients with autoimmune diseases is detected in vitro by adopting an autologous whole blood B cell deletion determination method, so that the killing effect of LaA-CAAR NK92MI on B cells expressing LaA-BCR is evaluated. Blood samples of three autoimmune disease patients strongly positive for the autoantibody La/SSB were collected, and the ratios of LaA-BCR positive B cells in the blood of the autoimmune disease patients were measured using LaA-HIS antigen and were 11.5%, 14%, and 13.4%, respectively (FIG. 8).

NK92MI and LaA-CAAR NK92MI were marked with CFSE staining and were mixed with fresh blood of 200ul of strongly positive patients with La/SSB autoantibodies in a 5% CO content₂After 24 hours of co-culture in an incubator at 37 ℃, the BD erythrocyte lysate lyses erythrocytes after 30min incubation using antibodies CD3, CD45, and CD 19. Collecting 1X 10⁴Individual lymphocytes (CFSE-/CD45+) and the data were analyzed using the flow analysis software FlowJo.

The percentage of B cell depletion due to LaA-CAAR-NK92MI was defined as the cytotoxicity index (CTI) and calculated by the following formula:

LaA-CAAR-NK92MI CTI ═ 100/B cell: T cell ratio in the sample without LaA-CAAR-NK92MI cells (B cell: T cell ratio in the sample with LaA-CAAR-NK92MI cells) ].

The control group to which samples of NK92MI and LaA-BCR-NK92MI were not added had the percentage of B cell loss set to 0.

The results show that compared with the NK92MI experimental group, the LaA-CAAR NK92MI experimental group causes about 25% of B cell loss (FIG. 9A, D), which indicates that LaA-CAAR NK92MI can specifically kill LaA-BCR-expressing memory B cells, indirectly kill plasma cells secreting anti-La/SSB autoantibodies, thereby alleviating the damage of the autoantibodies to the organism and relieving the symptoms of autoimmune diseases.

NK92MI and LaA-CAAR NK92MI did not kill normal T cells in the blood of patients (FIG. 9B); NK92MI also showed no significant killing of normal B cells in the blood of patients compared to the control group (fig. 9C).

In addition, blood samples of 3 healthy patients were collected at the same time, and the experimental method was the same as above. The results showed that NK92MI and LaA-CAAR NK92MI did not kill normal T and B cells in healthy patients (FIG. 10).

Discussion of the related Art

In recent years, CAR therapy has become a very desirable means of treating various hematologic malignancies. To date, great progress has been made in the treatment of various B cell derived malignancies using CD19 CARs, which have been validated through clinical trials and are significantly efficacious. However, autoimmune diseases are complex and difficult to treat, and the body is damaged by the fact that the body recognizes self-antigens and secretes high-titer autoantibodies, so that no good treatment standard exists at present, and an effective treatment scheme is lacked. There have been few attempts to apply CARs to treat autoimmune diseases.

Currently, there is an increasing focus on the function of B cells for the treatment of autoimmune diseases. The most representative of them is the targeted B cell deletion experiment of CD20 monoclonal antibody (rituximab), which has achieved certain curative effect in Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA) and Pemphigus Vulgaris (PV), but CD20 monoclonal antibody damages the immune system of the body while killing diseased B cells, and causes a series of side effects, such as fatal infection.

The article reports that the application of CAR-T technology to the treatment of pemphigus vulgaris has a certain effect both in vitro and in mouse models of pemphigus vulgaris. However, in autoimmune diseases, the immune system of the whole body is disturbed, T, B cells function abnormally. Studies have shown an increase in the number of Th helper cells (CD4+), a decrease in the number of Treg cells, and an increase in the number of memory B cells with the ability to differentiate into plasma cells in SLE. In addition, the number and activity of CD8+ that exert cytotoxic effects decreases with increasing follicular helper T cells (TFH). Thus, the use of autologous CAR-T cells to treat autoimmune diseases is not an ideal option, whereas allogeneic CAR-T cell therapy does not avoid graft-versus-host reaction (GvDH).

In autoantibody-mediated autoimmune diseases, depending on the specificity of the B Cell Receptor (BCR), autoantigen-based chimeric immunoreceptors can directly target NK92MI cells to kill over-reactive B cells. The invention reedits NK92MI cells to express an anti-chimeric antibody modified structure (CAAR) which comprises autoimmune disease autoantigen La/SSB and CD28-4-1BB-CD3 zeta signaling domain. The La/SSB chimera antigen-modified NK92MI (La/SSB-CAAR NK92MI) cells can specifically and effectively kill B cell-derived tumor cells (LaA-BCR-Romas, LaA-BCR-Maver-1) and T cell-derived tumor cells (LaA-BCR-Jurkat) which specifically express anti-La/SSB cell receptor (La/SSB-BCR). In addition, the La/SSB chimera antigen-modified NK92 cell (La/SSB-CAAR NK92MI) can also cause the deletion of B cells in blood samples of patients with autoimmune diseases with strong positive La/SSB autoantibodies, and this phenomenon indicates that the La/SSB chimera antigen-modified NK92 cell (La/SSB-CAAR NK92MI) can directly kill B cells expressing anti-La/SSB BCR hyper-reactivity (La/SSB-BCR-B) and indirectly kill plasma cells secreting La/SSB autoantibodies.

CAAR therapy is able to exert the greatest cytolytic effect, one of the most important factors being the specific binding of antigen and antibody and their functional validation. The invention firstly verifies that LaA antigen can be specifically combined with LaA-BCR sequence and has better affinity. LaA-CAAR NK92MI cells were then verified to have strong cytolytic effects on LaA-BCR-Romas and LaA-BCR-Maver-1 tumor cells (E: T ═ 2: 1). The immune damage mechanism of autoimmune diseases includes autoimmune diseases mediated by autoreactive T lymphocytes, such as (insulin-dependent diabetes mellitus, IDDM), in addition to autoimmune diseases caused by autoantibodies. Therefore, the tumor cell strain LaA-BCR-Jurkat derived from the T cells is selected as a target cell, and the result shows that the LaA-CAAR NK92MI cell has strong cytolysis effect on LaA-BCR-Jurkat. This provides the basis for further research on the specific killing of autoreactive T cell lymphocytes by CAAR NK92 MI. The invention collects the blood of a patient with systemic lupus erythematosus or Sjogren syndrome with strong positive La/SSB autoantibodies, firstly detects the expression condition of LaA-BCR in B cells, and then cocultures with LaA-CAAR NK92MI overnight, and finds that LaA-CAAR NK92MI has strong cytolysis effect on LaA-BCR-B cells, but has no killing effect on normally functional T and B cells.

Overall, LaA-CAAR NK92MI effector cells targeted only elimination of pathogenic B cells (memory B cells) with LaA-specific BCR, indirectly inhibiting plasma cell secretion of anti-La/SSB autoantibodies. The pathogenesis of autoimmune diseases is still unknown, and the variety of autoantibodies in the body is great. A novel targeting treatment strategy with high clinical application feasibility is explored, and meanwhile, an important research basis is provided for the combined targeting treatment of autoimmune diseases caused by multiple antibodies by various CAARs. Thus, CAAR NK cell therapy is an innovative targeted therapy approach, avoiding the risk of immunosuppression of the body.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Bosheng Ji pharmaceutical technology (Suzhou) Co., Ltd

<120> La/SSB chimera antigen-modified NK cell, preparation method and application thereof

<130>P2017-1227

<160>2

<170>PatentIn version 3.5

<210>1

<211>581

<212>PRT

<213> Artificial sequence (artificial sequence)

<400>1

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Met Ala Glu Asn Gly Asp Asn Glu Lys Met

20 25 30

Ala Ala Leu Glu Ala Lys Ile Cys His Gln Ile Glu Tyr Tyr Phe Gly

35 40 45

Asp Phe Asn Leu Pro Arg Asp Lys Phe Leu Lys Glu Gln Ile Lys Leu

50 55 60

Asp Glu Gly Trp Val Pro Leu Glu Ile Met Ile Lys Phe Asn Arg Leu

65 70 75 80

Asn Arg Leu Thr Thr Asp Phe Asn Val Ile Val Glu Ala Leu Ser Lys

85 90 95

Ser Lys Ala Glu Leu Met Glu Ile Ser Glu Asp Lys Thr Lys Ile Arg

100 105 110

Arg Ser Pro Ser Lys Pro Leu Pro Glu Val Thr Asp Glu Tyr Lys Asn

115 120 125

Asp Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu

130 135 140

Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

145 150 155 160

Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp

165 170 175

Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly

180 185 190

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn

195 200 205

Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp

210 215 220

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro

225 230 235 240

SerSer Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu

245 250 255

Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn

260 265 270

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

275 280 285

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

290 295 300

Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg

305 310 315 320

Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys

325 330 335

Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu

340 345 350

Ser Leu Ser Leu Gly Lys Met Phe Trp Val Leu Val Val Val Gly Gly

355 360 365

Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe

370 375 380

Trp Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn

385 390 395 400

Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr

405 410 415

Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Lys Arg Gly Arg Lys

420 425 430

Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr

435 440 445

Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu

450 455 460

Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro

465 470 475 480

Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly

485 490 495

Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro

500 505 510

Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr

515 520 525

Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly

530 535 540

Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln

545 550 555 560

Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln

565 570 575

Ala Leu Pro Pro Arg

580

<210>2

<211>1746

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>2

atgctgctcc tggtgacctc cctgctgctg tgtgaactcc cccaccccgc tttcctgctg 60

atccccatgg ctgaaaatgg tgataatgaa aagatggctg ccctggaggc caaaatctgt 120

catcaaattg agtattattt tggcgacttc aatttgccac gggacaagtt tctaaaggaa 180

cagataaaac tggatgaagg ctgggtacct ttggagataa tgataaaatt caacaggttg 240

aaccgtctaa caacagactt taatgtaatt gtggaagcat tgagcaaatc caaggcagaa 300

ctcatggaaa tcagtgaaga taaaactaaa atcagaaggt ctccaagcaa acccctacct 360

gaagtgactg atgagtataa aaatgatgag agcaagtacg gccctccctg ccccccttgc 420

cctgcccccg agttcctggg cggacccagc gtgttcctgt tcccccccaa gcccaaggac 480

accctgatga tcagccggac ccccgaggtg acctgtgtgg tggtggacgt gtcccaggag 540

gaccccgagg tccagttcaa ctggtacgtg gacggcgtgg aggtgcacaa cgccaagacc 600

aagccccggg aggagcagtt caatagcacc taccgggtgg tgtccgtgct gaccgtgctg 660

caccaggact ggctgaacgg caaggaatac aagtgtaagg tgtccaacaa gggcctgccc 720

agcagcatcg agaaaaccat cagcaaggcc aagggccagc ctcgggagcc ccaggtgtac 780

accctgcccc ctagccaaga ggagatgacc aagaatcagg tgtccctgac ctgcctggtg 840

aagggcttct accccagcga catcgccgtg gagtgggaga gcaacggcca gcccgagaac 900

aactacaaga ccaccccccc tgtgctggac agcgacggca gcttcttcct gtacagcagg 960

ctgaccgtgg acaagagccg gtggcaggag ggcaacgtct ttagctgctc cgtgatgcac 1020

gaggccctgc acaaccacta cacccagaag agcctgtccc tgagcctggg caagatgttc 1080

tgggtgctgg tcgtggtggg tggcgtgctg gcctgctaca gcctgctggt gacagtggcc 1140

ttcatcatct tttgggtgag gagcaagcgg agcagaggcg gccacagcga ctacatgaac 1200

atgacccccc ggaggcctgg ccccacccgg aagcactacc agccctacgc ccctcccagg 1260

gacttcgccg cctaccggag caaacggggc agaaagaaac tcctgtatat attcaaacaa 1320

ccatttatga gaccagtaca aactactcaa gaggaagatg gctgtagctg ccgatttcca 1380

gaagaagaag aaggaggatg tgaactgcgg gtgaagttca gccggagcgc cgacgcccct 1440

gcctaccagc agggccagaa ccagctgtac aacgagctga acctgggccg gagggaggag 1500

tacgacgtgc tggacaagcg gagaggccgg gaccctgaga tgggcggcaa gccccggaga 1560

aagaaccctc aggagggcct gtataacgaa ctgcagaaag acaagatggc cgaggcctac 1620

agcgagatcg gcatgaaggg cgagcggcgg aggggcaagg gccacgacgg cctgtaccag 1680

ggcctgagca ccgccaccaa ggatacctac gacgccctgc acatgcaggc cctgcccccc 1740

agatga 1746

Claims

1. A fusion protein having the structure of formula I:

X₁-X₂-L₁-X₃-X₄-X₅(I)，

wherein,

X₁is a null or signal peptide sequence;

X₂is a LaA peptide;

L₁is a null or a linker peptide sequence;

X₃is a transmembrane domain;

X₄is a co-stimulation element;

X₅is the cytoplasmic signaling sequence CD3 ζ;

"-" denotes a linker peptide or peptide bond linking the above elements.

2. The fusion protein of claim 1, wherein the polypeptide element X is₁Selected from the group consisting of:

(C) 1, 1-22 amino acid sequence is substituted, deleted or added by 1-5 amino acid residues to form derivative polypeptide; and/or

Said polypeptide element X₂Selected from the group consisting of:

(C) 1, the amino acid sequence shown in the 23 rd to 129 th positions is substituted, deleted or added by 1 to 5 amino acid residues to form derivative polypeptide; and/or

The polypeptide element L₁Selected from the group consisting of:

(C) a derivative polypeptide formed by substituting, deleting or adding 1-5 amino acid residues of the amino acid sequence shown in the 130-359 position in the SEQ ID NO. 1; and/or

Said polypeptide element X₃Selected from the group consisting of:

(C) a derivative polypeptide formed by substituting, deleting or adding 1-5 amino acid residues of the amino acid sequence shown in the 360-427 position in the SEQ ID NO. 1; and/or

Said polypeptide element X₄Selected from the group consisting of:

(C) a derivative polypeptide formed by substituting, deleting or adding 1-5 amino acid residues of the amino acid sequence shown in the 428-th and 469 th positions in the SEQ ID NO. 1; and/or

Said polypeptide element X₅Selected from the group consisting of:

3. The fusion protein of claim 1, wherein the fusion protein has an amino acid sequence as set forth in SEQ ID No. 1.

4. A polynucleotide encoding the fusion protein of claim 1.

5. A vector comprising the polynucleotide of claim 4.

6. A host cell expressing the fusion protein of claim 1; and/or

The host cell genome having integrated therein an exogenous polynucleotide of claim 4; and/or

The host cell comprising the vector of claim 5.

7. A genetically engineered NK cell, wherein the NK cell is a mammalian NK cell and the fusion protein of claim 1 is expressed on the cell membrane of the NK cell.

8. A pharmaceutical composition, wherein the composition comprises: the fusion protein of claim 1, the polynucleotide of claim 4, the vector of claim 5, or the NK cell of claim 7, and a pharmaceutically acceptable carrier or excipient.

9. Use of the fusion protein of claim 1, the polynucleotide of claim 4, the vector of claim 5, or the NK cell of claim 7 for the preparation of a medicament or formulation for the treatment of an autoimmune disease.

10. A method of producing the NK cell of claim 7, comprising the steps of: transferring the polynucleotide of claim 4 or the vector of claim 5 into an NK cell, thereby obtaining the NK cell.